text
stringlengths
7
328k
id
stringlengths
14
166
metadata
dict
__index_level_0__
int64
0
471
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # 🧨 Diffusers’ Ethical Guidelines ## Preamble [Diffusers](https://huggingface.co/docs/diffusers/index) provides pre-trained diffusion models and serves as a modular toolbox for inference and training. Given its real case applications in the world and potential negative impacts on society, we think it is important to provide the project with ethical guidelines to guide the development, users’ contributions, and usage of the Diffusers library. The risks associated with using this technology are still being examined, but to name a few: copyrights issues for artists; deep-fake exploitation; sexual content generation in inappropriate contexts; non-consensual impersonation; harmful social biases perpetuating the oppression of marginalized groups. We will keep tracking risks and adapt the following guidelines based on the community's responsiveness and valuable feedback. ## Scope The Diffusers community will apply the following ethical guidelines to the project’s development and help coordinate how the community will integrate the contributions, especially concerning sensitive topics related to ethical concerns. ## Ethical guidelines The following ethical guidelines apply generally, but we will primarily implement them when dealing with ethically sensitive issues while making a technical choice. Furthermore, we commit to adapting those ethical principles over time following emerging harms related to the state of the art of the technology in question. - **Transparency**: we are committed to being transparent in managing PRs, explaining our choices to users, and making technical decisions. - **Consistency**: we are committed to guaranteeing our users the same level of attention in project management, keeping it technically stable and consistent. - **Simplicity**: with a desire to make it easy to use and exploit the Diffusers library, we are committed to keeping the project’s goals lean and coherent. - **Accessibility**: the Diffusers project helps lower the entry bar for contributors who can help run it even without technical expertise. Doing so makes research artifacts more accessible to the community. - **Reproducibility**: we aim to be transparent about the reproducibility of upstream code, models, and datasets when made available through the Diffusers library. - **Responsibility**: as a community and through teamwork, we hold a collective responsibility to our users by anticipating and mitigating this technology's potential risks and dangers. ## Examples of implementations: Safety features and Mechanisms The team works daily to make the technical and non-technical tools available to deal with the potential ethical and social risks associated with diffusion technology. Moreover, the community's input is invaluable in ensuring these features' implementation and raising awareness with us. - [**Community tab**](https://huggingface.co/docs/hub/repositories-pull-requests-discussions): it enables the community to discuss and better collaborate on a project. - **Bias exploration and evaluation**: the Hugging Face team provides a [space](https://huggingface.co/spaces/society-ethics/DiffusionBiasExplorer) to demonstrate the biases in Stable Diffusion interactively. In this sense, we support and encourage bias explorers and evaluations. - **Encouraging safety in deployment** - [**Safe Stable Diffusion**](https://huggingface.co/docs/diffusers/main/en/api/pipelines/stable_diffusion/stable_diffusion_safe): It mitigates the well-known issue that models, like Stable Diffusion, that are trained on unfiltered, web-crawled datasets tend to suffer from inappropriate degeneration. Related paper: [Safe Latent Diffusion: Mitigating Inappropriate Degeneration in Diffusion Models](https://arxiv.org/abs/2211.05105). - [**Safety Checker**](https://github.com/huggingface/diffusers/blob/main/src/diffusers/pipelines/stable_diffusion/safety_checker.py): It checks and compares the class probability of a set of hard-coded harmful concepts in the embedding space against an image after it has been generated. The harmful concepts are intentionally hidden to prevent reverse engineering of the checker. - **Staged released on the Hub**: in particularly sensitive situations, access to some repositories should be restricted. This staged release is an intermediary step that allows the repository’s authors to have more control over its use. - **Licensing**: [OpenRAILs](https://huggingface.co/blog/open_rail), a new type of licensing, allow us to ensure free access while having a set of restrictions that ensure more responsible use.
diffusers/docs/source/en/conceptual/ethical_guidelines.md/0
{ "file_path": "diffusers/docs/source/en/conceptual/ethical_guidelines.md", "repo_id": "diffusers", "token_count": 1155 }
100
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # Token merging [Token merging](https://huggingface.co/papers/2303.17604) (ToMe) merges redundant tokens/patches progressively in the forward pass of a Transformer-based network which can speed-up the inference latency of [`StableDiffusionPipeline`]. Install ToMe from `pip`: ```bash pip install tomesd ``` You can use ToMe from the [`tomesd`](https://github.com/dbolya/tomesd) library with the [`apply_patch`](https://github.com/dbolya/tomesd?tab=readme-ov-file#usage) function: ```diff from diffusers import StableDiffusionPipeline import torch import tomesd pipeline = StableDiffusionPipeline.from_pretrained( "runwayml/stable-diffusion-v1-5", torch_dtype=torch.float16, use_safetensors=True, ).to("cuda") + tomesd.apply_patch(pipeline, ratio=0.5) image = pipeline("a photo of an astronaut riding a horse on mars").images[0] ``` The `apply_patch` function exposes a number of [arguments](https://github.com/dbolya/tomesd#usage) to help strike a balance between pipeline inference speed and the quality of the generated tokens. The most important argument is `ratio` which controls the number of tokens that are merged during the forward pass. As reported in the [paper](https://huggingface.co/papers/2303.17604), ToMe can greatly preserve the quality of the generated images while boosting inference speed. By increasing the `ratio`, you can speed-up inference even further, but at the cost of some degraded image quality. To test the quality of the generated images, we sampled a few prompts from [Parti Prompts](https://parti.research.google/) and performed inference with the [`StableDiffusionPipeline`] with the following settings: <div class="flex justify-center"> <img src="https://huggingface.co/datasets/diffusers/docs-images/resolve/main/tome/tome_samples.png"> </div> We didn’t notice any significant decrease in the quality of the generated samples, and you can check out the generated samples in this [WandB report](https://wandb.ai/sayakpaul/tomesd-results/runs/23j4bj3i?workspace=). If you're interested in reproducing this experiment, use this [script](https://gist.github.com/sayakpaul/8cac98d7f22399085a060992f411ecbd). ## Benchmarks We also benchmarked the impact of `tomesd` on the [`StableDiffusionPipeline`] with [xFormers](https://huggingface.co/docs/diffusers/optimization/xformers) enabled across several image resolutions. The results are obtained from A100 and V100 GPUs in the following development environment: ```bash - `diffusers` version: 0.15.1 - Python version: 3.8.16 - PyTorch version (GPU?): 1.13.1+cu116 (True) - Huggingface_hub version: 0.13.2 - Transformers version: 4.27.2 - Accelerate version: 0.18.0 - xFormers version: 0.0.16 - tomesd version: 0.1.2 ``` To reproduce this benchmark, feel free to use this [script](https://gist.github.com/sayakpaul/27aec6bca7eb7b0e0aa4112205850335). The results are reported in seconds, and where applicable we report the speed-up percentage over the vanilla pipeline when using ToMe and ToMe + xFormers. | **GPU** | **Resolution** | **Batch size** | **Vanilla** | **ToMe** | **ToMe + xFormers** | |----------|----------------|----------------|-------------|----------------|---------------------| | **A100** | 512 | 10 | 6.88 | 5.26 (+23.55%) | 4.69 (+31.83%) | | | 768 | 10 | OOM | 14.71 | 11 | | | | 8 | OOM | 11.56 | 8.84 | | | | 4 | OOM | 5.98 | 4.66 | | | | 2 | 4.99 | 3.24 (+35.07%) | 2.1 (+37.88%) | | | | 1 | 3.29 | 2.24 (+31.91%) | 2.03 (+38.3%) | | | 1024 | 10 | OOM | OOM | OOM | | | | 8 | OOM | OOM | OOM | | | | 4 | OOM | 12.51 | 9.09 | | | | 2 | OOM | 6.52 | 4.96 | | | | 1 | 6.4 | 3.61 (+43.59%) | 2.81 (+56.09%) | | **V100** | 512 | 10 | OOM | 10.03 | 9.29 | | | | 8 | OOM | 8.05 | 7.47 | | | | 4 | 5.7 | 4.3 (+24.56%) | 3.98 (+30.18%) | | | | 2 | 3.14 | 2.43 (+22.61%) | 2.27 (+27.71%) | | | | 1 | 1.88 | 1.57 (+16.49%) | 1.57 (+16.49%) | | | 768 | 10 | OOM | OOM | 23.67 | | | | 8 | OOM | OOM | 18.81 | | | | 4 | OOM | 11.81 | 9.7 | | | | 2 | OOM | 6.27 | 5.2 | | | | 1 | 5.43 | 3.38 (+37.75%) | 2.82 (+48.07%) | | | 1024 | 10 | OOM | OOM | OOM | | | | 8 | OOM | OOM | OOM | | | | 4 | OOM | OOM | 19.35 | | | | 2 | OOM | 13 | 10.78 | | | | 1 | OOM | 6.66 | 5.54 | As seen in the tables above, the speed-up from `tomesd` becomes more pronounced for larger image resolutions. It is also interesting to note that with `tomesd`, it is possible to run the pipeline on a higher resolution like 1024x1024. You may be able to speed-up inference even more with [`torch.compile`](torch2.0).
diffusers/docs/source/en/optimization/tome.md/0
{ "file_path": "diffusers/docs/source/en/optimization/tome.md", "repo_id": "diffusers", "token_count": 3379 }
101
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # Overview 🤗 Diffusers provides a collection of training scripts for you to train your own diffusion models. You can find all of our training scripts in [diffusers/examples](https://github.com/huggingface/diffusers/tree/main/examples). Each training script is: - **Self-contained**: the training script does not depend on any local files, and all packages required to run the script are installed from the `requirements.txt` file. - **Easy-to-tweak**: the training scripts are an example of how to train a diffusion model for a specific task and won't work out-of-the-box for every training scenario. You'll likely need to adapt the training script for your specific use-case. To help you with that, we've fully exposed the data preprocessing code and the training loop so you can modify it for your own use. - **Beginner-friendly**: the training scripts are designed to be beginner-friendly and easy to understand, rather than including the latest state-of-the-art methods to get the best and most competitive results. Any training methods we consider too complex are purposefully left out. - **Single-purpose**: each training script is expressly designed for only one task to keep it readable and understandable. Our current collection of training scripts include: | Training | SDXL-support | LoRA-support | Flax-support | |---|---|---|---| | [unconditional image generation](https://github.com/huggingface/diffusers/tree/main/examples/unconditional_image_generation) [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/huggingface/notebooks/blob/main/diffusers/training_example.ipynb) | | | | | [text-to-image](https://github.com/huggingface/diffusers/tree/main/examples/text_to_image) | 👍 | 👍 | 👍 | | [textual inversion](https://github.com/huggingface/diffusers/tree/main/examples/textual_inversion) [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/huggingface/notebooks/blob/main/diffusers/sd_textual_inversion_training.ipynb) | | | 👍 | | [DreamBooth](https://github.com/huggingface/diffusers/tree/main/examples/dreambooth) [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/huggingface/notebooks/blob/main/diffusers/sd_dreambooth_training.ipynb) | 👍 | 👍 | 👍 | | [ControlNet](https://github.com/huggingface/diffusers/tree/main/examples/controlnet) | 👍 | | 👍 | | [InstructPix2Pix](https://github.com/huggingface/diffusers/tree/main/examples/instruct_pix2pix) | 👍 | | | | [Custom Diffusion](https://github.com/huggingface/diffusers/tree/main/examples/custom_diffusion) | | | | | [T2I-Adapters](https://github.com/huggingface/diffusers/tree/main/examples/t2i_adapter) | 👍 | | | | [Kandinsky 2.2](https://github.com/huggingface/diffusers/tree/main/examples/kandinsky2_2/text_to_image) | | 👍 | | | [Wuerstchen](https://github.com/huggingface/diffusers/tree/main/examples/wuerstchen/text_to_image) | | 👍 | | These examples are **actively** maintained, so please feel free to open an issue if they aren't working as expected. If you feel like another training example should be included, you're more than welcome to start a [Feature Request](https://github.com/huggingface/diffusers/issues/new?assignees=&labels=&template=feature_request.md&title=) to discuss your feature idea with us and whether it meets our criteria of being self-contained, easy-to-tweak, beginner-friendly, and single-purpose. ## Install Make sure you can successfully run the latest versions of the example scripts by installing the library from source in a new virtual environment: ```bash git clone https://github.com/huggingface/diffusers cd diffusers pip install . ``` Then navigate to the folder of the training script (for example, [DreamBooth](https://github.com/huggingface/diffusers/tree/main/examples/dreambooth)) and install the `requirements.txt` file. Some training scripts have a specific requirement file for SDXL, LoRA or Flax. If you're using one of these scripts, make sure you install its corresponding requirements file. ```bash cd examples/dreambooth pip install -r requirements.txt # to train SDXL with DreamBooth pip install -r requirements_sdxl.txt ``` To speedup training and reduce memory-usage, we recommend: - using PyTorch 2.0 or higher to automatically use [scaled dot product attention](../optimization/torch2.0#scaled-dot-product-attention) during training (you don't need to make any changes to the training code) - installing [xFormers](../optimization/xformers) to enable memory-efficient attention
diffusers/docs/source/en/training/overview.md/0
{ "file_path": "diffusers/docs/source/en/training/overview.md", "repo_id": "diffusers", "token_count": 1545 }
102
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # Controlled generation Controlling outputs generated by diffusion models has been long pursued by the community and is now an active research topic. In many popular diffusion models, subtle changes in inputs, both images and text prompts, can drastically change outputs. In an ideal world we want to be able to control how semantics are preserved and changed. Most examples of preserving semantics reduce to being able to accurately map a change in input to a change in output. I.e. adding an adjective to a subject in a prompt preserves the entire image, only modifying the changed subject. Or, image variation of a particular subject preserves the subject's pose. Additionally, there are qualities of generated images that we would like to influence beyond semantic preservation. I.e. in general, we would like our outputs to be of good quality, adhere to a particular style, or be realistic. We will document some of the techniques `diffusers` supports to control generation of diffusion models. Much is cutting edge research and can be quite nuanced. If something needs clarifying or you have a suggestion, don't hesitate to open a discussion on the [forum](https://discuss.huggingface.co/c/discussion-related-to-httpsgithubcomhuggingfacediffusers/63) or a [GitHub issue](https://github.com/huggingface/diffusers/issues). We provide a high level explanation of how the generation can be controlled as well as a snippet of the technicals. For more in depth explanations on the technicals, the original papers which are linked from the pipelines are always the best resources. Depending on the use case, one should choose a technique accordingly. In many cases, these techniques can be combined. For example, one can combine Textual Inversion with SEGA to provide more semantic guidance to the outputs generated using Textual Inversion. Unless otherwise mentioned, these are techniques that work with existing models and don't require their own weights. 1. [InstructPix2Pix](#instruct-pix2pix) 2. [Pix2Pix Zero](#pix2pix-zero) 3. [Attend and Excite](#attend-and-excite) 4. [Semantic Guidance](#semantic-guidance-sega) 5. [Self-attention Guidance](#self-attention-guidance-sag) 6. [Depth2Image](#depth2image) 7. [MultiDiffusion Panorama](#multidiffusion-panorama) 8. [DreamBooth](#dreambooth) 9. [Textual Inversion](#textual-inversion) 10. [ControlNet](#controlnet) 11. [Prompt Weighting](#prompt-weighting) 12. [Custom Diffusion](#custom-diffusion) 13. [Model Editing](#model-editing) 14. [DiffEdit](#diffedit) 15. [T2I-Adapter](#t2i-adapter) 16. [FABRIC](#fabric) For convenience, we provide a table to denote which methods are inference-only and which require fine-tuning/training. | **Method** | **Inference only** | **Requires training /<br> fine-tuning** | **Comments** | | :-------------------------------------------------: | :----------------: | :-------------------------------------: | :---------------------------------------------------------------------------------------------: | | [InstructPix2Pix](#instruct-pix2pix) | ✅ | ❌ | Can additionally be<br>fine-tuned for better <br>performance on specific <br>edit instructions. | | [Pix2Pix Zero](#pix2pix-zero) | ✅ | ❌ | | | [Attend and Excite](#attend-and-excite) | ✅ | ❌ | | | [Semantic Guidance](#semantic-guidance-sega) | ✅ | ❌ | | | [Self-attention Guidance](#self-attention-guidance-sag) | ✅ | ❌ | | | [Depth2Image](#depth2image) | ✅ | ❌ | | | [MultiDiffusion Panorama](#multidiffusion-panorama) | ✅ | ❌ | | | [DreamBooth](#dreambooth) | ❌ | ✅ | | | [Textual Inversion](#textual-inversion) | ❌ | ✅ | | | [ControlNet](#controlnet) | ✅ | ❌ | A ControlNet can be <br>trained/fine-tuned on<br>a custom conditioning. | | [Prompt Weighting](#prompt-weighting) | ✅ | ❌ | | | [Custom Diffusion](#custom-diffusion) | ❌ | ✅ | | | [Model Editing](#model-editing) | ✅ | ❌ | | | [DiffEdit](#diffedit) | ✅ | ❌ | | | [T2I-Adapter](#t2i-adapter) | ✅ | ❌ | | | [Fabric](#fabric) | ✅ | ❌ | | ## InstructPix2Pix [Paper](https://arxiv.org/abs/2211.09800) [InstructPix2Pix](../api/pipelines/pix2pix) is fine-tuned from Stable Diffusion to support editing input images. It takes as inputs an image and a prompt describing an edit, and it outputs the edited image. InstructPix2Pix has been explicitly trained to work well with [InstructGPT](https://openai.com/blog/instruction-following/)-like prompts. ## Pix2Pix Zero [Paper](https://arxiv.org/abs/2302.03027) [Pix2Pix Zero](../api/pipelines/pix2pix_zero) allows modifying an image so that one concept or subject is translated to another one while preserving general image semantics. The denoising process is guided from one conceptual embedding towards another conceptual embedding. The intermediate latents are optimized during the denoising process to push the attention maps towards reference attention maps. The reference attention maps are from the denoising process of the input image and are used to encourage semantic preservation. Pix2Pix Zero can be used both to edit synthetic images as well as real images. - To edit synthetic images, one first generates an image given a caption. Next, we generate image captions for the concept that shall be edited and for the new target concept. We can use a model like [Flan-T5](https://huggingface.co/docs/transformers/model_doc/flan-t5) for this purpose. Then, "mean" prompt embeddings for both the source and target concepts are created via the text encoder. Finally, the pix2pix-zero algorithm is used to edit the synthetic image. - To edit a real image, one first generates an image caption using a model like [BLIP](https://huggingface.co/docs/transformers/model_doc/blip). Then one applies DDIM inversion on the prompt and image to generate "inverse" latents. Similar to before, "mean" prompt embeddings for both source and target concepts are created and finally the pix2pix-zero algorithm in combination with the "inverse" latents is used to edit the image. <Tip> Pix2Pix Zero is the first model that allows "zero-shot" image editing. This means that the model can edit an image in less than a minute on a consumer GPU as shown [here](../api/pipelines/pix2pix_zero#usage-example). </Tip> As mentioned above, Pix2Pix Zero includes optimizing the latents (and not any of the UNet, VAE, or the text encoder) to steer the generation toward a specific concept. This means that the overall pipeline might require more memory than a standard [StableDiffusionPipeline](../api/pipelines/stable_diffusion/text2img). <Tip> An important distinction between methods like InstructPix2Pix and Pix2Pix Zero is that the former involves fine-tuning the pre-trained weights while the latter does not. This means that you can apply Pix2Pix Zero to any of the available Stable Diffusion models. </Tip> ## Attend and Excite [Paper](https://arxiv.org/abs/2301.13826) [Attend and Excite](../api/pipelines/attend_and_excite) allows subjects in the prompt to be faithfully represented in the final image. A set of token indices are given as input, corresponding to the subjects in the prompt that need to be present in the image. During denoising, each token index is guaranteed to have a minimum attention threshold for at least one patch of the image. The intermediate latents are iteratively optimized during the denoising process to strengthen the attention of the most neglected subject token until the attention threshold is passed for all subject tokens. Like Pix2Pix Zero, Attend and Excite also involves a mini optimization loop (leaving the pre-trained weights untouched) in its pipeline and can require more memory than the usual [StableDiffusionPipeline](../api/pipelines/stable_diffusion/text2img). ## Semantic Guidance (SEGA) [Paper](https://arxiv.org/abs/2301.12247) [SEGA](../api/pipelines/semantic_stable_diffusion) allows applying or removing one or more concepts from an image. The strength of the concept can also be controlled. I.e. the smile concept can be used to incrementally increase or decrease the smile of a portrait. Similar to how classifier free guidance provides guidance via empty prompt inputs, SEGA provides guidance on conceptual prompts. Multiple of these conceptual prompts can be applied simultaneously. Each conceptual prompt can either add or remove their concept depending on if the guidance is applied positively or negatively. Unlike Pix2Pix Zero or Attend and Excite, SEGA directly interacts with the diffusion process instead of performing any explicit gradient-based optimization. ## Self-attention Guidance (SAG) [Paper](https://arxiv.org/abs/2210.00939) [Self-attention Guidance](../api/pipelines/self_attention_guidance) improves the general quality of images. SAG provides guidance from predictions not conditioned on high-frequency details to fully conditioned images. The high frequency details are extracted out of the UNet self-attention maps. ## Depth2Image [Project](https://huggingface.co/stabilityai/stable-diffusion-2-depth) [Depth2Image](../api/pipelines/stable_diffusion/depth2img) is fine-tuned from Stable Diffusion to better preserve semantics for text guided image variation. It conditions on a monocular depth estimate of the original image. ## MultiDiffusion Panorama [Paper](https://arxiv.org/abs/2302.08113) [MultiDiffusion Panorama](../api/pipelines/panorama) defines a new generation process over a pre-trained diffusion model. This process binds together multiple diffusion generation methods that can be readily applied to generate high quality and diverse images. Results adhere to user-provided controls, such as desired aspect ratio (e.g., panorama), and spatial guiding signals, ranging from tight segmentation masks to bounding boxes. MultiDiffusion Panorama allows to generate high-quality images at arbitrary aspect ratios (e.g., panoramas). ## Fine-tuning your own models In addition to pre-trained models, Diffusers has training scripts for fine-tuning models on user-provided data. ## DreamBooth [Project](https://dreambooth.github.io/) [DreamBooth](../training/dreambooth) fine-tunes a model to teach it about a new subject. I.e. a few pictures of a person can be used to generate images of that person in different styles. ## Textual Inversion [Paper](https://arxiv.org/abs/2208.01618) [Textual Inversion](../training/text_inversion) fine-tunes a model to teach it about a new concept. I.e. a few pictures of a style of artwork can be used to generate images in that style. ## ControlNet [Paper](https://arxiv.org/abs/2302.05543) [ControlNet](../api/pipelines/controlnet) is an auxiliary network which adds an extra condition. There are 8 canonical pre-trained ControlNets trained on different conditionings such as edge detection, scribbles, depth maps, and semantic segmentations. ## Prompt Weighting [Prompt weighting](../using-diffusers/weighted_prompts) is a simple technique that puts more attention weight on certain parts of the text input. ## Custom Diffusion [Paper](https://arxiv.org/abs/2212.04488) [Custom Diffusion](../training/custom_diffusion) only fine-tunes the cross-attention maps of a pre-trained text-to-image diffusion model. It also allows for additionally performing Textual Inversion. It supports multi-concept training by design. Like DreamBooth and Textual Inversion, Custom Diffusion is also used to teach a pre-trained text-to-image diffusion model about new concepts to generate outputs involving the concept(s) of interest. ## Model Editing [Paper](https://arxiv.org/abs/2303.08084) The [text-to-image model editing pipeline](../api/pipelines/model_editing) helps you mitigate some of the incorrect implicit assumptions a pre-trained text-to-image diffusion model might make about the subjects present in the input prompt. For example, if you prompt Stable Diffusion to generate images for "A pack of roses", the roses in the generated images are more likely to be red. This pipeline helps you change that assumption. ## DiffEdit [Paper](https://arxiv.org/abs/2210.11427) [DiffEdit](../api/pipelines/diffedit) allows for semantic editing of input images along with input prompts while preserving the original input images as much as possible. ## T2I-Adapter [Paper](https://arxiv.org/abs/2302.08453) [T2I-Adapter](../api/pipelines/stable_diffusion/adapter) is an auxiliary network which adds an extra condition. There are 8 canonical pre-trained adapters trained on different conditionings such as edge detection, sketch, depth maps, and semantic segmentations. ## Fabric [Paper](https://arxiv.org/abs/2307.10159) [Fabric](https://github.com/huggingface/diffusers/tree/442017ccc877279bcf24fbe92f92d3d0def191b6/examples/community#stable-diffusion-fabric-pipeline) is a training-free approach applicable to a wide range of popular diffusion models, which exploits the self-attention layer present in the most widely used architectures to condition the diffusion process on a set of feedback images.
diffusers/docs/source/en/using-diffusers/controlling_generation.md/0
{ "file_path": "diffusers/docs/source/en/using-diffusers/controlling_generation.md", "repo_id": "diffusers", "token_count": 6311 }
103
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # Load adapters [[open-in-colab]] There are several [training](../training/overview) techniques for personalizing diffusion models to generate images of a specific subject or images in certain styles. Each of these training methods produces a different type of adapter. Some of the adapters generate an entirely new model, while other adapters only modify a smaller set of embeddings or weights. This means the loading process for each adapter is also different. This guide will show you how to load DreamBooth, textual inversion, and LoRA weights. <Tip> Feel free to browse the [Stable Diffusion Conceptualizer](https://huggingface.co/spaces/sd-concepts-library/stable-diffusion-conceptualizer), [LoRA the Explorer](https://huggingface.co/spaces/multimodalart/LoraTheExplorer), and the [Diffusers Models Gallery](https://huggingface.co/spaces/huggingface-projects/diffusers-gallery) for checkpoints and embeddings to use. </Tip> ## DreamBooth [DreamBooth](https://dreambooth.github.io/) finetunes an *entire diffusion model* on just several images of a subject to generate images of that subject in new styles and settings. This method works by using a special word in the prompt that the model learns to associate with the subject image. Of all the training methods, DreamBooth produces the largest file size (usually a few GBs) because it is a full checkpoint model. Let's load the [herge_style](https://huggingface.co/sd-dreambooth-library/herge-style) checkpoint, which is trained on just 10 images drawn by Hergé, to generate images in that style. For it to work, you need to include the special word `herge_style` in your prompt to trigger the checkpoint: ```py from diffusers import AutoPipelineForText2Image import torch pipeline = AutoPipelineForText2Image.from_pretrained("sd-dreambooth-library/herge-style", torch_dtype=torch.float16).to("cuda") prompt = "A cute herge_style brown bear eating a slice of pizza, stunning color scheme, masterpiece, illustration" image = pipeline(prompt).images[0] image ``` <div class="flex justify-center"> <img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/load_dreambooth.png" /> </div> ## Textual inversion [Textual inversion](https://textual-inversion.github.io/) is very similar to DreamBooth and it can also personalize a diffusion model to generate certain concepts (styles, objects) from just a few images. This method works by training and finding new embeddings that represent the images you provide with a special word in the prompt. As a result, the diffusion model weights stay the same and the training process produces a relatively tiny (a few KBs) file. Because textual inversion creates embeddings, it cannot be used on its own like DreamBooth and requires another model. ```py from diffusers import AutoPipelineForText2Image import torch pipeline = AutoPipelineForText2Image.from_pretrained("runwayml/stable-diffusion-v1-5", torch_dtype=torch.float16).to("cuda") ``` Now you can load the textual inversion embeddings with the [`~loaders.TextualInversionLoaderMixin.load_textual_inversion`] method and generate some images. Let's load the [sd-concepts-library/gta5-artwork](https://huggingface.co/sd-concepts-library/gta5-artwork) embeddings and you'll need to include the special word `<gta5-artwork>` in your prompt to trigger it: ```py pipeline.load_textual_inversion("sd-concepts-library/gta5-artwork") prompt = "A cute brown bear eating a slice of pizza, stunning color scheme, masterpiece, illustration, <gta5-artwork> style" image = pipeline(prompt).images[0] image ``` <div class="flex justify-center"> <img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/load_txt_embed.png" /> </div> Textual inversion can also be trained on undesirable things to create *negative embeddings* to discourage a model from generating images with those undesirable things like blurry images or extra fingers on a hand. This can be an easy way to quickly improve your prompt. You'll also load the embeddings with [`~loaders.TextualInversionLoaderMixin.load_textual_inversion`], but this time, you'll need two more parameters: - `weight_name`: specifies the weight file to load if the file was saved in the 🤗 Diffusers format with a specific name or if the file is stored in the A1111 format - `token`: specifies the special word to use in the prompt to trigger the embeddings Let's load the [sayakpaul/EasyNegative-test](https://huggingface.co/sayakpaul/EasyNegative-test) embeddings: ```py pipeline.load_textual_inversion( "sayakpaul/EasyNegative-test", weight_name="EasyNegative.safetensors", token="EasyNegative" ) ``` Now you can use the `token` to generate an image with the negative embeddings: ```py prompt = "A cute brown bear eating a slice of pizza, stunning color scheme, masterpiece, illustration, EasyNegative" negative_prompt = "EasyNegative" image = pipeline(prompt, negative_prompt=negative_prompt, num_inference_steps=50).images[0] image ``` <div class="flex justify-center"> <img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/load_neg_embed.png" /> </div> ## LoRA [Low-Rank Adaptation (LoRA)](https://huggingface.co/papers/2106.09685) is a popular training technique because it is fast and generates smaller file sizes (a couple hundred MBs). Like the other methods in this guide, LoRA can train a model to learn new styles from just a few images. It works by inserting new weights into the diffusion model and then only the new weights are trained instead of the entire model. This makes LoRAs faster to train and easier to store. <Tip> LoRA is a very general training technique that can be used with other training methods. For example, it is common to train a model with DreamBooth and LoRA. It is also increasingly common to load and merge multiple LoRAs to create new and unique images. You can learn more about it in the in-depth [Merge LoRAs](merge_loras) guide since merging is outside the scope of this loading guide. </Tip> LoRAs also need to be used with another model: ```py from diffusers import AutoPipelineForText2Image import torch pipeline = AutoPipelineForText2Image.from_pretrained("stabilityai/stable-diffusion-xl-base-1.0", torch_dtype=torch.float16).to("cuda") ``` Then use the [`~loaders.LoraLoaderMixin.load_lora_weights`] method to load the [ostris/super-cereal-sdxl-lora](https://huggingface.co/ostris/super-cereal-sdxl-lora) weights and specify the weights filename from the repository: ```py pipeline.load_lora_weights("ostris/super-cereal-sdxl-lora", weight_name="cereal_box_sdxl_v1.safetensors") prompt = "bears, pizza bites" image = pipeline(prompt).images[0] image ``` <div class="flex justify-center"> <img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/load_lora.png" /> </div> The [`~loaders.LoraLoaderMixin.load_lora_weights`] method loads LoRA weights into both the UNet and text encoder. It is the preferred way for loading LoRAs because it can handle cases where: - the LoRA weights don't have separate identifiers for the UNet and text encoder - the LoRA weights have separate identifiers for the UNet and text encoder But if you only need to load LoRA weights into the UNet, then you can use the [`~loaders.UNet2DConditionLoadersMixin.load_attn_procs`] method. Let's load the [jbilcke-hf/sdxl-cinematic-1](https://huggingface.co/jbilcke-hf/sdxl-cinematic-1) LoRA: ```py from diffusers import AutoPipelineForText2Image import torch pipeline = AutoPipelineForText2Image.from_pretrained("stabilityai/stable-diffusion-xl-base-1.0", torch_dtype=torch.float16).to("cuda") pipeline.unet.load_attn_procs("jbilcke-hf/sdxl-cinematic-1", weight_name="pytorch_lora_weights.safetensors") # use cnmt in the prompt to trigger the LoRA prompt = "A cute cnmt eating a slice of pizza, stunning color scheme, masterpiece, illustration" image = pipeline(prompt).images[0] image ``` <div class="flex justify-center"> <img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/load_attn_proc.png" /> </div> To unload the LoRA weights, use the [`~loaders.LoraLoaderMixin.unload_lora_weights`] method to discard the LoRA weights and restore the model to its original weights: ```py pipeline.unload_lora_weights() ``` ### Adjust LoRA weight scale For both [`~loaders.LoraLoaderMixin.load_lora_weights`] and [`~loaders.UNet2DConditionLoadersMixin.load_attn_procs`], you can pass the `cross_attention_kwargs={"scale": 0.5}` parameter to adjust how much of the LoRA weights to use. A value of `0` is the same as only using the base model weights, and a value of `1` is equivalent to using the fully finetuned LoRA. For more granular control on the amount of LoRA weights used per layer, you can use [`~loaders.LoraLoaderMixin.set_adapters`] and pass a dictionary specifying by how much to scale the weights in each layer by. ```python pipe = ... # create pipeline pipe.load_lora_weights(..., adapter_name="my_adapter") scales = { "text_encoder": 0.5, "text_encoder_2": 0.5, # only usable if pipe has a 2nd text encoder "unet": { "down": 0.9, # all transformers in the down-part will use scale 0.9 # "mid" # in this example "mid" is not given, therefore all transformers in the mid part will use the default scale 1.0 "up": { "block_0": 0.6, # all 3 transformers in the 0th block in the up-part will use scale 0.6 "block_1": [0.4, 0.8, 1.0], # the 3 transformers in the 1st block in the up-part will use scales 0.4, 0.8 and 1.0 respectively } } } pipe.set_adapters("my_adapter", scales) ``` This also works with multiple adapters - see [this guide](https://huggingface.co/docs/diffusers/tutorials/using_peft_for_inference#customize-adapters-strength) for how to do it. <Tip warning={true}> Currently, [`~loaders.LoraLoaderMixin.set_adapters`] only supports scaling attention weights. If a LoRA has other parts (e.g., resnets or down-/upsamplers), they will keep a scale of 1.0. </Tip> ### Kohya and TheLastBen Other popular LoRA trainers from the community include those by [Kohya](https://github.com/kohya-ss/sd-scripts/) and [TheLastBen](https://github.com/TheLastBen/fast-stable-diffusion). These trainers create different LoRA checkpoints than those trained by 🤗 Diffusers, but they can still be loaded in the same way. <hfoptions id="other-trainers"> <hfoption id="Kohya"> To load a Kohya LoRA, let's download the [Blueprintify SD XL 1.0](https://civitai.com/models/150986/blueprintify-sd-xl-10) checkpoint from [Civitai](https://civitai.com/) as an example: ```sh !wget https://civitai.com/api/download/models/168776 -O blueprintify-sd-xl-10.safetensors ``` Load the LoRA checkpoint with the [`~loaders.LoraLoaderMixin.load_lora_weights`] method, and specify the filename in the `weight_name` parameter: ```py from diffusers import AutoPipelineForText2Image import torch pipeline = AutoPipelineForText2Image.from_pretrained("stabilityai/stable-diffusion-xl-base-1.0", torch_dtype=torch.float16).to("cuda") pipeline.load_lora_weights("path/to/weights", weight_name="blueprintify-sd-xl-10.safetensors") ``` Generate an image: ```py # use bl3uprint in the prompt to trigger the LoRA prompt = "bl3uprint, a highly detailed blueprint of the eiffel tower, explaining how to build all parts, many txt, blueprint grid backdrop" image = pipeline(prompt).images[0] image ``` <Tip warning={true}> Some limitations of using Kohya LoRAs with 🤗 Diffusers include: - Images may not look like those generated by UIs - like ComfyUI - for multiple reasons, which are explained [here](https://github.com/huggingface/diffusers/pull/4287/#issuecomment-1655110736). - [LyCORIS checkpoints](https://github.com/KohakuBlueleaf/LyCORIS) aren't fully supported. The [`~loaders.LoraLoaderMixin.load_lora_weights`] method loads LyCORIS checkpoints with LoRA and LoCon modules, but Hada and LoKR are not supported. </Tip> </hfoption> <hfoption id="TheLastBen"> Loading a checkpoint from TheLastBen is very similar. For example, to load the [TheLastBen/William_Eggleston_Style_SDXL](https://huggingface.co/TheLastBen/William_Eggleston_Style_SDXL) checkpoint: ```py from diffusers import AutoPipelineForText2Image import torch pipeline = AutoPipelineForText2Image.from_pretrained("stabilityai/stable-diffusion-xl-base-1.0", torch_dtype=torch.float16).to("cuda") pipeline.load_lora_weights("TheLastBen/William_Eggleston_Style_SDXL", weight_name="wegg.safetensors") # use by william eggleston in the prompt to trigger the LoRA prompt = "a house by william eggleston, sunrays, beautiful, sunlight, sunrays, beautiful" image = pipeline(prompt=prompt).images[0] image ``` </hfoption> </hfoptions> ## IP-Adapter [IP-Adapter](https://ip-adapter.github.io/) is a lightweight adapter that enables image prompting for any diffusion model. This adapter works by decoupling the cross-attention layers of the image and text features. All the other model components are frozen and only the embedded image features in the UNet are trained. As a result, IP-Adapter files are typically only ~100MBs. You can learn more about how to use IP-Adapter for different tasks and specific use cases in the [IP-Adapter](../using-diffusers/ip_adapter) guide. > [!TIP] > Diffusers currently only supports IP-Adapter for some of the most popular pipelines. Feel free to open a feature request if you have a cool use case and want to integrate IP-Adapter with an unsupported pipeline! > Official IP-Adapter checkpoints are available from [h94/IP-Adapter](https://huggingface.co/h94/IP-Adapter). To start, load a Stable Diffusion checkpoint. ```py from diffusers import AutoPipelineForText2Image import torch from diffusers.utils import load_image pipeline = AutoPipelineForText2Image.from_pretrained("runwayml/stable-diffusion-v1-5", torch_dtype=torch.float16).to("cuda") ``` Then load the IP-Adapter weights and add it to the pipeline with the [`~loaders.IPAdapterMixin.load_ip_adapter`] method. ```py pipeline.load_ip_adapter("h94/IP-Adapter", subfolder="models", weight_name="ip-adapter_sd15.bin") ``` Once loaded, you can use the pipeline with an image and text prompt to guide the image generation process. ```py image = load_image("https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/load_neg_embed.png") generator = torch.Generator(device="cpu").manual_seed(33) images = pipeline(     prompt='best quality, high quality, wearing sunglasses',     ip_adapter_image=image,     negative_prompt="monochrome, lowres, bad anatomy, worst quality, low quality",     num_inference_steps=50,     generator=generator, ).images[0] images ``` <div class="flex justify-center">     <img src="https://huggingface.co/datasets/YiYiXu/testing-images/resolve/main/ip-bear.png" /> </div> ### IP-Adapter Plus IP-Adapter relies on an image encoder to generate image features. If the IP-Adapter repository contains an `image_encoder` subfolder, the image encoder is automatically loaded and registered to the pipeline. Otherwise, you'll need to explicitly load the image encoder with a [`~transformers.CLIPVisionModelWithProjection`] model and pass it to the pipeline. This is the case for *IP-Adapter Plus* checkpoints which use the ViT-H image encoder. ```py from transformers import CLIPVisionModelWithProjection image_encoder = CLIPVisionModelWithProjection.from_pretrained( "h94/IP-Adapter", subfolder="models/image_encoder", torch_dtype=torch.float16 ) pipeline = AutoPipelineForText2Image.from_pretrained( "stabilityai/stable-diffusion-xl-base-1.0", image_encoder=image_encoder, torch_dtype=torch.float16 ).to("cuda") pipeline.load_ip_adapter("h94/IP-Adapter", subfolder="sdxl_models", weight_name="ip-adapter-plus_sdxl_vit-h.safetensors") ```
diffusers/docs/source/en/using-diffusers/loading_adapters.md/0
{ "file_path": "diffusers/docs/source/en/using-diffusers/loading_adapters.md", "repo_id": "diffusers", "token_count": 5187 }
104
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # Textual inversion [[open-in-colab]] The [`StableDiffusionPipeline`] supports textual inversion, a technique that enables a model like Stable Diffusion to learn a new concept from just a few sample images. This gives you more control over the generated images and allows you to tailor the model towards specific concepts. You can get started quickly with a collection of community created concepts in the [Stable Diffusion Conceptualizer](https://huggingface.co/spaces/sd-concepts-library/stable-diffusion-conceptualizer). This guide will show you how to run inference with textual inversion using a pre-learned concept from the Stable Diffusion Conceptualizer. If you're interested in teaching a model new concepts with textual inversion, take a look at the [Textual Inversion](../training/text_inversion) training guide. Import the necessary libraries: ```py import torch from diffusers import StableDiffusionPipeline from diffusers.utils import make_image_grid ``` ## Stable Diffusion 1 and 2 Pick a Stable Diffusion checkpoint and a pre-learned concept from the [Stable Diffusion Conceptualizer](https://huggingface.co/spaces/sd-concepts-library/stable-diffusion-conceptualizer): ```py pretrained_model_name_or_path = "runwayml/stable-diffusion-v1-5" repo_id_embeds = "sd-concepts-library/cat-toy" ``` Now you can load a pipeline, and pass the pre-learned concept to it: ```py pipeline = StableDiffusionPipeline.from_pretrained( pretrained_model_name_or_path, torch_dtype=torch.float16, use_safetensors=True ).to("cuda") pipeline.load_textual_inversion(repo_id_embeds) ``` Create a prompt with the pre-learned concept by using the special placeholder token `<cat-toy>`, and choose the number of samples and rows of images you'd like to generate: ```py prompt = "a grafitti in a favela wall with a <cat-toy> on it" num_samples_per_row = 2 num_rows = 2 ``` Then run the pipeline (feel free to adjust the parameters like `num_inference_steps` and `guidance_scale` to see how they affect image quality), save the generated images and visualize them with the helper function you created at the beginning: ```py all_images = [] for _ in range(num_rows): images = pipeline(prompt, num_images_per_prompt=num_samples_per_row, num_inference_steps=50, guidance_scale=7.5).images all_images.extend(images) grid = make_image_grid(all_images, num_rows, num_samples_per_row) grid ``` <div class="flex justify-center"> <img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/textual_inversion_inference.png"> </div> ## Stable Diffusion XL Stable Diffusion XL (SDXL) can also use textual inversion vectors for inference. In contrast to Stable Diffusion 1 and 2, SDXL has two text encoders so you'll need two textual inversion embeddings - one for each text encoder model. Let's download the SDXL textual inversion embeddings and have a closer look at it's structure: ```py from huggingface_hub import hf_hub_download from safetensors.torch import load_file file = hf_hub_download("dn118/unaestheticXL", filename="unaestheticXLv31.safetensors") state_dict = load_file(file) state_dict ``` ``` {'clip_g': tensor([[ 0.0077, -0.0112, 0.0065, ..., 0.0195, 0.0159, 0.0275], ..., [-0.0170, 0.0213, 0.0143, ..., -0.0302, -0.0240, -0.0362]], 'clip_l': tensor([[ 0.0023, 0.0192, 0.0213, ..., -0.0385, 0.0048, -0.0011], ..., [ 0.0475, -0.0508, -0.0145, ..., 0.0070, -0.0089, -0.0163]], ``` There are two tensors, `"clip_g"` and `"clip_l"`. `"clip_g"` corresponds to the bigger text encoder in SDXL and refers to `pipe.text_encoder_2` and `"clip_l"` refers to `pipe.text_encoder`. Now you can load each tensor separately by passing them along with the correct text encoder and tokenizer to [`~loaders.TextualInversionLoaderMixin.load_textual_inversion`]: ```py from diffusers import AutoPipelineForText2Image import torch pipe = AutoPipelineForText2Image.from_pretrained("stabilityai/stable-diffusion-xl-base-1.0", variant="fp16", torch_dtype=torch.float16) pipe.to("cuda") pipe.load_textual_inversion(state_dict["clip_g"], token="unaestheticXLv31", text_encoder=pipe.text_encoder_2, tokenizer=pipe.tokenizer_2) pipe.load_textual_inversion(state_dict["clip_l"], token="unaestheticXLv31", text_encoder=pipe.text_encoder, tokenizer=pipe.tokenizer) # the embedding should be used as a negative embedding, so we pass it as a negative prompt generator = torch.Generator().manual_seed(33) image = pipe("a woman standing in front of a mountain", negative_prompt="unaestheticXLv31", generator=generator).images[0] image ```
diffusers/docs/source/en/using-diffusers/textual_inversion_inference.md/0
{ "file_path": "diffusers/docs/source/en/using-diffusers/textual_inversion_inference.md", "repo_id": "diffusers", "token_count": 1716 }
105
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # 설치 사용하시는 라이브러리에 맞는 🤗 Diffusers를 설치하세요. 🤗 Diffusers는 Python 3.8+, PyTorch 1.7.0+ 및 flax에서 테스트되었습니다. 사용중인 딥러닝 라이브러리에 대한 아래의 설치 안내를 따르세요. - [PyTorch 설치 안내](https://pytorch.org/get-started/locally/) - [Flax 설치 안내](https://flax.readthedocs.io/en/latest/) ## pip를 이용한 설치 [가상 환경](https://docs.python.org/3/library/venv.html)에 🤗 Diffusers를 설치해야 합니다. Python 가상 환경에 익숙하지 않은 경우 [가상환경 pip 설치 가이드](https://packaging.python.org/guides/installing-using-pip-and-virtual-environments/)를 살펴보세요. 가상 환경을 사용하면 서로 다른 프로젝트를 더 쉽게 관리하고, 종속성간의 호환성 문제를 피할 수 있습니다. 프로젝트 디렉토리에 가상 환경을 생성하는 것으로 시작하세요: ```bash python -m venv .env ``` 그리고 가상 환경을 활성화합니다: ```bash source .env/bin/activate ``` 이제 다음의 명령어로 🤗 Diffusers를 설치할 준비가 되었습니다: **PyTorch의 경우** ```bash pip install diffusers["torch"] ``` **Flax의 경우** ```bash pip install diffusers["flax"] ``` ## 소스로부터 설치 소스에서 `diffusers`를 설치하기 전에, `torch` 및 `accelerate`이 설치되어 있는지 확인하세요. `torch` 설치에 대해서는 [torch docs](https://pytorch.org/get-started/locally/#start-locally)를 참고하세요. 다음과 같이 `accelerate`을 설치하세요. ```bash pip install accelerate ``` 다음 명령어를 사용하여 소스에서 🤗 Diffusers를 설치하세요: ```bash pip install git+https://github.com/huggingface/diffusers ``` 이 명령어는 최신 `stable` 버전이 아닌 최첨단 `main` 버전을 설치합니다. `main` 버전은 최신 개발 정보를 최신 상태로 유지하는 데 유용합니다. 예를 들어 마지막 공식 릴리즈 이후 버그가 수정되었지만, 새 릴리즈가 아직 출시되지 않은 경우입니다. 그러나 이는 `main` 버전이 항상 안정적이지 않을 수 있음을 의미합니다. 우리는 `main` 버전이 지속적으로 작동하도록 노력하고 있으며, 대부분의 문제는 보통 몇 시간 또는 하루 안에 해결됩니다. 문제가 발생하면 더 빨리 해결할 수 있도록 [Issue](https://github.com/huggingface/transformers/issues)를 열어주세요! ## 편집가능한 설치 다음을 수행하려면 편집가능한 설치가 필요합니다: * 소스 코드의 `main` 버전을 사용 * 🤗 Diffusers에 기여 (코드의 변경 사항을 테스트하기 위해 필요) 저장소를 복제하고 다음 명령어를 사용하여 🤗 Diffusers를 설치합니다: ```bash git clone https://github.com/huggingface/diffusers.git cd diffusers ``` **PyTorch의 경우** ``` pip install -e ".[torch]" ``` **Flax의 경우** ``` pip install -e ".[flax]" ``` 이러한 명령어들은 저장소를 복제한 폴더와 Python 라이브러리 경로를 연결합니다. Python은 이제 일반 라이브러리 경로에 더하여 복제한 폴더 내부를 살펴봅니다. 예를들어 Python 패키지가 `~/anaconda3/envs/main/lib/python3.8/site-packages/`에 설치되어 있는 경우 Python은 복제한 폴더인 `~/diffusers/`도 검색합니다. <Tip warning={true}> 라이브러리를 계속 사용하려면 `diffusers` 폴더를 유지해야 합니다. </Tip> 이제 다음 명령어를 사용하여 최신 버전의 🤗 Diffusers로 쉽게 업데이트할 수 있습니다: ```bash cd ~/diffusers/ git pull ``` 이렇게 하면, 다음에 실행할 때 Python 환경이 🤗 Diffusers의 `main` 버전을 찾게 됩니다. ## 텔레메트리 로깅에 대한 알림 우리 라이브러리는 `from_pretrained()` 요청 중에 텔레메트리 정보를 원격으로 수집합니다. 이 데이터에는 Diffusers 및 PyTorch/Flax의 버전, 요청된 모델 또는 파이프라인 클래스, 그리고 허브에서 호스팅되는 경우 사전학습된 체크포인트에 대한 경로를 포함합니다. 이 사용 데이터는 문제를 디버깅하고 새로운 기능의 우선순위를 지정하는데 도움이 됩니다. 텔레메트리는 HuggingFace 허브에서 모델과 파이프라인을 불러올 때만 전송되며, 로컬 사용 중에는 수집되지 않습니다. 우리는 추가 정보를 공유하지 않기를 원하는 사람이 있다는 것을 이해하고 개인 정보를 존중하므로, 터미널에서 `DISABLE_TELEMETRY` 환경 변수를 설정하여 텔레메트리 수집을 비활성화할 수 있습니다. Linux/MacOS에서: ```bash export DISABLE_TELEMETRY=YES ``` Windows에서: ```bash set DISABLE_TELEMETRY=YES ```
diffusers/docs/source/ko/installation.md/0
{ "file_path": "diffusers/docs/source/ko/installation.md", "repo_id": "diffusers", "token_count": 3687 }
106
<!--Copyright 2024 Custom Diffusion authors The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # 커스텀 Diffusion 학습 예제 [커스텀 Diffusion](https://arxiv.org/abs/2212.04488)은 피사체의 이미지 몇 장(4~5장)만 주어지면 Stable Diffusion처럼 text-to-image 모델을 커스터마이징하는 방법입니다. 'train_custom_diffusion.py' 스크립트는 학습 과정을 구현하고 이를 Stable Diffusion에 맞게 조정하는 방법을 보여줍니다. 이 교육 사례는 [Nupur Kumari](https://nupurkmr9.github.io/)가 제공하였습니다. (Custom Diffusion의 저자 중 한명). ## 로컬에서 PyTorch로 실행하기 ### Dependencies 설치하기 스크립트를 실행하기 전에 라이브러리의 학습 dependencies를 설치해야 합니다: **중요** 예제 스크립트의 최신 버전을 성공적으로 실행하려면 **소스로부터 설치**하는 것을 매우 권장하며, 예제 스크립트를 자주 업데이트하는 만큼 일부 예제별 요구 사항을 설치하고 설치를 최신 상태로 유지하는 것이 좋습니다. 이를 위해 새 가상 환경에서 다음 단계를 실행하세요: ```bash git clone https://github.com/huggingface/diffusers cd diffusers pip install -e . ``` [example folder](https://github.com/huggingface/diffusers/tree/main/examples/custom_diffusion)로 cd하여 이동하세요. ``` cd examples/custom_diffusion ``` 이제 실행 ```bash pip install -r requirements.txt pip install clip-retrieval ``` 그리고 [🤗Accelerate](https://github.com/huggingface/accelerate/) 환경을 초기화: ```bash accelerate config ``` 또는 사용자 환경에 대한 질문에 답하지 않고 기본 가속 구성을 사용하려면 다음과 같이 하세요. ```bash accelerate config default ``` 또는 사용 중인 환경이 대화형 셸을 지원하지 않는 경우(예: jupyter notebook) ```python from accelerate.utils import write_basic_config write_basic_config() ``` ### 고양이 예제 😺 이제 데이터셋을 가져옵니다. [여기](https://www.cs.cmu.edu/~custom-diffusion/assets/data.zip)에서 데이터셋을 다운로드하고 압축을 풉니다. 직접 데이터셋을 사용하려면 [학습용 데이터셋 생성하기](create_dataset) 가이드를 참고하세요. 또한 'clip-retrieval'을 사용하여 200개의 실제 이미지를 수집하고, regularization으로서 이를 학습 데이터셋의 타겟 이미지와 결합합니다. 이렇게 하면 주어진 타겟 이미지에 대한 과적합을 방지할 수 있습니다. 다음 플래그를 사용하면 `prior_loss_weight=1.`로 `prior_preservation`, `real_prior` regularization을 활성화할 수 있습니다. 클래스_프롬프트`는 대상 이미지와 동일한 카테고리 이름이어야 합니다. 수집된 실제 이미지에는 `class_prompt`와 유사한 텍스트 캡션이 있습니다. 검색된 이미지는 `class_data_dir`에 저장됩니다. 생성된 이미지를 regularization으로 사용하기 위해 `real_prior`를 비활성화할 수 있습니다. 실제 이미지를 수집하려면 훈련 전에 이 명령을 먼저 사용하십시오. ```bash pip install clip-retrieval python retrieve.py --class_prompt cat --class_data_dir real_reg/samples_cat --num_class_images 200 ``` **___참고: [stable-diffusion-2](https://huggingface.co/stabilityai/stable-diffusion-2) 768x768 모델을 사용하는 경우 '해상도'를 768로 변경하세요.___** 스크립트는 모델 체크포인트와 `pytorch_custom_diffusion_weights.bin` 파일을 생성하여 저장소에 저장합니다. ```bash export MODEL_NAME="CompVis/stable-diffusion-v1-4" export OUTPUT_DIR="path-to-save-model" export INSTANCE_DIR="./data/cat" accelerate launch train_custom_diffusion.py \ --pretrained_model_name_or_path=$MODEL_NAME \ --instance_data_dir=$INSTANCE_DIR \ --output_dir=$OUTPUT_DIR \ --class_data_dir=./real_reg/samples_cat/ \ --with_prior_preservation --real_prior --prior_loss_weight=1.0 \ --class_prompt="cat" --num_class_images=200 \ --instance_prompt="photo of a <new1> cat" \ --resolution=512 \ --train_batch_size=2 \ --learning_rate=1e-5 \ --lr_warmup_steps=0 \ --max_train_steps=250 \ --scale_lr --hflip \ --modifier_token "<new1>" \ --push_to_hub ``` **더 낮은 VRAM 요구 사항(GPU당 16GB)으로 더 빠르게 훈련하려면 `--enable_xformers_memory_efficient_attention`을 사용하세요. 설치 방법은 [가이드](https://github.com/facebookresearch/xformers)를 따르세요.** 가중치 및 편향(`wandb`)을 사용하여 실험을 추적하고 중간 결과를 저장하려면(강력히 권장합니다) 다음 단계를 따르세요: * `wandb` 설치: `pip install wandb`. * 로그인 : `wandb login`. * 그런 다음 트레이닝을 시작하는 동안 `validation_prompt`를 지정하고 `report_to`를 `wandb`로 설정합니다. 다음과 같은 관련 인수를 구성할 수도 있습니다: * `num_validation_images` * `validation_steps` ```bash accelerate launch train_custom_diffusion.py \ --pretrained_model_name_or_path=$MODEL_NAME \ --instance_data_dir=$INSTANCE_DIR \ --output_dir=$OUTPUT_DIR \ --class_data_dir=./real_reg/samples_cat/ \ --with_prior_preservation --real_prior --prior_loss_weight=1.0 \ --class_prompt="cat" --num_class_images=200 \ --instance_prompt="photo of a <new1> cat" \ --resolution=512 \ --train_batch_size=2 \ --learning_rate=1e-5 \ --lr_warmup_steps=0 \ --max_train_steps=250 \ --scale_lr --hflip \ --modifier_token "<new1>" \ --validation_prompt="<new1> cat sitting in a bucket" \ --report_to="wandb" \ --push_to_hub ``` 다음은 [Weights and Biases page](https://wandb.ai/sayakpaul/custom-diffusion/runs/26ghrcau)의 예시이며, 여러 학습 세부 정보와 함께 중간 결과들을 확인할 수 있습니다. `--push_to_hub`를 지정하면 학습된 파라미터가 허깅 페이스 허브의 리포지토리에 푸시됩니다. 다음은 [예제 리포지토리](https://huggingface.co/sayakpaul/custom-diffusion-cat)입니다. ### 멀티 컨셉에 대한 학습 🐱🪵 [this](https://github.com/ShivamShrirao/diffusers/blob/main/examples/dreambooth/train_dreambooth.py)와 유사하게 각 컨셉에 대한 정보가 포함된 [json](https://github.com/adobe-research/custom-diffusion/blob/main/assets/concept_list.json) 파일을 제공합니다. 실제 이미지를 수집하려면 json 파일의 각 컨셉에 대해 이 명령을 실행합니다. ```bash pip install clip-retrieval python retrieve.py --class_prompt {} --class_data_dir {} --num_class_images 200 ``` 그럼 우리는 학습시킬 준비가 되었습니다! ```bash export MODEL_NAME="CompVis/stable-diffusion-v1-4" export OUTPUT_DIR="path-to-save-model" accelerate launch train_custom_diffusion.py \ --pretrained_model_name_or_path=$MODEL_NAME \ --output_dir=$OUTPUT_DIR \ --concepts_list=./concept_list.json \ --with_prior_preservation --real_prior --prior_loss_weight=1.0 \ --resolution=512 \ --train_batch_size=2 \ --learning_rate=1e-5 \ --lr_warmup_steps=0 \ --max_train_steps=500 \ --num_class_images=200 \ --scale_lr --hflip \ --modifier_token "<new1>+<new2>" \ --push_to_hub ``` 다음은 [Weights and Biases page](https://wandb.ai/sayakpaul/custom-diffusion/runs/3990tzkg)의 예시이며, 다른 학습 세부 정보와 함께 중간 결과들을 확인할 수 있습니다. ### 사람 얼굴에 대한 학습 사람 얼굴에 대한 파인튜닝을 위해 다음과 같은 설정이 더 효과적이라는 것을 확인했습니다: `learning_rate=5e-6`, `max_train_steps=1000 to 2000`, `freeze_model=crossattn`을 최소 15~20개의 이미지로 설정합니다. 실제 이미지를 수집하려면 훈련 전에 이 명령을 먼저 사용하십시오. ```bash pip install clip-retrieval python retrieve.py --class_prompt person --class_data_dir real_reg/samples_person --num_class_images 200 ``` 이제 학습을 시작하세요! ```bash export MODEL_NAME="CompVis/stable-diffusion-v1-4" export OUTPUT_DIR="path-to-save-model" export INSTANCE_DIR="path-to-images" accelerate launch train_custom_diffusion.py \ --pretrained_model_name_or_path=$MODEL_NAME \ --instance_data_dir=$INSTANCE_DIR \ --output_dir=$OUTPUT_DIR \ --class_data_dir=./real_reg/samples_person/ \ --with_prior_preservation --real_prior --prior_loss_weight=1.0 \ --class_prompt="person" --num_class_images=200 \ --instance_prompt="photo of a <new1> person" \ --resolution=512 \ --train_batch_size=2 \ --learning_rate=5e-6 \ --lr_warmup_steps=0 \ --max_train_steps=1000 \ --scale_lr --hflip --noaug \ --freeze_model crossattn \ --modifier_token "<new1>" \ --enable_xformers_memory_efficient_attention \ --push_to_hub ``` ## 추론 위 프롬프트를 사용하여 모델을 학습시킨 후에는 아래 프롬프트를 사용하여 추론을 실행할 수 있습니다. 프롬프트에 'modifier token'(예: 위 예제에서는 \<new1\>)을 반드시 포함해야 합니다. ```python import torch from diffusers import DiffusionPipeline pipe = DiffusionPipeline.from_pretrained("CompVis/stable-diffusion-v1-4", torch_dtype=torch.float16).to("cuda") pipe.unet.load_attn_procs("path-to-save-model", weight_name="pytorch_custom_diffusion_weights.bin") pipe.load_textual_inversion("path-to-save-model", weight_name="<new1>.bin") image = pipe( "<new1> cat sitting in a bucket", num_inference_steps=100, guidance_scale=6.0, eta=1.0, ).images[0] image.save("cat.png") ``` 허브 리포지토리에서 이러한 매개변수를 직접 로드할 수 있습니다: ```python import torch from huggingface_hub.repocard import RepoCard from diffusers import DiffusionPipeline model_id = "sayakpaul/custom-diffusion-cat" card = RepoCard.load(model_id) base_model_id = card.data.to_dict()["base_model"] pipe = DiffusionPipeline.from_pretrained(base_model_id, torch_dtype=torch.float16).to("cuda") pipe.unet.load_attn_procs(model_id, weight_name="pytorch_custom_diffusion_weights.bin") pipe.load_textual_inversion(model_id, weight_name="<new1>.bin") image = pipe( "<new1> cat sitting in a bucket", num_inference_steps=100, guidance_scale=6.0, eta=1.0, ).images[0] image.save("cat.png") ``` 다음은 여러 컨셉으로 추론을 수행하는 예제입니다: ```python import torch from huggingface_hub.repocard import RepoCard from diffusers import DiffusionPipeline model_id = "sayakpaul/custom-diffusion-cat-wooden-pot" card = RepoCard.load(model_id) base_model_id = card.data.to_dict()["base_model"] pipe = DiffusionPipeline.from_pretrained(base_model_id, torch_dtype=torch.float16).to("cuda") pipe.unet.load_attn_procs(model_id, weight_name="pytorch_custom_diffusion_weights.bin") pipe.load_textual_inversion(model_id, weight_name="<new1>.bin") pipe.load_textual_inversion(model_id, weight_name="<new2>.bin") image = pipe( "the <new1> cat sculpture in the style of a <new2> wooden pot", num_inference_steps=100, guidance_scale=6.0, eta=1.0, ).images[0] image.save("multi-subject.png") ``` 여기서 '고양이'와 '나무 냄비'는 여러 컨셉을 말합니다. ### 학습된 체크포인트에서 추론하기 `--checkpointing_steps` 인수를 사용한 경우 학습 과정에서 저장된 전체 체크포인트 중 하나에서 추론을 수행할 수도 있습니다. ## Grads를 None으로 설정 더 많은 메모리를 절약하려면 스크립트에 `--set_grads_to_none` 인수를 전달하세요. 이렇게 하면 성적이 0이 아닌 없음으로 설정됩니다. 그러나 특정 동작이 변경되므로 문제가 발생하면 이 인수를 제거하세요. 자세한 정보: https://pytorch.org/docs/stable/generated/torch.optim.Optimizer.zero_grad.html ## 실험 결과 실험에 대한 자세한 내용은 [당사 웹페이지](https://www.cs.cmu.edu/~custom-diffusion/)를 참조하세요.
diffusers/docs/source/ko/training/custom_diffusion.md/0
{ "file_path": "diffusers/docs/source/ko/training/custom_diffusion.md", "repo_id": "diffusers", "token_count": 7052 }
107
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # 커스텀 파이프라인 불러오기 [[open-in-colab]] 커뮤니티 파이프라인은 논문에 명시된 원래의 구현체와 다른 형태로 구현된 모든 [`DiffusionPipeline`] 클래스를 의미합니다. (예를 들어, [`StableDiffusionControlNetPipeline`]는 ["Text-to-Image Generation with ControlNet Conditioning"](https://arxiv.org/abs/2302.05543) 해당) 이들은 추가 기능을 제공하거나 파이프라인의 원래 구현을 확장합니다. [Speech to Image](https://github.com/huggingface/diffusers/tree/main/examples/community#speech-to-image) 또는 [Composable Stable Diffusion](https://github.com/huggingface/diffusers/tree/main/examples/community#composable-stable-diffusion) 과 같은 멋진 커뮤니티 파이프라인이 많이 있으며 [여기에서](https://github.com/huggingface/diffusers/tree/main/examples/community) 모든 공식 커뮤니티 파이프라인을 찾을 수 있습니다. 허브에서 커뮤니티 파이프라인을 로드하려면, 커뮤니티 파이프라인의 리포지토리 ID와 (파이프라인 가중치 및 구성 요소를 로드하려는) 모델의 리포지토리 ID를 인자로 전달해야 합니다. 예를 들어, 아래 예시에서는 `hf-internal-testing/diffusers-dummy-pipeline`에서 더미 파이프라인을 불러오고, `google/ddpm-cifar10-32`에서 파이프라인의 가중치와 컴포넌트들을 로드합니다. <Tip warning={true}> 🔒 허깅 페이스 허브에서 커뮤니티 파이프라인을 불러오는 것은 곧 해당 코드가 안전하다고 신뢰하는 것입니다. 코드를 자동으로 불러오고 실행하기 앞서 반드시 온라인으로 해당 코드의 신뢰성을 검사하세요! </Tip> ```py from diffusers import DiffusionPipeline pipeline = DiffusionPipeline.from_pretrained( "google/ddpm-cifar10-32", custom_pipeline="hf-internal-testing/diffusers-dummy-pipeline" ) ``` 공식 커뮤니티 파이프라인을 불러오는 것은 비슷하지만, 공식 리포지토리 ID에서 가중치를 불러오는 것과 더불어 해당 파이프라인 내의 컴포넌트를 직접 지정하는 것 역시 가능합니다. 아래 예제를 보면 커뮤니티 [CLIP Guided Stable Diffusion](https://github.com/huggingface/diffusers/tree/main/examples/community#clip-guided-stable-diffusion) 파이프라인을 로드할 때, 해당 파이프라인에서 사용할 `clip_model` 컴포넌트와 `feature_extractor` 컴포넌트를 직접 설정하는 것을 확인할 수 있습니다. ```py from diffusers import DiffusionPipeline from transformers import CLIPImageProcessor, CLIPModel clip_model_id = "laion/CLIP-ViT-B-32-laion2B-s34B-b79K" feature_extractor = CLIPImageProcessor.from_pretrained(clip_model_id) clip_model = CLIPModel.from_pretrained(clip_model_id) pipeline = DiffusionPipeline.from_pretrained( "runwayml/stable-diffusion-v1-5", custom_pipeline="clip_guided_stable_diffusion", clip_model=clip_model, feature_extractor=feature_extractor, ) ``` 커뮤니티 파이프라인에 대한 자세한 내용은 [커뮤니티 파이프라인](https://github.com/huggingface/diffusers/blob/main/docs/source/en/using-diffusers/custom_pipeline_examples) 가이드를 살펴보세요. 커뮤니티 파이프라인 등록에 관심이 있는 경우 [커뮤니티 파이프라인에 기여하는 방법](https://github.com/huggingface/diffusers/blob/main/docs/source/en/using-diffusers/contribute_pipeline)에 대한 가이드를 확인하세요 !
diffusers/docs/source/ko/using-diffusers/custom_pipeline_overview.md/0
{ "file_path": "diffusers/docs/source/ko/using-diffusers/custom_pipeline_overview.md", "repo_id": "diffusers", "token_count": 2382 }
108
<!--Copyright 2024 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> # 파이프라인, 모델 및 스케줄러 이해하기 [[open-in-colab]] 🧨 Diffusers는 사용자 친화적이며 유연한 도구 상자로, 사용사례에 맞게 diffusion 시스템을 구축 할 수 있도록 설계되었습니다. 이 도구 상자의 핵심은 모델과 스케줄러입니다. [`DiffusionPipeline`]은 편의를 위해 이러한 구성 요소를 번들로 제공하지만, 파이프라인을 분리하고 모델과 스케줄러를 개별적으로 사용해 새로운 diffusion 시스템을 만들 수도 있습니다. 이 튜토리얼에서는 기본 파이프라인부터 시작해 Stable Diffusion 파이프라인까지 진행하며 모델과 스케줄러를 사용해 추론을 위한 diffusion 시스템을 조립하는 방법을 배웁니다. ## 기본 파이프라인 해체하기 파이프라인은 추론을 위해 모델을 실행하는 빠르고 쉬운 방법으로, 이미지를 생성하는 데 코드가 4줄 이상 필요하지 않습니다: ```py >>> from diffusers import DDPMPipeline >>> ddpm = DDPMPipeline.from_pretrained("google/ddpm-cat-256").to("cuda") >>> image = ddpm(num_inference_steps=25).images[0] >>> image ``` <div class="flex justify-center"> <img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/diffusers/ddpm-cat.png" alt="Image of cat created from DDPMPipeline"/> </div> 정말 쉽습니다. 그런데 파이프라인은 어떻게 이렇게 할 수 있었을까요? 파이프라인을 세분화하여 내부에서 어떤 일이 일어나고 있는지 살펴보겠습니다. 위 예시에서 파이프라인에는 [`UNet2DModel`] 모델과 [`DDPMScheduler`]가 포함되어 있습니다. 파이프라인은 원하는 출력 크기의 랜덤 노이즈를 받아 모델을 여러번 통과시켜 이미지의 노이즈를 제거합니다. 각 timestep에서 모델은 *noise residual*을 예측하고 스케줄러는 이를 사용하여 노이즈가 적은 이미지를 예측합니다. 파이프라인은 지정된 추론 스텝수에 도달할 때까지 이 과정을 반복합니다. 모델과 스케줄러를 별도로 사용하여 파이프라인을 다시 생성하기 위해 자체적인 노이즈 제거 프로세스를 작성해 보겠습니다. 1. 모델과 스케줄러를 불러옵니다: ```py >>> from diffusers import DDPMScheduler, UNet2DModel >>> scheduler = DDPMScheduler.from_pretrained("google/ddpm-cat-256") >>> model = UNet2DModel.from_pretrained("google/ddpm-cat-256").to("cuda") ``` 2. 노이즈 제거 프로세스를 실행할 timestep 수를 설정합니다: ```py >>> scheduler.set_timesteps(50) ``` 3. 스케줄러의 timestep을 설정하면 균등한 간격의 구성 요소를 가진 텐서가 생성됩니다.(이 예시에서는 50개) 각 요소는 모델이 이미지의 노이즈를 제거하는 시간 간격에 해당합니다. 나중에 노이즈 제거 루프를 만들 때 이 텐서를 반복하여 이미지의 노이즈를 제거합니다: ```py >>> scheduler.timesteps tensor([980, 960, 940, 920, 900, 880, 860, 840, 820, 800, 780, 760, 740, 720, 700, 680, 660, 640, 620, 600, 580, 560, 540, 520, 500, 480, 460, 440, 420, 400, 380, 360, 340, 320, 300, 280, 260, 240, 220, 200, 180, 160, 140, 120, 100, 80, 60, 40, 20, 0]) ``` 4. 원하는 출력과 같은 모양을 가진 랜덤 노이즈를 생성합니다: ```py >>> import torch >>> sample_size = model.config.sample_size >>> noise = torch.randn((1, 3, sample_size, sample_size), device="cuda") ``` 5. 이제 timestep을 반복하는 루프를 작성합니다. 각 timestep에서 모델은 [`UNet2DModel.forward`]를 통해 noisy residual을 반환합니다. 스케줄러의 [`~DDPMScheduler.step`] 메서드는 noisy residual, timestep, 그리고 입력을 받아 이전 timestep에서 이미지를 예측합니다. 이 출력은 노이즈 제거 루프의 모델에 대한 다음 입력이 되며, `timesteps` 배열의 끝에 도달할 때까지 반복됩니다. ```py >>> input = noise >>> for t in scheduler.timesteps: ... with torch.no_grad(): ... noisy_residual = model(input, t).sample ... previous_noisy_sample = scheduler.step(noisy_residual, t, input).prev_sample ... input = previous_noisy_sample ``` 이것이 전체 노이즈 제거 프로세스이며, 동일한 패턴을 사용해 모든 diffusion 시스템을 작성할 수 있습니다. 6. 마지막 단계는 노이즈가 제거된 출력을 이미지로 변환하는 것입니다: ```py >>> from PIL import Image >>> import numpy as np >>> image = (input / 2 + 0.5).clamp(0, 1) >>> image = image.cpu().permute(0, 2, 3, 1).numpy()[0] >>> image = Image.fromarray((image * 255).round().astype("uint8")) >>> image ``` 다음 섹션에서는 여러분의 기술을 시험해보고 좀 더 복잡한 Stable Diffusion 파이프라인을 분석해 보겠습니다. 방법은 거의 동일합니다. 필요한 구성요소들을 초기화하고 timestep수를 설정하여 `timestep` 배열을 생성합니다. 노이즈 제거 루프에서 `timestep` 배열이 사용되며, 이 배열의 각 요소에 대해 모델은 노이즈가 적은 이미지를 예측합니다. 노이즈 제거 루프는 `timestep`을 반복하고 각 timestep에서 noise residual을 출력하고 스케줄러는 이를 사용하여 이전 timestep에서 노이즈가 덜한 이미지를 예측합니다. 이 프로세스는 `timestep` 배열의 끝에 도달할 때까지 반복됩니다. 한번 사용해 봅시다! ## Stable Diffusion 파이프라인 해체하기 Stable Diffusion 은 text-to-image *latent diffusion* 모델입니다. latent diffusion 모델이라고 불리는 이유는 실제 픽셀 공간 대신 이미지의 저차원의 표현으로 작업하기 때문이고, 메모리 효율이 더 높습니다. 인코더는 이미지를 더 작은 표현으로 압축하고, 디코더는 압축된 표현을 다시 이미지로 변환합니다. text-to-image 모델의 경우 텍스트 임베딩을 생성하기 위해 tokenizer와 인코더가 필요합니다. 이전 예제에서 이미 UNet 모델과 스케줄러가 필요하다는 것은 알고 계셨을 것입니다. 보시다시피, 이것은 UNet 모델만 포함된 DDPM 파이프라인보다 더 복잡합니다. Stable Diffusion 모델에는 세 개의 개별 사전학습된 모델이 있습니다. <Tip> 💡 VAE, UNet 및 텍스트 인코더 모델의 작동방식에 대한 자세한 내용은 [How does Stable Diffusion work?](https://huggingface.co/blog/stable_diffusion#how-does-stable-diffusion-work) 블로그를 참조하세요. </Tip> 이제 Stable Diffusion 파이프라인에 필요한 구성요소들이 무엇인지 알았으니, [`~ModelMixin.from_pretrained`] 메서드를 사용해 모든 구성요소를 불러옵니다. 사전학습된 체크포인트 [`runwayml/stable-diffusion-v1-5`](https://huggingface.co/runwayml/stable-diffusion-v1-5)에서 찾을 수 있으며, 각 구성요소들은 별도의 하위 폴더에 저장되어 있습니다: ```py >>> from PIL import Image >>> import torch >>> from transformers import CLIPTextModel, CLIPTokenizer >>> from diffusers import AutoencoderKL, UNet2DConditionModel, PNDMScheduler >>> vae = AutoencoderKL.from_pretrained("CompVis/stable-diffusion-v1-4", subfolder="vae") >>> tokenizer = CLIPTokenizer.from_pretrained("CompVis/stable-diffusion-v1-4", subfolder="tokenizer") >>> text_encoder = CLIPTextModel.from_pretrained("CompVis/stable-diffusion-v1-4", subfolder="text_encoder") >>> unet = UNet2DConditionModel.from_pretrained("CompVis/stable-diffusion-v1-4", subfolder="unet") ``` 기본 [`PNDMScheduler`] 대신, [`UniPCMultistepScheduler`]로 교체하여 다른 스케줄러를 얼마나 쉽게 연결할 수 있는지 확인합니다: ```py >>> from diffusers import UniPCMultistepScheduler >>> scheduler = UniPCMultistepScheduler.from_pretrained("CompVis/stable-diffusion-v1-4", subfolder="scheduler") ``` 추론 속도를 높이려면 스케줄러와 달리 학습 가능한 가중치가 있으므로 모델을 GPU로 옮기세요: ```py >>> torch_device = "cuda" >>> vae.to(torch_device) >>> text_encoder.to(torch_device) >>> unet.to(torch_device) ``` ### 텍스트 임베딩 생성하기 다음 단계는 임베딩을 생성하기 위해 텍스트를 토큰화하는 것입니다. 이 텍스트는 UNet 모델에서 condition으로 사용되고 입력 프롬프트와 유사한 방향으로 diffusion 프로세스를 조정하는 데 사용됩니다. <Tip> 💡 `guidance_scale` 매개변수는 이미지를 생성할 때 프롬프트에 얼마나 많은 가중치를 부여할지 결정합니다. </Tip> 다른 프롬프트를 생성하고 싶다면 원하는 프롬프트를 자유롭게 선택하세요! ```py >>> prompt = ["a photograph of an astronaut riding a horse"] >>> height = 512 # Stable Diffusion의 기본 높이 >>> width = 512 # Stable Diffusion의 기본 너비 >>> num_inference_steps = 25 # 노이즈 제거 스텝 수 >>> guidance_scale = 7.5 # classifier-free guidance를 위한 scale >>> generator = torch.manual_seed(0) # 초기 잠재 노이즈를 생성하는 seed generator >>> batch_size = len(prompt) ``` 텍스트를 토큰화하고 프롬프트에서 임베딩을 생성합니다: ```py >>> text_input = tokenizer( ... prompt, padding="max_length", max_length=tokenizer.model_max_length, truncation=True, return_tensors="pt" ... ) >>> with torch.no_grad(): ... text_embeddings = text_encoder(text_input.input_ids.to(torch_device))[0] ``` 또한 패딩 토큰의 임베딩인 *unconditional 텍스트 임베딩*을 생성해야 합니다. 이 임베딩은 조건부 `text_embeddings`과 동일한 shape(`batch_size` 그리고 `seq_length`)을 가져야 합니다: ```py >>> max_length = text_input.input_ids.shape[-1] >>> uncond_input = tokenizer([""] * batch_size, padding="max_length", max_length=max_length, return_tensors="pt") >>> uncond_embeddings = text_encoder(uncond_input.input_ids.to(torch_device))[0] ``` 두번의 forward pass를 피하기 위해 conditional 임베딩과 unconditional 임베딩을 배치(batch)로 연결하겠습니다: ```py >>> text_embeddings = torch.cat([uncond_embeddings, text_embeddings]) ``` ### 랜덤 노이즈 생성 그다음 diffusion 프로세스의 시작점으로 초기 랜덤 노이즈를 생성합니다. 이것이 이미지의 잠재적 표현이며 점차적으로 노이즈가 제거됩니다. 이 시점에서 `latent` 이미지는 최종 이미지 크기보다 작지만 나중에 모델이 이를 512x512 이미지 크기로 변환하므로 괜찮습니다. <Tip> 💡 `vae` 모델에는 3개의 다운 샘플링 레이어가 있기 때문에 높이와 너비가 8로 나뉩니다. 다음을 실행하여 확인할 수 있습니다: ```py 2 ** (len(vae.config.block_out_channels) - 1) == 8 ``` </Tip> ```py >>> latents = torch.randn( ... (batch_size, unet.config.in_channels, height // 8, width // 8), ... generator=generator, ... device=torch_device, ... ) ``` ### 이미지 노이즈 제거 먼저 [`UniPCMultistepScheduler`]와 같은 향상된 스케줄러에 필요한 노이즈 스케일 값인 초기 노이즈 분포 *sigma* 로 입력을 스케일링 하는 것부터 시작합니다: ```py >>> latents = latents * scheduler.init_noise_sigma ``` 마지막 단계는 `latent`의 순수한 노이즈를 점진적으로 프롬프트에 설명된 이미지로 변환하는 노이즈 제거 루프를 생성하는 것입니다. 노이즈 제거 루프는 세 가지 작업을 수행해야 한다는 점을 기억하세요: 1. 노이즈 제거 중에 사용할 스케줄러의 timesteps를 설정합니다. 2. timestep을 따라 반복합니다. 3. 각 timestep에서 UNet 모델을 호출하여 noise residual을 예측하고 스케줄러에 전달하여 이전 노이즈 샘플을 계산합니다. ```py >>> from tqdm.auto import tqdm >>> scheduler.set_timesteps(num_inference_steps) >>> for t in tqdm(scheduler.timesteps): ... # classifier-free guidance를 수행하는 경우 두번의 forward pass를 수행하지 않도록 latent를 확장. ... latent_model_input = torch.cat([latents] * 2) ... latent_model_input = scheduler.scale_model_input(latent_model_input, timestep=t) ... # noise residual 예측 ... with torch.no_grad(): ... noise_pred = unet(latent_model_input, t, encoder_hidden_states=text_embeddings).sample ... # guidance 수행 ... noise_pred_uncond, noise_pred_text = noise_pred.chunk(2) ... noise_pred = noise_pred_uncond + guidance_scale * (noise_pred_text - noise_pred_uncond) ... # 이전 노이즈 샘플을 계산 x_t -> x_t-1 ... latents = scheduler.step(noise_pred, t, latents).prev_sample ``` ### 이미지 디코딩 마지막 단계는 `vae`를 이용하여 잠재 표현을 이미지로 디코딩하고 `sample`과 함께 디코딩된 출력을 얻는 것입니다: ```py # latent를 스케일링하고 vae로 이미지 디코딩 latents = 1 / 0.18215 * latents with torch.no_grad(): image = vae.decode(latents).sample ``` 마지막으로 이미지를 `PIL.Image`로 변환하면 생성된 이미지를 확인할 수 있습니다! ```py >>> image = (image / 2 + 0.5).clamp(0, 1) >>> image = image.detach().cpu().permute(0, 2, 3, 1).numpy() >>> images = (image * 255).round().astype("uint8") >>> pil_images = [Image.fromarray(image) for image in images] >>> pil_images[0] ``` <div class="flex justify-center"> <img src="https://huggingface.co/blog/assets/98_stable_diffusion/stable_diffusion_k_lms.png"/> </div> ## 다음 단계 기본 파이프라인부터 복잡한 파이프라인까지, 자신만의 diffusion 시스템을 작성하는 데 필요한 것은 노이즈 제거 루프뿐이라는 것을 알 수 있었습니다. 이 루프는 스케줄러의 timesteps를 설정하고, 이를 반복하며, UNet 모델을 호출하여 noise residual을 예측하고 스케줄러에 전달하여 이전 노이즈 샘플을 계산하는 과정을 번갈아 가며 수행해야 합니다. 이것이 바로 🧨 Diffusers가 설계된 목적입니다: 모델과 스케줄러를 사용해 자신만의 diffusion 시스템을 직관적이고 쉽게 작성할 수 있도록 하기 위해서입니다. 다음 단계를 자유롭게 진행하세요: * 🧨 Diffusers에 [파이프라인 구축 및 기여](using-diffusers/#contribute_pipeline)하는 방법을 알아보세요. 여러분이 어떤 아이디어를 내놓을지 기대됩니다! * 라이브러리에서 [기본 파이프라인](./api/pipelines/overview)을 살펴보고, 모델과 스케줄러를 별도로 사용하여 파이프라인을 처음부터 해체하고 빌드할 수 있는지 확인해 보세요.
diffusers/docs/source/ko/using-diffusers/write_own_pipeline.md/0
{ "file_path": "diffusers/docs/source/ko/using-diffusers/write_own_pipeline.md", "repo_id": "diffusers", "token_count": 9948 }
109
# coding=utf-8 # Copyright 2024 The HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import argparse import copy import logging import math import os import shutil from contextlib import nullcontext from pathlib import Path import torch import torch.nn.functional as F from accelerate import Accelerator from accelerate.logging import get_logger from accelerate.utils import ProjectConfiguration, set_seed from datasets import load_dataset from peft import LoraConfig from peft.utils import get_peft_model_state_dict from PIL import Image from PIL.ImageOps import exif_transpose from torch.utils.data import DataLoader, Dataset, default_collate from torchvision import transforms from transformers import ( CLIPTextModelWithProjection, CLIPTokenizer, ) import diffusers.optimization from diffusers import AmusedPipeline, AmusedScheduler, EMAModel, UVit2DModel, VQModel from diffusers.loaders import LoraLoaderMixin from diffusers.utils import is_wandb_available if is_wandb_available(): import wandb logger = get_logger(__name__, log_level="INFO") def parse_args(): parser = argparse.ArgumentParser() parser.add_argument( "--pretrained_model_name_or_path", type=str, default=None, required=True, help="Path to pretrained model or model identifier from huggingface.co/models.", ) parser.add_argument( "--revision", type=str, default=None, required=False, help="Revision of pretrained model identifier from huggingface.co/models.", ) parser.add_argument( "--variant", type=str, default=None, help="Variant of the model files of the pretrained model identifier from huggingface.co/models, 'e.g.' fp16", ) parser.add_argument( "--instance_data_dataset", type=str, default=None, required=False, help="A Hugging Face dataset containing the training images", ) parser.add_argument( "--instance_data_dir", type=str, default=None, required=False, help="A folder containing the training data of instance images.", ) parser.add_argument( "--instance_data_image", type=str, default=None, required=False, help="A single training image" ) parser.add_argument( "--use_8bit_adam", action="store_true", help="Whether or not to use 8-bit Adam from bitsandbytes." ) parser.add_argument( "--dataloader_num_workers", type=int, default=0, help=( "Number of subprocesses to use for data loading. 0 means that the data will be loaded in the main process." ), ) parser.add_argument( "--allow_tf32", action="store_true", help=( "Whether or not to allow TF32 on Ampere GPUs. Can be used to speed up training. For more information, see" " https://pytorch.org/docs/stable/notes/cuda.html#tensorfloat-32-tf32-on-ampere-devices" ), ) parser.add_argument("--use_ema", action="store_true", help="Whether to use EMA model.") parser.add_argument("--ema_decay", type=float, default=0.9999) parser.add_argument("--ema_update_after_step", type=int, default=0) parser.add_argument("--adam_beta1", type=float, default=0.9, help="The beta1 parameter for the Adam optimizer.") parser.add_argument("--adam_beta2", type=float, default=0.999, help="The beta2 parameter for the Adam optimizer.") parser.add_argument("--adam_weight_decay", type=float, default=1e-2, help="Weight decay to use.") parser.add_argument("--adam_epsilon", type=float, default=1e-08, help="Epsilon value for the Adam optimizer") parser.add_argument( "--output_dir", type=str, default="muse_training", help="The output directory where the model predictions and checkpoints will be written.", ) parser.add_argument("--seed", type=int, default=None, help="A seed for reproducible training.") parser.add_argument( "--logging_dir", type=str, default="logs", help=( "[TensorBoard](https://www.tensorflow.org/tensorboard) log directory. Will default to" " *output_dir/runs/**CURRENT_DATETIME_HOSTNAME***." ), ) parser.add_argument( "--max_train_steps", type=int, default=None, help="Total number of training steps to perform. If provided, overrides num_train_epochs.", ) parser.add_argument( "--checkpointing_steps", type=int, default=500, help=( "Save a checkpoint of the training state every X updates. Checkpoints can be used for resuming training via `--resume_from_checkpoint`. " "In the case that the checkpoint is better than the final trained model, the checkpoint can also be used for inference." "Using a checkpoint for inference requires separate loading of the original pipeline and the individual checkpointed model components." "See https://huggingface.co/docs/diffusers/main/en/training/dreambooth#performing-inference-using-a-saved-checkpoint for step by step" "instructions." ), ) parser.add_argument( "--logging_steps", type=int, default=50, ) parser.add_argument( "--checkpoints_total_limit", type=int, default=None, help=( "Max number of checkpoints to store. Passed as `total_limit` to the `Accelerator` `ProjectConfiguration`." " See Accelerator::save_state https://huggingface.co/docs/accelerate/package_reference/accelerator#accelerate.Accelerator.save_state" " for more details" ), ) parser.add_argument( "--resume_from_checkpoint", type=str, default=None, help=( "Whether training should be resumed from a previous checkpoint. Use a path saved by" ' `--checkpointing_steps`, or `"latest"` to automatically select the last available checkpoint.' ), ) parser.add_argument( "--train_batch_size", type=int, default=16, help="Batch size (per device) for the training dataloader." ) parser.add_argument( "--gradient_accumulation_steps", type=int, default=1, help="Number of updates steps to accumulate before performing a backward/update pass.", ) parser.add_argument( "--learning_rate", type=float, default=0.0003, help="Initial learning rate (after the potential warmup period) to use.", ) parser.add_argument( "--scale_lr", action="store_true", default=False, help="Scale the learning rate by the number of GPUs, gradient accumulation steps, and batch size.", ) parser.add_argument( "--lr_scheduler", type=str, default="constant", help=( 'The scheduler type to use. Choose between ["linear", "cosine", "cosine_with_restarts", "polynomial",' ' "constant", "constant_with_warmup"]' ), ) parser.add_argument( "--lr_warmup_steps", type=int, default=500, help="Number of steps for the warmup in the lr scheduler." ) parser.add_argument( "--validation_steps", type=int, default=100, help=( "Run validation every X steps. Validation consists of running the prompt" " `args.validation_prompt` multiple times: `args.num_validation_images`" " and logging the images." ), ) parser.add_argument( "--mixed_precision", type=str, default=None, choices=["no", "fp16", "bf16"], help=( "Whether to use mixed precision. Choose between fp16 and bf16 (bfloat16). Bf16 requires PyTorch >=" " 1.10.and an Nvidia Ampere GPU. Default to the value of accelerate config of the current system or the" " flag passed with the `accelerate.launch` command. Use this argument to override the accelerate config." ), ) parser.add_argument( "--report_to", type=str, default="wandb", help=( 'The integration to report the results and logs to. Supported platforms are `"tensorboard"`' ' (default), `"wandb"` and `"comet_ml"`. Use `"all"` to report to all integrations.' ), ) parser.add_argument("--validation_prompts", type=str, nargs="*") parser.add_argument( "--resolution", type=int, default=512, help=( "The resolution for input images, all the images in the train/validation dataset will be resized to this" " resolution" ), ) parser.add_argument("--split_vae_encode", type=int, required=False, default=None) parser.add_argument("--min_masking_rate", type=float, default=0.0) parser.add_argument("--cond_dropout_prob", type=float, default=0.0) parser.add_argument("--max_grad_norm", default=None, type=float, help="Max gradient norm.", required=False) parser.add_argument("--use_lora", action="store_true", help="Fine tune the model using LoRa") parser.add_argument("--text_encoder_use_lora", action="store_true", help="Fine tune the model using LoRa") parser.add_argument("--lora_r", default=16, type=int) parser.add_argument("--lora_alpha", default=32, type=int) parser.add_argument("--lora_target_modules", default=["to_q", "to_k", "to_v"], type=str, nargs="+") parser.add_argument("--text_encoder_lora_r", default=16, type=int) parser.add_argument("--text_encoder_lora_alpha", default=32, type=int) parser.add_argument("--text_encoder_lora_target_modules", default=["to_q", "to_k", "to_v"], type=str, nargs="+") parser.add_argument("--train_text_encoder", action="store_true") parser.add_argument("--image_key", type=str, required=False) parser.add_argument("--prompt_key", type=str, required=False) parser.add_argument( "--gradient_checkpointing", action="store_true", help="Whether or not to use gradient checkpointing to save memory at the expense of slower backward pass.", ) parser.add_argument("--prompt_prefix", type=str, required=False, default=None) args = parser.parse_args() if args.report_to == "wandb": if not is_wandb_available(): raise ImportError("Make sure to install wandb if you want to use it for logging during training.") num_datasources = sum( [x is not None for x in [args.instance_data_dir, args.instance_data_image, args.instance_data_dataset]] ) if num_datasources != 1: raise ValueError( "provide one and only one of `--instance_data_dir`, `--instance_data_image`, or `--instance_data_dataset`" ) if args.instance_data_dir is not None: if not os.path.exists(args.instance_data_dir): raise ValueError(f"Does not exist: `--args.instance_data_dir` {args.instance_data_dir}") if args.instance_data_image is not None: if not os.path.exists(args.instance_data_image): raise ValueError(f"Does not exist: `--args.instance_data_image` {args.instance_data_image}") if args.instance_data_dataset is not None and (args.image_key is None or args.prompt_key is None): raise ValueError("`--instance_data_dataset` requires setting `--image_key` and `--prompt_key`") return args class InstanceDataRootDataset(Dataset): def __init__( self, instance_data_root, tokenizer, size=512, ): self.size = size self.tokenizer = tokenizer self.instance_images_path = list(Path(instance_data_root).iterdir()) def __len__(self): return len(self.instance_images_path) def __getitem__(self, index): image_path = self.instance_images_path[index % len(self.instance_images_path)] instance_image = Image.open(image_path) rv = process_image(instance_image, self.size) prompt = os.path.splitext(os.path.basename(image_path))[0] rv["prompt_input_ids"] = tokenize_prompt(self.tokenizer, prompt)[0] return rv class InstanceDataImageDataset(Dataset): def __init__( self, instance_data_image, train_batch_size, size=512, ): self.value = process_image(Image.open(instance_data_image), size) self.train_batch_size = train_batch_size def __len__(self): # Needed so a full batch of the data can be returned. Otherwise will return # batches of size 1 return self.train_batch_size def __getitem__(self, index): return self.value class HuggingFaceDataset(Dataset): def __init__( self, hf_dataset, tokenizer, image_key, prompt_key, prompt_prefix=None, size=512, ): self.size = size self.image_key = image_key self.prompt_key = prompt_key self.tokenizer = tokenizer self.hf_dataset = hf_dataset self.prompt_prefix = prompt_prefix def __len__(self): return len(self.hf_dataset) def __getitem__(self, index): item = self.hf_dataset[index] rv = process_image(item[self.image_key], self.size) prompt = item[self.prompt_key] if self.prompt_prefix is not None: prompt = self.prompt_prefix + prompt rv["prompt_input_ids"] = tokenize_prompt(self.tokenizer, prompt)[0] return rv def process_image(image, size): image = exif_transpose(image) if not image.mode == "RGB": image = image.convert("RGB") orig_height = image.height orig_width = image.width image = transforms.Resize(size, interpolation=transforms.InterpolationMode.BILINEAR)(image) c_top, c_left, _, _ = transforms.RandomCrop.get_params(image, output_size=(size, size)) image = transforms.functional.crop(image, c_top, c_left, size, size) image = transforms.ToTensor()(image) micro_conds = torch.tensor( [orig_width, orig_height, c_top, c_left, 6.0], ) return {"image": image, "micro_conds": micro_conds} def tokenize_prompt(tokenizer, prompt): return tokenizer( prompt, truncation=True, padding="max_length", max_length=77, return_tensors="pt", ).input_ids def encode_prompt(text_encoder, input_ids): outputs = text_encoder(input_ids, return_dict=True, output_hidden_states=True) encoder_hidden_states = outputs.hidden_states[-2] cond_embeds = outputs[0] return encoder_hidden_states, cond_embeds def main(args): if args.allow_tf32: torch.backends.cuda.matmul.allow_tf32 = True logging_dir = Path(args.output_dir, args.logging_dir) accelerator_project_config = ProjectConfiguration(project_dir=args.output_dir, logging_dir=logging_dir) accelerator = Accelerator( gradient_accumulation_steps=args.gradient_accumulation_steps, mixed_precision=args.mixed_precision, log_with=args.report_to, project_config=accelerator_project_config, ) # Disable AMP for MPS. if torch.backends.mps.is_available(): accelerator.native_amp = False if accelerator.is_main_process: os.makedirs(args.output_dir, exist_ok=True) # Make one log on every process with the configuration for debugging. logging.basicConfig( format="%(asctime)s - %(levelname)s - %(name)s - %(message)s", datefmt="%m/%d/%Y %H:%M:%S", level=logging.INFO, ) logger.info(accelerator.state, main_process_only=False) if accelerator.is_main_process: accelerator.init_trackers("amused", config=vars(copy.deepcopy(args))) if args.seed is not None: set_seed(args.seed) # TODO - will have to fix loading if training text encoder text_encoder = CLIPTextModelWithProjection.from_pretrained( args.pretrained_model_name_or_path, subfolder="text_encoder", revision=args.revision, variant=args.variant ) tokenizer = CLIPTokenizer.from_pretrained( args.pretrained_model_name_or_path, subfolder="tokenizer", revision=args.revision, variant=args.variant ) vq_model = VQModel.from_pretrained( args.pretrained_model_name_or_path, subfolder="vqvae", revision=args.revision, variant=args.variant ) if args.train_text_encoder: if args.text_encoder_use_lora: lora_config = LoraConfig( r=args.text_encoder_lora_r, lora_alpha=args.text_encoder_lora_alpha, target_modules=args.text_encoder_lora_target_modules, ) text_encoder.add_adapter(lora_config) text_encoder.train() text_encoder.requires_grad_(True) else: text_encoder.eval() text_encoder.requires_grad_(False) vq_model.requires_grad_(False) model = UVit2DModel.from_pretrained( args.pretrained_model_name_or_path, subfolder="transformer", revision=args.revision, variant=args.variant, ) if args.use_lora: lora_config = LoraConfig( r=args.lora_r, lora_alpha=args.lora_alpha, target_modules=args.lora_target_modules, ) model.add_adapter(lora_config) model.train() if args.gradient_checkpointing: model.enable_gradient_checkpointing() if args.train_text_encoder: text_encoder.gradient_checkpointing_enable() if args.use_ema: ema = EMAModel( model.parameters(), decay=args.ema_decay, update_after_step=args.ema_update_after_step, model_cls=UVit2DModel, model_config=model.config, ) def save_model_hook(models, weights, output_dir): if accelerator.is_main_process: transformer_lora_layers_to_save = None text_encoder_lora_layers_to_save = None for model_ in models: if isinstance(model_, type(accelerator.unwrap_model(model))): if args.use_lora: transformer_lora_layers_to_save = get_peft_model_state_dict(model_) else: model_.save_pretrained(os.path.join(output_dir, "transformer")) elif isinstance(model_, type(accelerator.unwrap_model(text_encoder))): if args.text_encoder_use_lora: text_encoder_lora_layers_to_save = get_peft_model_state_dict(model_) else: model_.save_pretrained(os.path.join(output_dir, "text_encoder")) else: raise ValueError(f"unexpected save model: {model_.__class__}") # make sure to pop weight so that corresponding model is not saved again weights.pop() if transformer_lora_layers_to_save is not None or text_encoder_lora_layers_to_save is not None: LoraLoaderMixin.save_lora_weights( output_dir, transformer_lora_layers=transformer_lora_layers_to_save, text_encoder_lora_layers=text_encoder_lora_layers_to_save, ) if args.use_ema: ema.save_pretrained(os.path.join(output_dir, "ema_model")) def load_model_hook(models, input_dir): transformer = None text_encoder_ = None while len(models) > 0: model_ = models.pop() if isinstance(model_, type(accelerator.unwrap_model(model))): if args.use_lora: transformer = model_ else: load_model = UVit2DModel.from_pretrained(os.path.join(input_dir, "transformer")) model_.load_state_dict(load_model.state_dict()) del load_model elif isinstance(model, type(accelerator.unwrap_model(text_encoder))): if args.text_encoder_use_lora: text_encoder_ = model_ else: load_model = CLIPTextModelWithProjection.from_pretrained(os.path.join(input_dir, "text_encoder")) model_.load_state_dict(load_model.state_dict()) del load_model else: raise ValueError(f"unexpected save model: {model.__class__}") if transformer is not None or text_encoder_ is not None: lora_state_dict, network_alphas = LoraLoaderMixin.lora_state_dict(input_dir) LoraLoaderMixin.load_lora_into_text_encoder( lora_state_dict, network_alphas=network_alphas, text_encoder=text_encoder_ ) LoraLoaderMixin.load_lora_into_transformer( lora_state_dict, network_alphas=network_alphas, transformer=transformer ) if args.use_ema: load_from = EMAModel.from_pretrained(os.path.join(input_dir, "ema_model"), model_cls=UVit2DModel) ema.load_state_dict(load_from.state_dict()) del load_from accelerator.register_load_state_pre_hook(load_model_hook) accelerator.register_save_state_pre_hook(save_model_hook) if args.scale_lr: args.learning_rate = ( args.learning_rate * args.train_batch_size * accelerator.num_processes * args.gradient_accumulation_steps ) if args.use_8bit_adam: try: import bitsandbytes as bnb except ImportError: raise ImportError( "Please install bitsandbytes to use 8-bit Adam. You can do so by running `pip install bitsandbytes`" ) optimizer_cls = bnb.optim.AdamW8bit else: optimizer_cls = torch.optim.AdamW # no decay on bias and layernorm and embedding no_decay = ["bias", "layer_norm.weight", "mlm_ln.weight", "embeddings.weight"] optimizer_grouped_parameters = [ { "params": [p for n, p in model.named_parameters() if not any(nd in n for nd in no_decay)], "weight_decay": args.adam_weight_decay, }, { "params": [p for n, p in model.named_parameters() if any(nd in n for nd in no_decay)], "weight_decay": 0.0, }, ] if args.train_text_encoder: optimizer_grouped_parameters.append( {"params": text_encoder.parameters(), "weight_decay": args.adam_weight_decay} ) optimizer = optimizer_cls( optimizer_grouped_parameters, lr=args.learning_rate, betas=(args.adam_beta1, args.adam_beta2), weight_decay=args.adam_weight_decay, eps=args.adam_epsilon, ) logger.info("Creating dataloaders and lr_scheduler") total_batch_size = args.train_batch_size * accelerator.num_processes * args.gradient_accumulation_steps if args.instance_data_dir is not None: dataset = InstanceDataRootDataset( instance_data_root=args.instance_data_dir, tokenizer=tokenizer, size=args.resolution, ) elif args.instance_data_image is not None: dataset = InstanceDataImageDataset( instance_data_image=args.instance_data_image, train_batch_size=args.train_batch_size, size=args.resolution, ) elif args.instance_data_dataset is not None: dataset = HuggingFaceDataset( hf_dataset=load_dataset(args.instance_data_dataset, split="train"), tokenizer=tokenizer, image_key=args.image_key, prompt_key=args.prompt_key, prompt_prefix=args.prompt_prefix, size=args.resolution, ) else: assert False train_dataloader = DataLoader( dataset, batch_size=args.train_batch_size, shuffle=True, num_workers=args.dataloader_num_workers, collate_fn=default_collate, ) train_dataloader.num_batches = len(train_dataloader) lr_scheduler = diffusers.optimization.get_scheduler( args.lr_scheduler, optimizer=optimizer, num_training_steps=args.max_train_steps * accelerator.num_processes, num_warmup_steps=args.lr_warmup_steps * accelerator.num_processes, ) logger.info("Preparing model, optimizer and dataloaders") if args.train_text_encoder: model, optimizer, lr_scheduler, train_dataloader, text_encoder = accelerator.prepare( model, optimizer, lr_scheduler, train_dataloader, text_encoder ) else: model, optimizer, lr_scheduler, train_dataloader = accelerator.prepare( model, optimizer, lr_scheduler, train_dataloader ) train_dataloader.num_batches = len(train_dataloader) weight_dtype = torch.float32 if accelerator.mixed_precision == "fp16": weight_dtype = torch.float16 elif accelerator.mixed_precision == "bf16": weight_dtype = torch.bfloat16 if not args.train_text_encoder: text_encoder.to(device=accelerator.device, dtype=weight_dtype) vq_model.to(device=accelerator.device) if args.use_ema: ema.to(accelerator.device) with nullcontext() if args.train_text_encoder else torch.no_grad(): empty_embeds, empty_clip_embeds = encode_prompt( text_encoder, tokenize_prompt(tokenizer, "").to(text_encoder.device, non_blocking=True) ) # There is a single image, we can just pre-encode the single prompt if args.instance_data_image is not None: prompt = os.path.splitext(os.path.basename(args.instance_data_image))[0] encoder_hidden_states, cond_embeds = encode_prompt( text_encoder, tokenize_prompt(tokenizer, prompt).to(text_encoder.device, non_blocking=True) ) encoder_hidden_states = encoder_hidden_states.repeat(args.train_batch_size, 1, 1) cond_embeds = cond_embeds.repeat(args.train_batch_size, 1) # We need to recalculate our total training steps as the size of the training dataloader may have changed. num_update_steps_per_epoch = math.ceil(train_dataloader.num_batches / args.gradient_accumulation_steps) # Afterwards we recalculate our number of training epochs. # Note: We are not doing epoch based training here, but just using this for book keeping and being able to # reuse the same training loop with other datasets/loaders. num_train_epochs = math.ceil(args.max_train_steps / num_update_steps_per_epoch) # Train! logger.info("***** Running training *****") logger.info(f" Num training steps = {args.max_train_steps}") logger.info(f" Instantaneous batch size per device = { args.train_batch_size}") logger.info(f" Total train batch size (w. parallel, distributed & accumulation) = {total_batch_size}") logger.info(f" Gradient Accumulation steps = {args.gradient_accumulation_steps}") resume_from_checkpoint = args.resume_from_checkpoint if resume_from_checkpoint: if resume_from_checkpoint == "latest": # Get the most recent checkpoint dirs = os.listdir(args.output_dir) dirs = [d for d in dirs if d.startswith("checkpoint")] dirs = sorted(dirs, key=lambda x: int(x.split("-")[1])) if len(dirs) > 0: resume_from_checkpoint = os.path.join(args.output_dir, dirs[-1]) else: resume_from_checkpoint = None if resume_from_checkpoint is None: accelerator.print( f"Checkpoint '{args.resume_from_checkpoint}' does not exist. Starting a new training run." ) else: accelerator.print(f"Resuming from checkpoint {resume_from_checkpoint}") if resume_from_checkpoint is None: global_step = 0 first_epoch = 0 else: accelerator.load_state(resume_from_checkpoint) global_step = int(os.path.basename(resume_from_checkpoint).split("-")[1]) first_epoch = global_step // num_update_steps_per_epoch # As stated above, we are not doing epoch based training here, but just using this for book keeping and being able to # reuse the same training loop with other datasets/loaders. for epoch in range(first_epoch, num_train_epochs): for batch in train_dataloader: with torch.no_grad(): micro_conds = batch["micro_conds"].to(accelerator.device, non_blocking=True) pixel_values = batch["image"].to(accelerator.device, non_blocking=True) batch_size = pixel_values.shape[0] split_batch_size = args.split_vae_encode if args.split_vae_encode is not None else batch_size num_splits = math.ceil(batch_size / split_batch_size) image_tokens = [] for i in range(num_splits): start_idx = i * split_batch_size end_idx = min((i + 1) * split_batch_size, batch_size) bs = pixel_values.shape[0] image_tokens.append( vq_model.quantize(vq_model.encode(pixel_values[start_idx:end_idx]).latents)[2][2].reshape( bs, -1 ) ) image_tokens = torch.cat(image_tokens, dim=0) batch_size, seq_len = image_tokens.shape timesteps = torch.rand(batch_size, device=image_tokens.device) mask_prob = torch.cos(timesteps * math.pi * 0.5) mask_prob = mask_prob.clip(args.min_masking_rate) num_token_masked = (seq_len * mask_prob).round().clamp(min=1) batch_randperm = torch.rand(batch_size, seq_len, device=image_tokens.device).argsort(dim=-1) mask = batch_randperm < num_token_masked.unsqueeze(-1) mask_id = accelerator.unwrap_model(model).config.vocab_size - 1 input_ids = torch.where(mask, mask_id, image_tokens) labels = torch.where(mask, image_tokens, -100) if args.cond_dropout_prob > 0.0: assert encoder_hidden_states is not None batch_size = encoder_hidden_states.shape[0] mask = ( torch.zeros((batch_size, 1, 1), device=encoder_hidden_states.device).float().uniform_(0, 1) < args.cond_dropout_prob ) empty_embeds_ = empty_embeds.expand(batch_size, -1, -1) encoder_hidden_states = torch.where( (encoder_hidden_states * mask).bool(), encoder_hidden_states, empty_embeds_ ) empty_clip_embeds_ = empty_clip_embeds.expand(batch_size, -1) cond_embeds = torch.where((cond_embeds * mask.squeeze(-1)).bool(), cond_embeds, empty_clip_embeds_) bs = input_ids.shape[0] vae_scale_factor = 2 ** (len(vq_model.config.block_out_channels) - 1) resolution = args.resolution // vae_scale_factor input_ids = input_ids.reshape(bs, resolution, resolution) if "prompt_input_ids" in batch: with nullcontext() if args.train_text_encoder else torch.no_grad(): encoder_hidden_states, cond_embeds = encode_prompt( text_encoder, batch["prompt_input_ids"].to(accelerator.device, non_blocking=True) ) # Train Step with accelerator.accumulate(model): codebook_size = accelerator.unwrap_model(model).config.codebook_size logits = ( model( input_ids=input_ids, encoder_hidden_states=encoder_hidden_states, micro_conds=micro_conds, pooled_text_emb=cond_embeds, ) .reshape(bs, codebook_size, -1) .permute(0, 2, 1) .reshape(-1, codebook_size) ) loss = F.cross_entropy( logits, labels.view(-1), ignore_index=-100, reduction="mean", ) # Gather the losses across all processes for logging (if we use distributed training). avg_loss = accelerator.gather(loss.repeat(args.train_batch_size)).mean() avg_masking_rate = accelerator.gather(mask_prob.repeat(args.train_batch_size)).mean() accelerator.backward(loss) if args.max_grad_norm is not None and accelerator.sync_gradients: accelerator.clip_grad_norm_(model.parameters(), args.max_grad_norm) optimizer.step() lr_scheduler.step() optimizer.zero_grad(set_to_none=True) # Checks if the accelerator has performed an optimization step behind the scenes if accelerator.sync_gradients: if args.use_ema: ema.step(model.parameters()) if (global_step + 1) % args.logging_steps == 0: logs = { "step_loss": avg_loss.item(), "lr": lr_scheduler.get_last_lr()[0], "avg_masking_rate": avg_masking_rate.item(), } accelerator.log(logs, step=global_step + 1) logger.info( f"Step: {global_step + 1} " f"Loss: {avg_loss.item():0.4f} " f"LR: {lr_scheduler.get_last_lr()[0]:0.6f}" ) if (global_step + 1) % args.checkpointing_steps == 0: save_checkpoint(args, accelerator, global_step + 1) if (global_step + 1) % args.validation_steps == 0 and accelerator.is_main_process: if args.use_ema: ema.store(model.parameters()) ema.copy_to(model.parameters()) with torch.no_grad(): logger.info("Generating images...") model.eval() if args.train_text_encoder: text_encoder.eval() scheduler = AmusedScheduler.from_pretrained( args.pretrained_model_name_or_path, subfolder="scheduler", revision=args.revision, variant=args.variant, ) pipe = AmusedPipeline( transformer=accelerator.unwrap_model(model), tokenizer=tokenizer, text_encoder=text_encoder, vqvae=vq_model, scheduler=scheduler, ) pil_images = pipe(prompt=args.validation_prompts).images wandb_images = [ wandb.Image(image, caption=args.validation_prompts[i]) for i, image in enumerate(pil_images) ] wandb.log({"generated_images": wandb_images}, step=global_step + 1) model.train() if args.train_text_encoder: text_encoder.train() if args.use_ema: ema.restore(model.parameters()) global_step += 1 # Stop training if max steps is reached if global_step >= args.max_train_steps: break # End for accelerator.wait_for_everyone() # Evaluate and save checkpoint at the end of training save_checkpoint(args, accelerator, global_step) # Save the final trained checkpoint if accelerator.is_main_process: model = accelerator.unwrap_model(model) if args.use_ema: ema.copy_to(model.parameters()) model.save_pretrained(args.output_dir) accelerator.end_training() def save_checkpoint(args, accelerator, global_step): output_dir = args.output_dir # _before_ saving state, check if this save would set us over the `checkpoints_total_limit` if accelerator.is_main_process and args.checkpoints_total_limit is not None: checkpoints = os.listdir(output_dir) checkpoints = [d for d in checkpoints if d.startswith("checkpoint")] checkpoints = sorted(checkpoints, key=lambda x: int(x.split("-")[1])) # before we save the new checkpoint, we need to have at _most_ `checkpoints_total_limit - 1` checkpoints if len(checkpoints) >= args.checkpoints_total_limit: num_to_remove = len(checkpoints) - args.checkpoints_total_limit + 1 removing_checkpoints = checkpoints[0:num_to_remove] logger.info( f"{len(checkpoints)} checkpoints already exist, removing {len(removing_checkpoints)} checkpoints" ) logger.info(f"removing checkpoints: {', '.join(removing_checkpoints)}") for removing_checkpoint in removing_checkpoints: removing_checkpoint = os.path.join(output_dir, removing_checkpoint) shutil.rmtree(removing_checkpoint) save_path = Path(output_dir) / f"checkpoint-{global_step}" accelerator.save_state(save_path) logger.info(f"Saved state to {save_path}") if __name__ == "__main__": main(parse_args())
diffusers/examples/amused/train_amused.py/0
{ "file_path": "diffusers/examples/amused/train_amused.py", "repo_id": "diffusers", "token_count": 17503 }
110
import inspect from typing import Callable, List, Optional, Tuple, Union import numpy as np import PIL.Image import torch from transformers import CLIPImageProcessor, CLIPTextModel, CLIPTokenizer from diffusers import DiffusionPipeline from diffusers.configuration_utils import FrozenDict from diffusers.models import AutoencoderKL, UNet2DConditionModel from diffusers.pipelines.stable_diffusion import StableDiffusionPipelineOutput from diffusers.pipelines.stable_diffusion.safety_checker import StableDiffusionSafetyChecker from diffusers.schedulers import DDIMScheduler, LMSDiscreteScheduler, PNDMScheduler from diffusers.utils import deprecate, logging logger = logging.get_logger(__name__) # pylint: disable=invalid-name def prepare_mask_and_masked_image(image, mask): image = np.array(image.convert("RGB")) image = image[None].transpose(0, 3, 1, 2) image = torch.from_numpy(image).to(dtype=torch.float32) / 127.5 - 1.0 mask = np.array(mask.convert("L")) mask = mask.astype(np.float32) / 255.0 mask = mask[None, None] mask[mask < 0.5] = 0 mask[mask >= 0.5] = 1 mask = torch.from_numpy(mask) masked_image = image * (mask < 0.5) return mask, masked_image def check_size(image, height, width): if isinstance(image, PIL.Image.Image): w, h = image.size elif isinstance(image, torch.Tensor): *_, h, w = image.shape if h != height or w != width: raise ValueError(f"Image size should be {height}x{width}, but got {h}x{w}") def overlay_inner_image(image, inner_image, paste_offset: Tuple[int] = (0, 0)): inner_image = inner_image.convert("RGBA") image = image.convert("RGB") image.paste(inner_image, paste_offset, inner_image) image = image.convert("RGB") return image class ImageToImageInpaintingPipeline(DiffusionPipeline): r""" Pipeline for text-guided image-to-image inpainting using Stable Diffusion. *This is an experimental feature*. This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods the library implements for all the pipelines (such as downloading or saving, running on a particular device, etc.) Args: vae ([`AutoencoderKL`]): Variational Auto-Encoder (VAE) Model to encode and decode images to and from latent representations. text_encoder ([`CLIPTextModel`]): Frozen text-encoder. Stable Diffusion uses the text portion of [CLIP](https://huggingface.co/docs/transformers/model_doc/clip#transformers.CLIPTextModel), specifically the [clip-vit-large-patch14](https://huggingface.co/openai/clip-vit-large-patch14) variant. tokenizer (`CLIPTokenizer`): Tokenizer of class [CLIPTokenizer](https://huggingface.co/docs/transformers/v4.21.0/en/model_doc/clip#transformers.CLIPTokenizer). unet ([`UNet2DConditionModel`]): Conditional U-Net architecture to denoise the encoded image latents. scheduler ([`SchedulerMixin`]): A scheduler to be used in combination with `unet` to denoise the encoded image latens. Can be one of [`DDIMScheduler`], [`LMSDiscreteScheduler`], or [`PNDMScheduler`]. safety_checker ([`StableDiffusionSafetyChecker`]): Classification module that estimates whether generated images could be considered offensive or harmful. Please, refer to the [model card](https://huggingface.co/runwayml/stable-diffusion-v1-5) for details. feature_extractor ([`CLIPImageProcessor`]): Model that extracts features from generated images to be used as inputs for the `safety_checker`. """ def __init__( self, vae: AutoencoderKL, text_encoder: CLIPTextModel, tokenizer: CLIPTokenizer, unet: UNet2DConditionModel, scheduler: Union[DDIMScheduler, PNDMScheduler, LMSDiscreteScheduler], safety_checker: StableDiffusionSafetyChecker, feature_extractor: CLIPImageProcessor, ): super().__init__() if hasattr(scheduler.config, "steps_offset") and scheduler.config.steps_offset != 1: deprecation_message = ( f"The configuration file of this scheduler: {scheduler} is outdated. `steps_offset`" f" should be set to 1 instead of {scheduler.config.steps_offset}. Please make sure " "to update the config accordingly as leaving `steps_offset` might led to incorrect results" " in future versions. If you have downloaded this checkpoint from the Hugging Face Hub," " it would be very nice if you could open a Pull request for the `scheduler/scheduler_config.json`" " file" ) deprecate("steps_offset!=1", "1.0.0", deprecation_message, standard_warn=False) new_config = dict(scheduler.config) new_config["steps_offset"] = 1 scheduler._internal_dict = FrozenDict(new_config) if safety_checker is None: logger.warning( f"You have disabled the safety checker for {self.__class__} by passing `safety_checker=None`. Ensure" " that you abide to the conditions of the Stable Diffusion license and do not expose unfiltered" " results in services or applications open to the public. Both the diffusers team and Hugging Face" " strongly recommend to keep the safety filter enabled in all public facing circumstances, disabling" " it only for use-cases that involve analyzing network behavior or auditing its results. For more" " information, please have a look at https://github.com/huggingface/diffusers/pull/254 ." ) self.register_modules( vae=vae, text_encoder=text_encoder, tokenizer=tokenizer, unet=unet, scheduler=scheduler, safety_checker=safety_checker, feature_extractor=feature_extractor, ) @torch.no_grad() def __call__( self, prompt: Union[str, List[str]], image: Union[torch.FloatTensor, PIL.Image.Image], inner_image: Union[torch.FloatTensor, PIL.Image.Image], mask_image: Union[torch.FloatTensor, PIL.Image.Image], height: int = 512, width: int = 512, num_inference_steps: int = 50, guidance_scale: float = 7.5, negative_prompt: Optional[Union[str, List[str]]] = None, num_images_per_prompt: Optional[int] = 1, eta: float = 0.0, generator: Optional[torch.Generator] = None, latents: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", return_dict: bool = True, callback: Optional[Callable[[int, int, torch.FloatTensor], None]] = None, callback_steps: int = 1, **kwargs, ): r""" Function invoked when calling the pipeline for generation. Args: prompt (`str` or `List[str]`): The prompt or prompts to guide the image generation. image (`torch.Tensor` or `PIL.Image.Image`): `Image`, or tensor representing an image batch which will be inpainted, *i.e.* parts of the image will be masked out with `mask_image` and repainted according to `prompt`. inner_image (`torch.Tensor` or `PIL.Image.Image`): `Image`, or tensor representing an image batch which will be overlayed onto `image`. Non-transparent regions of `inner_image` must fit inside white pixels in `mask_image`. Expects four channels, with the last channel representing the alpha channel, which will be used to blend `inner_image` with `image`. If not provided, it will be forcibly cast to RGBA. mask_image (`PIL.Image.Image`): `Image`, or tensor representing an image batch, to mask `image`. White pixels in the mask will be repainted, while black pixels will be preserved. If `mask_image` is a PIL image, it will be converted to a single channel (luminance) before use. If it's a tensor, it should contain one color channel (L) instead of 3, so the expected shape would be `(B, H, W, 1)`. height (`int`, *optional*, defaults to 512): The height in pixels of the generated image. width (`int`, *optional*, defaults to 512): The width in pixels of the generated image. num_inference_steps (`int`, *optional*, defaults to 50): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. guidance_scale (`float`, *optional*, defaults to 7.5): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. eta (`float`, *optional*, defaults to 0.0): Corresponds to parameter eta (η) in the DDIM paper: https://arxiv.org/abs/2010.02502. Only applies to [`schedulers.DDIMScheduler`], will be ignored for others. generator (`torch.Generator`, *optional*): A [torch generator](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. latents (`torch.FloatTensor`, *optional*): Pre-generated noisy latents, sampled from a Gaussian distribution, to be used as inputs for image generation. Can be used to tweak the same generation with different prompts. If not provided, a latents tensor will ge generated by sampling using the supplied random `generator`. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between [PIL](https://pillow.readthedocs.io/en/stable/): `PIL.Image.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] instead of a plain tuple. callback (`Callable`, *optional*): A function that will be called every `callback_steps` steps during inference. The function will be called with the following arguments: `callback(step: int, timestep: int, latents: torch.FloatTensor)`. callback_steps (`int`, *optional*, defaults to 1): The frequency at which the `callback` function will be called. If not specified, the callback will be called at every step. Returns: [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] or `tuple`: [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] if `return_dict` is True, otherwise a `tuple. When returning a tuple, the first element is a list with the generated images, and the second element is a list of `bool`s denoting whether the corresponding generated image likely represents "not-safe-for-work" (nsfw) content, according to the `safety_checker`. """ if isinstance(prompt, str): batch_size = 1 elif isinstance(prompt, list): batch_size = len(prompt) else: raise ValueError(f"`prompt` has to be of type `str` or `list` but is {type(prompt)}") if height % 8 != 0 or width % 8 != 0: raise ValueError(f"`height` and `width` have to be divisible by 8 but are {height} and {width}.") if (callback_steps is None) or ( callback_steps is not None and (not isinstance(callback_steps, int) or callback_steps <= 0) ): raise ValueError( f"`callback_steps` has to be a positive integer but is {callback_steps} of type" f" {type(callback_steps)}." ) # check if input sizes are correct check_size(image, height, width) check_size(inner_image, height, width) check_size(mask_image, height, width) # get prompt text embeddings text_inputs = self.tokenizer( prompt, padding="max_length", max_length=self.tokenizer.model_max_length, return_tensors="pt", ) text_input_ids = text_inputs.input_ids if text_input_ids.shape[-1] > self.tokenizer.model_max_length: removed_text = self.tokenizer.batch_decode(text_input_ids[:, self.tokenizer.model_max_length :]) logger.warning( "The following part of your input was truncated because CLIP can only handle sequences up to" f" {self.tokenizer.model_max_length} tokens: {removed_text}" ) text_input_ids = text_input_ids[:, : self.tokenizer.model_max_length] text_embeddings = self.text_encoder(text_input_ids.to(self.device))[0] # duplicate text embeddings for each generation per prompt, using mps friendly method bs_embed, seq_len, _ = text_embeddings.shape text_embeddings = text_embeddings.repeat(1, num_images_per_prompt, 1) text_embeddings = text_embeddings.view(bs_embed * num_images_per_prompt, seq_len, -1) # here `guidance_scale` is defined analog to the guidance weight `w` of equation (2) # of the Imagen paper: https://arxiv.org/pdf/2205.11487.pdf . `guidance_scale = 1` # corresponds to doing no classifier free guidance. do_classifier_free_guidance = guidance_scale > 1.0 # get unconditional embeddings for classifier free guidance if do_classifier_free_guidance: uncond_tokens: List[str] if negative_prompt is None: uncond_tokens = [""] elif type(prompt) is not type(negative_prompt): raise TypeError( f"`negative_prompt` should be the same type to `prompt`, but got {type(negative_prompt)} !=" f" {type(prompt)}." ) elif isinstance(negative_prompt, str): uncond_tokens = [negative_prompt] elif batch_size != len(negative_prompt): raise ValueError( f"`negative_prompt`: {negative_prompt} has batch size {len(negative_prompt)}, but `prompt`:" f" {prompt} has batch size {batch_size}. Please make sure that passed `negative_prompt` matches" " the batch size of `prompt`." ) else: uncond_tokens = negative_prompt max_length = text_input_ids.shape[-1] uncond_input = self.tokenizer( uncond_tokens, padding="max_length", max_length=max_length, truncation=True, return_tensors="pt", ) uncond_embeddings = self.text_encoder(uncond_input.input_ids.to(self.device))[0] # duplicate unconditional embeddings for each generation per prompt, using mps friendly method seq_len = uncond_embeddings.shape[1] uncond_embeddings = uncond_embeddings.repeat(batch_size, num_images_per_prompt, 1) uncond_embeddings = uncond_embeddings.view(batch_size * num_images_per_prompt, seq_len, -1) # For classifier free guidance, we need to do two forward passes. # Here we concatenate the unconditional and text embeddings into a single batch # to avoid doing two forward passes text_embeddings = torch.cat([uncond_embeddings, text_embeddings]) # get the initial random noise unless the user supplied it # Unlike in other pipelines, latents need to be generated in the target device # for 1-to-1 results reproducibility with the CompVis implementation. # However this currently doesn't work in `mps`. num_channels_latents = self.vae.config.latent_channels latents_shape = (batch_size * num_images_per_prompt, num_channels_latents, height // 8, width // 8) latents_dtype = text_embeddings.dtype if latents is None: if self.device.type == "mps": # randn does not exist on mps latents = torch.randn(latents_shape, generator=generator, device="cpu", dtype=latents_dtype).to( self.device ) else: latents = torch.randn(latents_shape, generator=generator, device=self.device, dtype=latents_dtype) else: if latents.shape != latents_shape: raise ValueError(f"Unexpected latents shape, got {latents.shape}, expected {latents_shape}") latents = latents.to(self.device) # overlay the inner image image = overlay_inner_image(image, inner_image) # prepare mask and masked_image mask, masked_image = prepare_mask_and_masked_image(image, mask_image) mask = mask.to(device=self.device, dtype=text_embeddings.dtype) masked_image = masked_image.to(device=self.device, dtype=text_embeddings.dtype) # resize the mask to latents shape as we concatenate the mask to the latents mask = torch.nn.functional.interpolate(mask, size=(height // 8, width // 8)) # encode the mask image into latents space so we can concatenate it to the latents masked_image_latents = self.vae.encode(masked_image).latent_dist.sample(generator=generator) masked_image_latents = 0.18215 * masked_image_latents # duplicate mask and masked_image_latents for each generation per prompt, using mps friendly method mask = mask.repeat(batch_size * num_images_per_prompt, 1, 1, 1) masked_image_latents = masked_image_latents.repeat(batch_size * num_images_per_prompt, 1, 1, 1) mask = torch.cat([mask] * 2) if do_classifier_free_guidance else mask masked_image_latents = ( torch.cat([masked_image_latents] * 2) if do_classifier_free_guidance else masked_image_latents ) num_channels_mask = mask.shape[1] num_channels_masked_image = masked_image_latents.shape[1] if num_channels_latents + num_channels_mask + num_channels_masked_image != self.unet.config.in_channels: raise ValueError( f"Incorrect configuration settings! The config of `pipeline.unet`: {self.unet.config} expects" f" {self.unet.config.in_channels} but received `num_channels_latents`: {num_channels_latents} +" f" `num_channels_mask`: {num_channels_mask} + `num_channels_masked_image`: {num_channels_masked_image}" f" = {num_channels_latents+num_channels_masked_image+num_channels_mask}. Please verify the config of" " `pipeline.unet` or your `mask_image` or `image` input." ) # set timesteps self.scheduler.set_timesteps(num_inference_steps) # Some schedulers like PNDM have timesteps as arrays # It's more optimized to move all timesteps to correct device beforehand timesteps_tensor = self.scheduler.timesteps.to(self.device) # scale the initial noise by the standard deviation required by the scheduler latents = latents * self.scheduler.init_noise_sigma # prepare extra kwargs for the scheduler step, since not all schedulers have the same signature # eta (η) is only used with the DDIMScheduler, it will be ignored for other schedulers. # eta corresponds to η in DDIM paper: https://arxiv.org/abs/2010.02502 # and should be between [0, 1] accepts_eta = "eta" in set(inspect.signature(self.scheduler.step).parameters.keys()) extra_step_kwargs = {} if accepts_eta: extra_step_kwargs["eta"] = eta for i, t in enumerate(self.progress_bar(timesteps_tensor)): # expand the latents if we are doing classifier free guidance latent_model_input = torch.cat([latents] * 2) if do_classifier_free_guidance else latents # concat latents, mask, masked_image_latents in the channel dimension latent_model_input = torch.cat([latent_model_input, mask, masked_image_latents], dim=1) latent_model_input = self.scheduler.scale_model_input(latent_model_input, t) # predict the noise residual noise_pred = self.unet(latent_model_input, t, encoder_hidden_states=text_embeddings).sample # perform guidance if do_classifier_free_guidance: noise_pred_uncond, noise_pred_text = noise_pred.chunk(2) noise_pred = noise_pred_uncond + guidance_scale * (noise_pred_text - noise_pred_uncond) # compute the previous noisy sample x_t -> x_t-1 latents = self.scheduler.step(noise_pred, t, latents, **extra_step_kwargs).prev_sample # call the callback, if provided if callback is not None and i % callback_steps == 0: step_idx = i // getattr(self.scheduler, "order", 1) callback(step_idx, t, latents) latents = 1 / 0.18215 * latents image = self.vae.decode(latents).sample image = (image / 2 + 0.5).clamp(0, 1) # we always cast to float32 as this does not cause significant overhead and is compatible with bfloat16 image = image.cpu().permute(0, 2, 3, 1).float().numpy() if self.safety_checker is not None: safety_checker_input = self.feature_extractor(self.numpy_to_pil(image), return_tensors="pt").to( self.device ) image, has_nsfw_concept = self.safety_checker( images=image, clip_input=safety_checker_input.pixel_values.to(text_embeddings.dtype) ) else: has_nsfw_concept = None if output_type == "pil": image = self.numpy_to_pil(image) if not return_dict: return (image, has_nsfw_concept) return StableDiffusionPipelineOutput(images=image, nsfw_content_detected=has_nsfw_concept)
diffusers/examples/community/img2img_inpainting.py/0
{ "file_path": "diffusers/examples/community/img2img_inpainting.py", "repo_id": "diffusers", "token_count": 9677 }
111
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import inspect from typing import Any, Callable, Dict, List, Optional, Union import intel_extension_for_pytorch as ipex import torch from packaging import version from transformers import CLIPFeatureExtractor, CLIPTextModel, CLIPTokenizer from diffusers.configuration_utils import FrozenDict from diffusers.loaders import LoraLoaderMixin, TextualInversionLoaderMixin from diffusers.models import AutoencoderKL, UNet2DConditionModel from diffusers.pipelines.pipeline_utils import DiffusionPipeline, StableDiffusionMixin from diffusers.pipelines.stable_diffusion import StableDiffusionPipelineOutput from diffusers.pipelines.stable_diffusion.safety_checker import StableDiffusionSafetyChecker from diffusers.schedulers import KarrasDiffusionSchedulers from diffusers.utils import ( deprecate, logging, replace_example_docstring, ) from diffusers.utils.torch_utils import randn_tensor logger = logging.get_logger(__name__) # pylint: disable=invalid-name EXAMPLE_DOC_STRING = """ Examples: ```py >>> import torch >>> from diffusers import StableDiffusionPipeline >>> pipe = DiffusionPipeline.from_pretrained("runwayml/stable-diffusion-v1-5", custom_pipeline="stable_diffusion_ipex") >>> # For Float32 >>> pipe.prepare_for_ipex(prompt, dtype=torch.float32, height=512, width=512) #value of image height/width should be consistent with the pipeline inference >>> # For BFloat16 >>> pipe.prepare_for_ipex(prompt, dtype=torch.bfloat16, height=512, width=512) #value of image height/width should be consistent with the pipeline inference >>> prompt = "a photo of an astronaut riding a horse on mars" >>> # For Float32 >>> image = pipe(prompt, num_inference_steps=num_inference_steps, height=512, width=512).images[0] #value of image height/width should be consistent with 'prepare_for_ipex()' >>> # For BFloat16 >>> with torch.cpu.amp.autocast(enabled=True, dtype=torch.bfloat16): >>> image = pipe(prompt, num_inference_steps=num_inference_steps, height=512, width=512).images[0] #value of image height/width should be consistent with 'prepare_for_ipex()' ``` """ class StableDiffusionIPEXPipeline( DiffusionPipeline, StableDiffusionMixin, TextualInversionLoaderMixin, LoraLoaderMixin ): r""" Pipeline for text-to-image generation using Stable Diffusion on IPEX. This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods the library implements for all the pipelines (such as downloading or saving, running on a particular device, etc.) Args: vae ([`AutoencoderKL`]): Variational Auto-Encoder (VAE) Model to encode and decode images to and from latent representations. text_encoder ([`CLIPTextModel`]): Frozen text-encoder. Stable Diffusion uses the text portion of [CLIP](https://huggingface.co/docs/transformers/model_doc/clip#transformers.CLIPTextModel), specifically the [clip-vit-large-patch14](https://huggingface.co/openai/clip-vit-large-patch14) variant. tokenizer (`CLIPTokenizer`): Tokenizer of class [CLIPTokenizer](https://huggingface.co/docs/transformers/v4.21.0/en/model_doc/clip#transformers.CLIPTokenizer). unet ([`UNet2DConditionModel`]): Conditional U-Net architecture to denoise the encoded image latents. scheduler ([`SchedulerMixin`]): A scheduler to be used in combination with `unet` to denoise the encoded image latents. Can be one of [`DDIMScheduler`], [`LMSDiscreteScheduler`], or [`PNDMScheduler`]. safety_checker ([`StableDiffusionSafetyChecker`]): Classification module that estimates whether generated images could be considered offensive or harmful. Please, refer to the [model card](https://huggingface.co/runwayml/stable-diffusion-v1-5) for details. feature_extractor ([`CLIPFeatureExtractor`]): Model that extracts features from generated images to be used as inputs for the `safety_checker`. """ _optional_components = ["safety_checker", "feature_extractor"] def __init__( self, vae: AutoencoderKL, text_encoder: CLIPTextModel, tokenizer: CLIPTokenizer, unet: UNet2DConditionModel, scheduler: KarrasDiffusionSchedulers, safety_checker: StableDiffusionSafetyChecker, feature_extractor: CLIPFeatureExtractor, requires_safety_checker: bool = True, ): super().__init__() if hasattr(scheduler.config, "steps_offset") and scheduler.config.steps_offset != 1: deprecation_message = ( f"The configuration file of this scheduler: {scheduler} is outdated. `steps_offset`" f" should be set to 1 instead of {scheduler.config.steps_offset}. Please make sure " "to update the config accordingly as leaving `steps_offset` might led to incorrect results" " in future versions. If you have downloaded this checkpoint from the Hugging Face Hub," " it would be very nice if you could open a Pull request for the `scheduler/scheduler_config.json`" " file" ) deprecate("steps_offset!=1", "1.0.0", deprecation_message, standard_warn=False) new_config = dict(scheduler.config) new_config["steps_offset"] = 1 scheduler._internal_dict = FrozenDict(new_config) if hasattr(scheduler.config, "clip_sample") and scheduler.config.clip_sample is True: deprecation_message = ( f"The configuration file of this scheduler: {scheduler} has not set the configuration `clip_sample`." " `clip_sample` should be set to False in the configuration file. Please make sure to update the" " config accordingly as not setting `clip_sample` in the config might lead to incorrect results in" " future versions. If you have downloaded this checkpoint from the Hugging Face Hub, it would be very" " nice if you could open a Pull request for the `scheduler/scheduler_config.json` file" ) deprecate("clip_sample not set", "1.0.0", deprecation_message, standard_warn=False) new_config = dict(scheduler.config) new_config["clip_sample"] = False scheduler._internal_dict = FrozenDict(new_config) if safety_checker is None and requires_safety_checker: logger.warning( f"You have disabled the safety checker for {self.__class__} by passing `safety_checker=None`. Ensure" " that you abide to the conditions of the Stable Diffusion license and do not expose unfiltered" " results in services or applications open to the public. Both the diffusers team and Hugging Face" " strongly recommend to keep the safety filter enabled in all public facing circumstances, disabling" " it only for use-cases that involve analyzing network behavior or auditing its results. For more" " information, please have a look at https://github.com/huggingface/diffusers/pull/254 ." ) if safety_checker is not None and feature_extractor is None: raise ValueError( "Make sure to define a feature extractor when loading {self.__class__} if you want to use the safety" " checker. If you do not want to use the safety checker, you can pass `'safety_checker=None'` instead." ) is_unet_version_less_0_9_0 = hasattr(unet.config, "_diffusers_version") and version.parse( version.parse(unet.config._diffusers_version).base_version ) < version.parse("0.9.0.dev0") is_unet_sample_size_less_64 = hasattr(unet.config, "sample_size") and unet.config.sample_size < 64 if is_unet_version_less_0_9_0 and is_unet_sample_size_less_64: deprecation_message = ( "The configuration file of the unet has set the default `sample_size` to smaller than" " 64 which seems highly unlikely. If your checkpoint is a fine-tuned version of any of the" " following: \n- CompVis/stable-diffusion-v1-4 \n- CompVis/stable-diffusion-v1-3 \n-" " CompVis/stable-diffusion-v1-2 \n- CompVis/stable-diffusion-v1-1 \n- runwayml/stable-diffusion-v1-5" " \n- runwayml/stable-diffusion-inpainting \n you should change 'sample_size' to 64 in the" " configuration file. Please make sure to update the config accordingly as leaving `sample_size=32`" " in the config might lead to incorrect results in future versions. If you have downloaded this" " checkpoint from the Hugging Face Hub, it would be very nice if you could open a Pull request for" " the `unet/config.json` file" ) deprecate("sample_size<64", "1.0.0", deprecation_message, standard_warn=False) new_config = dict(unet.config) new_config["sample_size"] = 64 unet._internal_dict = FrozenDict(new_config) self.register_modules( vae=vae, text_encoder=text_encoder, tokenizer=tokenizer, unet=unet, scheduler=scheduler, safety_checker=safety_checker, feature_extractor=feature_extractor, ) self.vae_scale_factor = 2 ** (len(self.vae.config.block_out_channels) - 1) self.register_to_config(requires_safety_checker=requires_safety_checker) def get_input_example(self, prompt, height=None, width=None, guidance_scale=7.5, num_images_per_prompt=1): prompt_embeds = None negative_prompt_embeds = None negative_prompt = None callback_steps = 1 generator = None latents = None # 0. Default height and width to unet height = height or self.unet.config.sample_size * self.vae_scale_factor width = width or self.unet.config.sample_size * self.vae_scale_factor # 1. Check inputs. Raise error if not correct self.check_inputs( prompt, height, width, callback_steps, negative_prompt, prompt_embeds, negative_prompt_embeds ) # 2. Define call parameters if prompt is not None and isinstance(prompt, str): batch_size = 1 elif prompt is not None and isinstance(prompt, list): batch_size = len(prompt) device = "cpu" # here `guidance_scale` is defined analog to the guidance weight `w` of equation (2) # of the Imagen paper: https://arxiv.org/pdf/2205.11487.pdf . `guidance_scale = 1` # corresponds to doing no classifier free guidance. do_classifier_free_guidance = guidance_scale > 1.0 # 3. Encode input prompt prompt_embeds = self._encode_prompt( prompt, device, num_images_per_prompt, do_classifier_free_guidance, negative_prompt, prompt_embeds=prompt_embeds, negative_prompt_embeds=negative_prompt_embeds, ) # 5. Prepare latent variables latents = self.prepare_latents( batch_size * num_images_per_prompt, self.unet.config.in_channels, height, width, prompt_embeds.dtype, device, generator, latents, ) dummy = torch.ones(1, dtype=torch.int32) latent_model_input = torch.cat([latents] * 2) if do_classifier_free_guidance else latents latent_model_input = self.scheduler.scale_model_input(latent_model_input, dummy) unet_input_example = (latent_model_input, dummy, prompt_embeds) vae_decoder_input_example = latents return unet_input_example, vae_decoder_input_example def prepare_for_ipex(self, promt, dtype=torch.float32, height=None, width=None, guidance_scale=7.5): self.unet = self.unet.to(memory_format=torch.channels_last) self.vae.decoder = self.vae.decoder.to(memory_format=torch.channels_last) self.text_encoder = self.text_encoder.to(memory_format=torch.channels_last) if self.safety_checker is not None: self.safety_checker = self.safety_checker.to(memory_format=torch.channels_last) unet_input_example, vae_decoder_input_example = self.get_input_example(promt, height, width, guidance_scale) # optimize with ipex if dtype == torch.bfloat16: self.unet = ipex.optimize(self.unet.eval(), dtype=torch.bfloat16, inplace=True) self.vae.decoder = ipex.optimize(self.vae.decoder.eval(), dtype=torch.bfloat16, inplace=True) self.text_encoder = ipex.optimize(self.text_encoder.eval(), dtype=torch.bfloat16, inplace=True) if self.safety_checker is not None: self.safety_checker = ipex.optimize(self.safety_checker.eval(), dtype=torch.bfloat16, inplace=True) elif dtype == torch.float32: self.unet = ipex.optimize( self.unet.eval(), dtype=torch.float32, inplace=True, weights_prepack=True, auto_kernel_selection=False, ) self.vae.decoder = ipex.optimize( self.vae.decoder.eval(), dtype=torch.float32, inplace=True, weights_prepack=True, auto_kernel_selection=False, ) self.text_encoder = ipex.optimize( self.text_encoder.eval(), dtype=torch.float32, inplace=True, weights_prepack=True, auto_kernel_selection=False, ) if self.safety_checker is not None: self.safety_checker = ipex.optimize( self.safety_checker.eval(), dtype=torch.float32, inplace=True, weights_prepack=True, auto_kernel_selection=False, ) else: raise ValueError(" The value of 'dtype' should be 'torch.bfloat16' or 'torch.float32' !") # trace unet model to get better performance on IPEX with torch.cpu.amp.autocast(enabled=dtype == torch.bfloat16), torch.no_grad(): unet_trace_model = torch.jit.trace(self.unet, unet_input_example, check_trace=False, strict=False) unet_trace_model = torch.jit.freeze(unet_trace_model) self.unet.forward = unet_trace_model.forward # trace vae.decoder model to get better performance on IPEX with torch.cpu.amp.autocast(enabled=dtype == torch.bfloat16), torch.no_grad(): ave_decoder_trace_model = torch.jit.trace( self.vae.decoder, vae_decoder_input_example, check_trace=False, strict=False ) ave_decoder_trace_model = torch.jit.freeze(ave_decoder_trace_model) self.vae.decoder.forward = ave_decoder_trace_model.forward def _encode_prompt( self, prompt, device, num_images_per_prompt, do_classifier_free_guidance, negative_prompt=None, prompt_embeds: Optional[torch.FloatTensor] = None, negative_prompt_embeds: Optional[torch.FloatTensor] = None, ): r""" Encodes the prompt into text encoder hidden states. Args: prompt (`str` or `List[str]`, *optional*): prompt to be encoded device: (`torch.device`): torch device num_images_per_prompt (`int`): number of images that should be generated per prompt do_classifier_free_guidance (`bool`): whether to use classifier free guidance or not negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. If not defined, one has to pass `negative_prompt_embeds`. instead. If not defined, one has to pass `negative_prompt_embeds`. instead. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, text embeddings will be generated from `prompt` input argument. negative_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, negative_prompt_embeds will be generated from `negative_prompt` input argument. """ if prompt is not None and isinstance(prompt, str): batch_size = 1 elif prompt is not None and isinstance(prompt, list): batch_size = len(prompt) else: batch_size = prompt_embeds.shape[0] if prompt_embeds is None: # textual inversion: process multi-vector tokens if necessary if isinstance(self, TextualInversionLoaderMixin): prompt = self.maybe_convert_prompt(prompt, self.tokenizer) text_inputs = self.tokenizer( prompt, padding="max_length", max_length=self.tokenizer.model_max_length, truncation=True, return_tensors="pt", ) text_input_ids = text_inputs.input_ids untruncated_ids = self.tokenizer(prompt, padding="longest", return_tensors="pt").input_ids if untruncated_ids.shape[-1] >= text_input_ids.shape[-1] and not torch.equal( text_input_ids, untruncated_ids ): removed_text = self.tokenizer.batch_decode( untruncated_ids[:, self.tokenizer.model_max_length - 1 : -1] ) logger.warning( "The following part of your input was truncated because CLIP can only handle sequences up to" f" {self.tokenizer.model_max_length} tokens: {removed_text}" ) if hasattr(self.text_encoder.config, "use_attention_mask") and self.text_encoder.config.use_attention_mask: attention_mask = text_inputs.attention_mask.to(device) else: attention_mask = None prompt_embeds = self.text_encoder( text_input_ids.to(device), attention_mask=attention_mask, ) prompt_embeds = prompt_embeds[0] prompt_embeds = prompt_embeds.to(dtype=self.text_encoder.dtype, device=device) bs_embed, seq_len, _ = prompt_embeds.shape # duplicate text embeddings for each generation per prompt, using mps friendly method prompt_embeds = prompt_embeds.repeat(1, num_images_per_prompt, 1) prompt_embeds = prompt_embeds.view(bs_embed * num_images_per_prompt, seq_len, -1) # get unconditional embeddings for classifier free guidance if do_classifier_free_guidance and negative_prompt_embeds is None: uncond_tokens: List[str] if negative_prompt is None: uncond_tokens = [""] * batch_size elif type(prompt) is not type(negative_prompt): raise TypeError( f"`negative_prompt` should be the same type to `prompt`, but got {type(negative_prompt)} !=" f" {type(prompt)}." ) elif isinstance(negative_prompt, str): uncond_tokens = [negative_prompt] elif batch_size != len(negative_prompt): raise ValueError( f"`negative_prompt`: {negative_prompt} has batch size {len(negative_prompt)}, but `prompt`:" f" {prompt} has batch size {batch_size}. Please make sure that passed `negative_prompt` matches" " the batch size of `prompt`." ) else: uncond_tokens = negative_prompt # textual inversion: process multi-vector tokens if necessary if isinstance(self, TextualInversionLoaderMixin): uncond_tokens = self.maybe_convert_prompt(uncond_tokens, self.tokenizer) max_length = prompt_embeds.shape[1] uncond_input = self.tokenizer( uncond_tokens, padding="max_length", max_length=max_length, truncation=True, return_tensors="pt", ) if hasattr(self.text_encoder.config, "use_attention_mask") and self.text_encoder.config.use_attention_mask: attention_mask = uncond_input.attention_mask.to(device) else: attention_mask = None negative_prompt_embeds = self.text_encoder( uncond_input.input_ids.to(device), attention_mask=attention_mask, ) negative_prompt_embeds = negative_prompt_embeds[0] if do_classifier_free_guidance: # duplicate unconditional embeddings for each generation per prompt, using mps friendly method seq_len = negative_prompt_embeds.shape[1] negative_prompt_embeds = negative_prompt_embeds.to(dtype=self.text_encoder.dtype, device=device) negative_prompt_embeds = negative_prompt_embeds.repeat(1, num_images_per_prompt, 1) negative_prompt_embeds = negative_prompt_embeds.view(batch_size * num_images_per_prompt, seq_len, -1) # For classifier free guidance, we need to do two forward passes. # Here we concatenate the unconditional and text embeddings into a single batch # to avoid doing two forward passes prompt_embeds = torch.cat([negative_prompt_embeds, prompt_embeds]) return prompt_embeds def run_safety_checker(self, image, device, dtype): if self.safety_checker is not None: safety_checker_input = self.feature_extractor(self.numpy_to_pil(image), return_tensors="pt").to(device) image, has_nsfw_concept = self.safety_checker( images=image, clip_input=safety_checker_input.pixel_values.to(dtype) ) else: has_nsfw_concept = None return image, has_nsfw_concept def decode_latents(self, latents): latents = 1 / self.vae.config.scaling_factor * latents image = self.vae.decode(latents).sample image = (image / 2 + 0.5).clamp(0, 1) # we always cast to float32 as this does not cause significant overhead and is compatible with bfloat16 image = image.cpu().permute(0, 2, 3, 1).float().numpy() return image def prepare_extra_step_kwargs(self, generator, eta): # prepare extra kwargs for the scheduler step, since not all schedulers have the same signature # eta (η) is only used with the DDIMScheduler, it will be ignored for other schedulers. # eta corresponds to η in DDIM paper: https://arxiv.org/abs/2010.02502 # and should be between [0, 1] accepts_eta = "eta" in set(inspect.signature(self.scheduler.step).parameters.keys()) extra_step_kwargs = {} if accepts_eta: extra_step_kwargs["eta"] = eta # check if the scheduler accepts generator accepts_generator = "generator" in set(inspect.signature(self.scheduler.step).parameters.keys()) if accepts_generator: extra_step_kwargs["generator"] = generator return extra_step_kwargs def check_inputs( self, prompt, height, width, callback_steps, negative_prompt=None, prompt_embeds=None, negative_prompt_embeds=None, ): if height % 8 != 0 or width % 8 != 0: raise ValueError(f"`height` and `width` have to be divisible by 8 but are {height} and {width}.") if (callback_steps is None) or ( callback_steps is not None and (not isinstance(callback_steps, int) or callback_steps <= 0) ): raise ValueError( f"`callback_steps` has to be a positive integer but is {callback_steps} of type" f" {type(callback_steps)}." ) if prompt is not None and prompt_embeds is not None: raise ValueError( f"Cannot forward both `prompt`: {prompt} and `prompt_embeds`: {prompt_embeds}. Please make sure to" " only forward one of the two." ) elif prompt is None and prompt_embeds is None: raise ValueError( "Provide either `prompt` or `prompt_embeds`. Cannot leave both `prompt` and `prompt_embeds` undefined." ) elif prompt is not None and (not isinstance(prompt, str) and not isinstance(prompt, list)): raise ValueError(f"`prompt` has to be of type `str` or `list` but is {type(prompt)}") if negative_prompt is not None and negative_prompt_embeds is not None: raise ValueError( f"Cannot forward both `negative_prompt`: {negative_prompt} and `negative_prompt_embeds`:" f" {negative_prompt_embeds}. Please make sure to only forward one of the two." ) if prompt_embeds is not None and negative_prompt_embeds is not None: if prompt_embeds.shape != negative_prompt_embeds.shape: raise ValueError( "`prompt_embeds` and `negative_prompt_embeds` must have the same shape when passed directly, but" f" got: `prompt_embeds` {prompt_embeds.shape} != `negative_prompt_embeds`" f" {negative_prompt_embeds.shape}." ) def prepare_latents(self, batch_size, num_channels_latents, height, width, dtype, device, generator, latents=None): shape = (batch_size, num_channels_latents, height // self.vae_scale_factor, width // self.vae_scale_factor) if isinstance(generator, list) and len(generator) != batch_size: raise ValueError( f"You have passed a list of generators of length {len(generator)}, but requested an effective batch" f" size of {batch_size}. Make sure the batch size matches the length of the generators." ) if latents is None: latents = randn_tensor(shape, generator=generator, device=device, dtype=dtype) else: latents = latents.to(device) # scale the initial noise by the standard deviation required by the scheduler latents = latents * self.scheduler.init_noise_sigma return latents @torch.no_grad() @replace_example_docstring(EXAMPLE_DOC_STRING) def __call__( self, prompt: Union[str, List[str]] = None, height: Optional[int] = None, width: Optional[int] = None, num_inference_steps: int = 50, guidance_scale: float = 7.5, negative_prompt: Optional[Union[str, List[str]]] = None, num_images_per_prompt: Optional[int] = 1, eta: float = 0.0, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, latents: Optional[torch.FloatTensor] = None, prompt_embeds: Optional[torch.FloatTensor] = None, negative_prompt_embeds: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", return_dict: bool = True, callback: Optional[Callable[[int, int, torch.FloatTensor], None]] = None, callback_steps: int = 1, cross_attention_kwargs: Optional[Dict[str, Any]] = None, ): r""" Function invoked when calling the pipeline for generation. Args: prompt (`str` or `List[str]`, *optional*): The prompt or prompts to guide the image generation. If not defined, one has to pass `prompt_embeds`. instead. height (`int`, *optional*, defaults to self.unet.config.sample_size * self.vae_scale_factor): The height in pixels of the generated image. width (`int`, *optional*, defaults to self.unet.config.sample_size * self.vae_scale_factor): The width in pixels of the generated image. num_inference_steps (`int`, *optional*, defaults to 50): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. guidance_scale (`float`, *optional*, defaults to 7.5): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. If not defined, one has to pass `negative_prompt_embeds`. instead. If not defined, one has to pass `negative_prompt_embeds`. instead. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. eta (`float`, *optional*, defaults to 0.0): Corresponds to parameter eta (η) in the DDIM paper: https://arxiv.org/abs/2010.02502. Only applies to [`schedulers.DDIMScheduler`], will be ignored for others. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): One or a list of [torch generator(s)](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. latents (`torch.FloatTensor`, *optional*): Pre-generated noisy latents, sampled from a Gaussian distribution, to be used as inputs for image generation. Can be used to tweak the same generation with different prompts. If not provided, a latents tensor will ge generated by sampling using the supplied random `generator`. prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, text embeddings will be generated from `prompt` input argument. negative_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, negative_prompt_embeds will be generated from `negative_prompt` input argument. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between [PIL](https://pillow.readthedocs.io/en/stable/): `PIL.Image.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] instead of a plain tuple. callback (`Callable`, *optional*): A function that will be called every `callback_steps` steps during inference. The function will be called with the following arguments: `callback(step: int, timestep: int, latents: torch.FloatTensor)`. callback_steps (`int`, *optional*, defaults to 1): The frequency at which the `callback` function will be called. If not specified, the callback will be called at every step. cross_attention_kwargs (`dict`, *optional*): A kwargs dictionary that if specified is passed along to the `AttnProcessor` as defined under `self.processor` in [diffusers.models.attention_processor](https://github.com/huggingface/diffusers/blob/main/src/diffusers/models/attention_processor.py). Examples: Returns: [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] or `tuple`: [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] if `return_dict` is True, otherwise a `tuple. When returning a tuple, the first element is a list with the generated images, and the second element is a list of `bool`s denoting whether the corresponding generated image likely represents "not-safe-for-work" (nsfw) content, according to the `safety_checker`. """ # 0. Default height and width to unet height = height or self.unet.config.sample_size * self.vae_scale_factor width = width or self.unet.config.sample_size * self.vae_scale_factor # 1. Check inputs. Raise error if not correct self.check_inputs( prompt, height, width, callback_steps, negative_prompt, prompt_embeds, negative_prompt_embeds ) # 2. Define call parameters if prompt is not None and isinstance(prompt, str): batch_size = 1 elif prompt is not None and isinstance(prompt, list): batch_size = len(prompt) else: batch_size = prompt_embeds.shape[0] device = self._execution_device # here `guidance_scale` is defined analog to the guidance weight `w` of equation (2) # of the Imagen paper: https://arxiv.org/pdf/2205.11487.pdf . `guidance_scale = 1` # corresponds to doing no classifier free guidance. do_classifier_free_guidance = guidance_scale > 1.0 # 3. Encode input prompt prompt_embeds = self._encode_prompt( prompt, device, num_images_per_prompt, do_classifier_free_guidance, negative_prompt, prompt_embeds=prompt_embeds, negative_prompt_embeds=negative_prompt_embeds, ) # 4. Prepare timesteps self.scheduler.set_timesteps(num_inference_steps, device=device) timesteps = self.scheduler.timesteps # 5. Prepare latent variables num_channels_latents = self.unet.config.in_channels latents = self.prepare_latents( batch_size * num_images_per_prompt, num_channels_latents, height, width, prompt_embeds.dtype, device, generator, latents, ) # 6. Prepare extra step kwargs. TODO: Logic should ideally just be moved out of the pipeline extra_step_kwargs = self.prepare_extra_step_kwargs(generator, eta) # 7. Denoising loop num_warmup_steps = len(timesteps) - num_inference_steps * self.scheduler.order with self.progress_bar(total=num_inference_steps) as progress_bar: for i, t in enumerate(timesteps): # expand the latents if we are doing classifier free guidance latent_model_input = torch.cat([latents] * 2) if do_classifier_free_guidance else latents latent_model_input = self.scheduler.scale_model_input(latent_model_input, t) # predict the noise residual noise_pred = self.unet(latent_model_input, t, encoder_hidden_states=prompt_embeds)["sample"] # perform guidance if do_classifier_free_guidance: noise_pred_uncond, noise_pred_text = noise_pred.chunk(2) noise_pred = noise_pred_uncond + guidance_scale * (noise_pred_text - noise_pred_uncond) # compute the previous noisy sample x_t -> x_t-1 latents = self.scheduler.step(noise_pred, t, latents, **extra_step_kwargs).prev_sample # call the callback, if provided if i == len(timesteps) - 1 or ((i + 1) > num_warmup_steps and (i + 1) % self.scheduler.order == 0): progress_bar.update() if callback is not None and i % callback_steps == 0: step_idx = i // getattr(self.scheduler, "order", 1) callback(step_idx, t, latents) if output_type == "latent": image = latents has_nsfw_concept = None elif output_type == "pil": # 8. Post-processing image = self.decode_latents(latents) # 9. Run safety checker image, has_nsfw_concept = self.run_safety_checker(image, device, prompt_embeds.dtype) # 10. Convert to PIL image = self.numpy_to_pil(image) else: # 8. Post-processing image = self.decode_latents(latents) # 9. Run safety checker image, has_nsfw_concept = self.run_safety_checker(image, device, prompt_embeds.dtype) # Offload last model to CPU if hasattr(self, "final_offload_hook") and self.final_offload_hook is not None: self.final_offload_hook.offload() if not return_dict: return (image, has_nsfw_concept) return StableDiffusionPipelineOutput(images=image, nsfw_content_detected=has_nsfw_concept)
diffusers/examples/community/stable_diffusion_ipex.py/0
{ "file_path": "diffusers/examples/community/stable_diffusion_ipex.py", "repo_id": "diffusers", "token_count": 16731 }
112
# Latent Consistency Distillation Example: [Latent Consistency Models (LCMs)](https://arxiv.org/abs/2310.04378) is a method to distill a latent diffusion model to enable swift inference with minimal steps. This example demonstrates how to use latent consistency distillation to distill SDXL for inference with few timesteps. ## Full model distillation ### Running locally with PyTorch #### Installing the dependencies Before running the scripts, make sure to install the library's training dependencies: **Important** To make sure you can successfully run the latest versions of the example scripts, we highly recommend **installing from source** and keeping the install up to date as we update the example scripts frequently and install some example-specific requirements. To do this, execute the following steps in a new virtual environment: ```bash git clone https://github.com/huggingface/diffusers cd diffusers pip install -e . ``` Then cd in the example folder and run ```bash pip install -r requirements.txt ``` And initialize an [🤗 Accelerate](https://github.com/huggingface/accelerate/) environment with: ```bash accelerate config ``` Or for a default accelerate configuration without answering questions about your environment ```bash accelerate config default ``` Or if your environment doesn't support an interactive shell e.g. a notebook ```python from accelerate.utils import write_basic_config write_basic_config() ``` When running `accelerate config`, if we specify torch compile mode to True there can be dramatic speedups. #### Example The following uses the [Conceptual Captions 12M (CC12M) dataset](https://github.com/google-research-datasets/conceptual-12m) as an example, and for illustrative purposes only. For best results you may consider large and high-quality text-image datasets such as [LAION](https://laion.ai/blog/laion-400-open-dataset/). You may also need to search the hyperparameter space according to the dataset you use. ```bash export MODEL_NAME="stabilityai/stable-diffusion-xl-base-1.0" export OUTPUT_DIR="path/to/saved/model" accelerate launch train_lcm_distill_sdxl_wds.py \ --pretrained_teacher_model=$MODEL_NAME \ --pretrained_vae_model_name_or_path=madebyollin/sdxl-vae-fp16-fix \ --output_dir=$OUTPUT_DIR \ --mixed_precision=fp16 \ --resolution=1024 \ --learning_rate=1e-6 --loss_type="huber" --use_fix_crop_and_size --ema_decay=0.95 --adam_weight_decay=0.0 \ --max_train_steps=1000 \ --max_train_samples=4000000 \ --dataloader_num_workers=8 \ --train_shards_path_or_url="pipe:curl -L -s https://huggingface.co/datasets/laion/conceptual-captions-12m-webdataset/resolve/main/data/{00000..01099}.tar?download=true" \ --validation_steps=200 \ --checkpointing_steps=200 --checkpoints_total_limit=10 \ --train_batch_size=12 \ --gradient_checkpointing --enable_xformers_memory_efficient_attention \ --gradient_accumulation_steps=1 \ --use_8bit_adam \ --resume_from_checkpoint=latest \ --report_to=wandb \ --seed=453645634 \ --push_to_hub \ ``` ## LCM-LoRA Instead of fine-tuning the full model, we can also just train a LoRA that can be injected into any SDXL model. ### Example The following uses the [Conceptual Captions 12M (CC12M) dataset](https://github.com/google-research-datasets/conceptual-12m) as an example. For best results you may consider large and high-quality text-image datasets such as [LAION](https://laion.ai/blog/laion-400-open-dataset/). ```bash export MODEL_NAME="stabilityai/stable-diffusion-xl-base-1.0" export OUTPUT_DIR="path/to/saved/model" accelerate launch train_lcm_distill_lora_sdxl_wds.py \ --pretrained_teacher_model=$MODEL_DIR \ --pretrained_vae_model_name_or_path=madebyollin/sdxl-vae-fp16-fix \ --output_dir=$OUTPUT_DIR \ --mixed_precision=fp16 \ --resolution=1024 \ --lora_rank=64 \ --learning_rate=1e-4 --loss_type="huber" --use_fix_crop_and_size --adam_weight_decay=0.0 \ --max_train_steps=1000 \ --max_train_samples=4000000 \ --dataloader_num_workers=8 \ --train_shards_path_or_url="pipe:curl -L -s https://huggingface.co/datasets/laion/conceptual-captions-12m-webdataset/resolve/main/data/{00000..01099}.tar?download=true" \ --validation_steps=200 \ --checkpointing_steps=200 --checkpoints_total_limit=10 \ --train_batch_size=12 \ --gradient_checkpointing --enable_xformers_memory_efficient_attention \ --gradient_accumulation_steps=1 \ --use_8bit_adam \ --resume_from_checkpoint=latest \ --report_to=wandb \ --seed=453645634 \ --push_to_hub \ ``` We provide another version for LCM LoRA SDXL that follows best practices of `peft` and leverages the `datasets` library for quick experimentation. The script doesn't load two UNets unlike `train_lcm_distill_lora_sdxl_wds.py` which reduces the memory requirements quite a bit. Below is an example training command that trains an LCM LoRA on the [Pokemons dataset](https://huggingface.co/datasets/lambdalabs/pokemon-blip-captions): ```bash export MODEL_NAME="stabilityai/stable-diffusion-xl-base-1.0" export DATASET_NAME="lambdalabs/pokemon-blip-captions" export VAE_PATH="madebyollin/sdxl-vae-fp16-fix" accelerate launch train_lcm_distill_lora_sdxl.py \ --pretrained_teacher_model=${MODEL_NAME} \ --pretrained_vae_model_name_or_path=${VAE_PATH} \ --output_dir="pokemons-lora-lcm-sdxl" \ --mixed_precision="fp16" \ --dataset_name=$DATASET_NAME \ --resolution=1024 \ --train_batch_size=24 \ --gradient_accumulation_steps=1 \ --gradient_checkpointing \ --use_8bit_adam \ --lora_rank=64 \ --learning_rate=1e-4 \ --report_to="wandb" \ --lr_scheduler="constant" \ --lr_warmup_steps=0 \ --max_train_steps=3000 \ --checkpointing_steps=500 \ --validation_steps=50 \ --seed="0" \ --report_to="wandb" \ --push_to_hub ```
diffusers/examples/consistency_distillation/README_sdxl.md/0
{ "file_path": "diffusers/examples/consistency_distillation/README_sdxl.md", "repo_id": "diffusers", "token_count": 2096 }
113
#!/usr/bin/env python # coding=utf-8 # Copyright 2024 The HuggingFace Inc. team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and import argparse import copy import gc import logging import math import os import shutil import warnings from pathlib import Path import numpy as np import torch import torch.nn.functional as F import torch.utils.checkpoint import transformers from accelerate import Accelerator from accelerate.logging import get_logger from accelerate.utils import ProjectConfiguration, set_seed from huggingface_hub import create_repo, upload_folder from huggingface_hub.utils import insecure_hashlib from packaging import version from peft import LoraConfig from peft.utils import get_peft_model_state_dict, set_peft_model_state_dict from PIL import Image from PIL.ImageOps import exif_transpose from torch.utils.data import Dataset from torchvision import transforms from tqdm.auto import tqdm from transformers import AutoTokenizer, PretrainedConfig import diffusers from diffusers import ( AutoencoderKL, DDPMScheduler, DiffusionPipeline, DPMSolverMultistepScheduler, StableDiffusionPipeline, UNet2DConditionModel, ) from diffusers.loaders import LoraLoaderMixin from diffusers.optimization import get_scheduler from diffusers.training_utils import _set_state_dict_into_text_encoder, cast_training_params from diffusers.utils import ( check_min_version, convert_state_dict_to_diffusers, convert_unet_state_dict_to_peft, is_wandb_available, ) from diffusers.utils.hub_utils import load_or_create_model_card, populate_model_card from diffusers.utils.import_utils import is_xformers_available from diffusers.utils.torch_utils import is_compiled_module if is_wandb_available(): import wandb # Will error if the minimal version of diffusers is not installed. Remove at your own risks. check_min_version("0.28.0.dev0") logger = get_logger(__name__) def save_model_card( repo_id: str, images=None, base_model=str, train_text_encoder=False, prompt=str, repo_folder=None, pipeline: DiffusionPipeline = None, ): img_str = "" for i, image in enumerate(images): image.save(os.path.join(repo_folder, f"image_{i}.png")) img_str += f"![img_{i}](./image_{i}.png)\n" model_description = f""" # LoRA DreamBooth - {repo_id} These are LoRA adaption weights for {base_model}. The weights were trained on {prompt} using [DreamBooth](https://dreambooth.github.io/). You can find some example images in the following. \n {img_str} LoRA for the text encoder was enabled: {train_text_encoder}. """ model_card = load_or_create_model_card( repo_id_or_path=repo_id, from_training=True, license="creativeml-openrail-m", base_model=base_model, prompt=prompt, model_description=model_description, inference=True, ) tags = ["text-to-image", "diffusers", "lora", "diffusers-training"] if isinstance(pipeline, StableDiffusionPipeline): tags.extend(["stable-diffusion", "stable-diffusion-diffusers"]) else: tags.extend(["if", "if-diffusers"]) model_card = populate_model_card(model_card, tags=tags) model_card.save(os.path.join(repo_folder, "README.md")) def log_validation( pipeline, args, accelerator, pipeline_args, epoch, is_final_validation=False, ): logger.info( f"Running validation... \n Generating {args.num_validation_images} images with prompt:" f" {args.validation_prompt}." ) # We train on the simplified learning objective. If we were previously predicting a variance, we need the scheduler to ignore it scheduler_args = {} if "variance_type" in pipeline.scheduler.config: variance_type = pipeline.scheduler.config.variance_type if variance_type in ["learned", "learned_range"]: variance_type = "fixed_small" scheduler_args["variance_type"] = variance_type pipeline.scheduler = DPMSolverMultistepScheduler.from_config(pipeline.scheduler.config, **scheduler_args) pipeline = pipeline.to(accelerator.device) pipeline.set_progress_bar_config(disable=True) # run inference generator = torch.Generator(device=accelerator.device).manual_seed(args.seed) if args.seed else None if args.validation_images is None: images = [] for _ in range(args.num_validation_images): with torch.cuda.amp.autocast(): image = pipeline(**pipeline_args, generator=generator).images[0] images.append(image) else: images = [] for image in args.validation_images: image = Image.open(image) with torch.cuda.amp.autocast(): image = pipeline(**pipeline_args, image=image, generator=generator).images[0] images.append(image) for tracker in accelerator.trackers: phase_name = "test" if is_final_validation else "validation" if tracker.name == "tensorboard": np_images = np.stack([np.asarray(img) for img in images]) tracker.writer.add_images(phase_name, np_images, epoch, dataformats="NHWC") if tracker.name == "wandb": tracker.log( { phase_name: [ wandb.Image(image, caption=f"{i}: {args.validation_prompt}") for i, image in enumerate(images) ] } ) del pipeline torch.cuda.empty_cache() return images def import_model_class_from_model_name_or_path(pretrained_model_name_or_path: str, revision: str): text_encoder_config = PretrainedConfig.from_pretrained( pretrained_model_name_or_path, subfolder="text_encoder", revision=revision, ) model_class = text_encoder_config.architectures[0] if model_class == "CLIPTextModel": from transformers import CLIPTextModel return CLIPTextModel elif model_class == "RobertaSeriesModelWithTransformation": from diffusers.pipelines.alt_diffusion.modeling_roberta_series import RobertaSeriesModelWithTransformation return RobertaSeriesModelWithTransformation elif model_class == "T5EncoderModel": from transformers import T5EncoderModel return T5EncoderModel else: raise ValueError(f"{model_class} is not supported.") def parse_args(input_args=None): parser = argparse.ArgumentParser(description="Simple example of a training script.") parser.add_argument( "--pretrained_model_name_or_path", type=str, default=None, required=True, help="Path to pretrained model or model identifier from huggingface.co/models.", ) parser.add_argument( "--revision", type=str, default=None, required=False, help="Revision of pretrained model identifier from huggingface.co/models.", ) parser.add_argument( "--variant", type=str, default=None, help="Variant of the model files of the pretrained model identifier from huggingface.co/models, 'e.g.' fp16", ) parser.add_argument( "--tokenizer_name", type=str, default=None, help="Pretrained tokenizer name or path if not the same as model_name", ) parser.add_argument( "--instance_data_dir", type=str, default=None, required=True, help="A folder containing the training data of instance images.", ) parser.add_argument( "--class_data_dir", type=str, default=None, required=False, help="A folder containing the training data of class images.", ) parser.add_argument( "--instance_prompt", type=str, default=None, required=True, help="The prompt with identifier specifying the instance", ) parser.add_argument( "--class_prompt", type=str, default=None, help="The prompt to specify images in the same class as provided instance images.", ) parser.add_argument( "--validation_prompt", type=str, default=None, help="A prompt that is used during validation to verify that the model is learning.", ) parser.add_argument( "--num_validation_images", type=int, default=4, help="Number of images that should be generated during validation with `validation_prompt`.", ) parser.add_argument( "--validation_epochs", type=int, default=50, help=( "Run dreambooth validation every X epochs. Dreambooth validation consists of running the prompt" " `args.validation_prompt` multiple times: `args.num_validation_images`." ), ) parser.add_argument( "--with_prior_preservation", default=False, action="store_true", help="Flag to add prior preservation loss.", ) parser.add_argument("--prior_loss_weight", type=float, default=1.0, help="The weight of prior preservation loss.") parser.add_argument( "--num_class_images", type=int, default=100, help=( "Minimal class images for prior preservation loss. If there are not enough images already present in" " class_data_dir, additional images will be sampled with class_prompt." ), ) parser.add_argument( "--output_dir", type=str, default="lora-dreambooth-model", help="The output directory where the model predictions and checkpoints will be written.", ) parser.add_argument("--seed", type=int, default=None, help="A seed for reproducible training.") parser.add_argument( "--resolution", type=int, default=512, help=( "The resolution for input images, all the images in the train/validation dataset will be resized to this" " resolution" ), ) parser.add_argument( "--center_crop", default=False, action="store_true", help=( "Whether to center crop the input images to the resolution. If not set, the images will be randomly" " cropped. The images will be resized to the resolution first before cropping." ), ) parser.add_argument( "--train_text_encoder", action="store_true", help="Whether to train the text encoder. If set, the text encoder should be float32 precision.", ) parser.add_argument( "--train_batch_size", type=int, default=4, help="Batch size (per device) for the training dataloader." ) parser.add_argument( "--sample_batch_size", type=int, default=4, help="Batch size (per device) for sampling images." ) parser.add_argument("--num_train_epochs", type=int, default=1) parser.add_argument( "--max_train_steps", type=int, default=None, help="Total number of training steps to perform. If provided, overrides num_train_epochs.", ) parser.add_argument( "--checkpointing_steps", type=int, default=500, help=( "Save a checkpoint of the training state every X updates. These checkpoints can be used both as final" " checkpoints in case they are better than the last checkpoint, and are also suitable for resuming" " training using `--resume_from_checkpoint`." ), ) parser.add_argument( "--checkpoints_total_limit", type=int, default=None, help=("Max number of checkpoints to store."), ) parser.add_argument( "--resume_from_checkpoint", type=str, default=None, help=( "Whether training should be resumed from a previous checkpoint. Use a path saved by" ' `--checkpointing_steps`, or `"latest"` to automatically select the last available checkpoint.' ), ) parser.add_argument( "--gradient_accumulation_steps", type=int, default=1, help="Number of updates steps to accumulate before performing a backward/update pass.", ) parser.add_argument( "--gradient_checkpointing", action="store_true", help="Whether or not to use gradient checkpointing to save memory at the expense of slower backward pass.", ) parser.add_argument( "--learning_rate", type=float, default=5e-4, help="Initial learning rate (after the potential warmup period) to use.", ) parser.add_argument( "--scale_lr", action="store_true", default=False, help="Scale the learning rate by the number of GPUs, gradient accumulation steps, and batch size.", ) parser.add_argument( "--lr_scheduler", type=str, default="constant", help=( 'The scheduler type to use. Choose between ["linear", "cosine", "cosine_with_restarts", "polynomial",' ' "constant", "constant_with_warmup"]' ), ) parser.add_argument( "--lr_warmup_steps", type=int, default=500, help="Number of steps for the warmup in the lr scheduler." ) parser.add_argument( "--lr_num_cycles", type=int, default=1, help="Number of hard resets of the lr in cosine_with_restarts scheduler.", ) parser.add_argument("--lr_power", type=float, default=1.0, help="Power factor of the polynomial scheduler.") parser.add_argument( "--dataloader_num_workers", type=int, default=0, help=( "Number of subprocesses to use for data loading. 0 means that the data will be loaded in the main process." ), ) parser.add_argument( "--use_8bit_adam", action="store_true", help="Whether or not to use 8-bit Adam from bitsandbytes." ) parser.add_argument("--adam_beta1", type=float, default=0.9, help="The beta1 parameter for the Adam optimizer.") parser.add_argument("--adam_beta2", type=float, default=0.999, help="The beta2 parameter for the Adam optimizer.") parser.add_argument("--adam_weight_decay", type=float, default=1e-2, help="Weight decay to use.") parser.add_argument("--adam_epsilon", type=float, default=1e-08, help="Epsilon value for the Adam optimizer") parser.add_argument("--max_grad_norm", default=1.0, type=float, help="Max gradient norm.") parser.add_argument("--push_to_hub", action="store_true", help="Whether or not to push the model to the Hub.") parser.add_argument("--hub_token", type=str, default=None, help="The token to use to push to the Model Hub.") parser.add_argument( "--hub_model_id", type=str, default=None, help="The name of the repository to keep in sync with the local `output_dir`.", ) parser.add_argument( "--logging_dir", type=str, default="logs", help=( "[TensorBoard](https://www.tensorflow.org/tensorboard) log directory. Will default to" " *output_dir/runs/**CURRENT_DATETIME_HOSTNAME***." ), ) parser.add_argument( "--allow_tf32", action="store_true", help=( "Whether or not to allow TF32 on Ampere GPUs. Can be used to speed up training. For more information, see" " https://pytorch.org/docs/stable/notes/cuda.html#tensorfloat-32-tf32-on-ampere-devices" ), ) parser.add_argument( "--report_to", type=str, default="tensorboard", help=( 'The integration to report the results and logs to. Supported platforms are `"tensorboard"`' ' (default), `"wandb"` and `"comet_ml"`. Use `"all"` to report to all integrations.' ), ) parser.add_argument( "--mixed_precision", type=str, default=None, choices=["no", "fp16", "bf16"], help=( "Whether to use mixed precision. Choose between fp16 and bf16 (bfloat16). Bf16 requires PyTorch >=" " 1.10.and an Nvidia Ampere GPU. Default to the value of accelerate config of the current system or the" " flag passed with the `accelerate.launch` command. Use this argument to override the accelerate config." ), ) parser.add_argument( "--prior_generation_precision", type=str, default=None, choices=["no", "fp32", "fp16", "bf16"], help=( "Choose prior generation precision between fp32, fp16 and bf16 (bfloat16). Bf16 requires PyTorch >=" " 1.10.and an Nvidia Ampere GPU. Default to fp16 if a GPU is available else fp32." ), ) parser.add_argument("--local_rank", type=int, default=-1, help="For distributed training: local_rank") parser.add_argument( "--enable_xformers_memory_efficient_attention", action="store_true", help="Whether or not to use xformers." ) parser.add_argument( "--pre_compute_text_embeddings", action="store_true", help="Whether or not to pre-compute text embeddings. If text embeddings are pre-computed, the text encoder will not be kept in memory during training and will leave more GPU memory available for training the rest of the model. This is not compatible with `--train_text_encoder`.", ) parser.add_argument( "--tokenizer_max_length", type=int, default=None, required=False, help="The maximum length of the tokenizer. If not set, will default to the tokenizer's max length.", ) parser.add_argument( "--text_encoder_use_attention_mask", action="store_true", required=False, help="Whether to use attention mask for the text encoder", ) parser.add_argument( "--validation_images", required=False, default=None, nargs="+", help="Optional set of images to use for validation. Used when the target pipeline takes an initial image as input such as when training image variation or superresolution.", ) parser.add_argument( "--class_labels_conditioning", required=False, default=None, help="The optional `class_label` conditioning to pass to the unet, available values are `timesteps`.", ) parser.add_argument( "--rank", type=int, default=4, help=("The dimension of the LoRA update matrices."), ) if input_args is not None: args = parser.parse_args(input_args) else: args = parser.parse_args() env_local_rank = int(os.environ.get("LOCAL_RANK", -1)) if env_local_rank != -1 and env_local_rank != args.local_rank: args.local_rank = env_local_rank if args.with_prior_preservation: if args.class_data_dir is None: raise ValueError("You must specify a data directory for class images.") if args.class_prompt is None: raise ValueError("You must specify prompt for class images.") else: # logger is not available yet if args.class_data_dir is not None: warnings.warn("You need not use --class_data_dir without --with_prior_preservation.") if args.class_prompt is not None: warnings.warn("You need not use --class_prompt without --with_prior_preservation.") if args.train_text_encoder and args.pre_compute_text_embeddings: raise ValueError("`--train_text_encoder` cannot be used with `--pre_compute_text_embeddings`") return args class DreamBoothDataset(Dataset): """ A dataset to prepare the instance and class images with the prompts for fine-tuning the model. It pre-processes the images and the tokenizes prompts. """ def __init__( self, instance_data_root, instance_prompt, tokenizer, class_data_root=None, class_prompt=None, class_num=None, size=512, center_crop=False, encoder_hidden_states=None, class_prompt_encoder_hidden_states=None, tokenizer_max_length=None, ): self.size = size self.center_crop = center_crop self.tokenizer = tokenizer self.encoder_hidden_states = encoder_hidden_states self.class_prompt_encoder_hidden_states = class_prompt_encoder_hidden_states self.tokenizer_max_length = tokenizer_max_length self.instance_data_root = Path(instance_data_root) if not self.instance_data_root.exists(): raise ValueError("Instance images root doesn't exists.") self.instance_images_path = list(Path(instance_data_root).iterdir()) self.num_instance_images = len(self.instance_images_path) self.instance_prompt = instance_prompt self._length = self.num_instance_images if class_data_root is not None: self.class_data_root = Path(class_data_root) self.class_data_root.mkdir(parents=True, exist_ok=True) self.class_images_path = list(self.class_data_root.iterdir()) if class_num is not None: self.num_class_images = min(len(self.class_images_path), class_num) else: self.num_class_images = len(self.class_images_path) self._length = max(self.num_class_images, self.num_instance_images) self.class_prompt = class_prompt else: self.class_data_root = None self.image_transforms = transforms.Compose( [ transforms.Resize(size, interpolation=transforms.InterpolationMode.BILINEAR), transforms.CenterCrop(size) if center_crop else transforms.RandomCrop(size), transforms.ToTensor(), transforms.Normalize([0.5], [0.5]), ] ) def __len__(self): return self._length def __getitem__(self, index): example = {} instance_image = Image.open(self.instance_images_path[index % self.num_instance_images]) instance_image = exif_transpose(instance_image) if not instance_image.mode == "RGB": instance_image = instance_image.convert("RGB") example["instance_images"] = self.image_transforms(instance_image) if self.encoder_hidden_states is not None: example["instance_prompt_ids"] = self.encoder_hidden_states else: text_inputs = tokenize_prompt( self.tokenizer, self.instance_prompt, tokenizer_max_length=self.tokenizer_max_length ) example["instance_prompt_ids"] = text_inputs.input_ids example["instance_attention_mask"] = text_inputs.attention_mask if self.class_data_root: class_image = Image.open(self.class_images_path[index % self.num_class_images]) class_image = exif_transpose(class_image) if not class_image.mode == "RGB": class_image = class_image.convert("RGB") example["class_images"] = self.image_transforms(class_image) if self.class_prompt_encoder_hidden_states is not None: example["class_prompt_ids"] = self.class_prompt_encoder_hidden_states else: class_text_inputs = tokenize_prompt( self.tokenizer, self.class_prompt, tokenizer_max_length=self.tokenizer_max_length ) example["class_prompt_ids"] = class_text_inputs.input_ids example["class_attention_mask"] = class_text_inputs.attention_mask return example def collate_fn(examples, with_prior_preservation=False): has_attention_mask = "instance_attention_mask" in examples[0] input_ids = [example["instance_prompt_ids"] for example in examples] pixel_values = [example["instance_images"] for example in examples] if has_attention_mask: attention_mask = [example["instance_attention_mask"] for example in examples] # Concat class and instance examples for prior preservation. # We do this to avoid doing two forward passes. if with_prior_preservation: input_ids += [example["class_prompt_ids"] for example in examples] pixel_values += [example["class_images"] for example in examples] if has_attention_mask: attention_mask += [example["class_attention_mask"] for example in examples] pixel_values = torch.stack(pixel_values) pixel_values = pixel_values.to(memory_format=torch.contiguous_format).float() input_ids = torch.cat(input_ids, dim=0) batch = { "input_ids": input_ids, "pixel_values": pixel_values, } if has_attention_mask: batch["attention_mask"] = attention_mask return batch class PromptDataset(Dataset): "A simple dataset to prepare the prompts to generate class images on multiple GPUs." def __init__(self, prompt, num_samples): self.prompt = prompt self.num_samples = num_samples def __len__(self): return self.num_samples def __getitem__(self, index): example = {} example["prompt"] = self.prompt example["index"] = index return example def tokenize_prompt(tokenizer, prompt, tokenizer_max_length=None): if tokenizer_max_length is not None: max_length = tokenizer_max_length else: max_length = tokenizer.model_max_length text_inputs = tokenizer( prompt, truncation=True, padding="max_length", max_length=max_length, return_tensors="pt", ) return text_inputs def encode_prompt(text_encoder, input_ids, attention_mask, text_encoder_use_attention_mask=None): text_input_ids = input_ids.to(text_encoder.device) if text_encoder_use_attention_mask: attention_mask = attention_mask.to(text_encoder.device) else: attention_mask = None prompt_embeds = text_encoder( text_input_ids, attention_mask=attention_mask, return_dict=False, ) prompt_embeds = prompt_embeds[0] return prompt_embeds def main(args): if args.report_to == "wandb" and args.hub_token is not None: raise ValueError( "You cannot use both --report_to=wandb and --hub_token due to a security risk of exposing your token." " Please use `huggingface-cli login` to authenticate with the Hub." ) logging_dir = Path(args.output_dir, args.logging_dir) accelerator_project_config = ProjectConfiguration(project_dir=args.output_dir, logging_dir=logging_dir) accelerator = Accelerator( gradient_accumulation_steps=args.gradient_accumulation_steps, mixed_precision=args.mixed_precision, log_with=args.report_to, project_config=accelerator_project_config, ) # Disable AMP for MPS. if torch.backends.mps.is_available(): accelerator.native_amp = False if args.report_to == "wandb": if not is_wandb_available(): raise ImportError("Make sure to install wandb if you want to use it for logging during training.") # Currently, it's not possible to do gradient accumulation when training two models with accelerate.accumulate # This will be enabled soon in accelerate. For now, we don't allow gradient accumulation when training two models. # TODO (sayakpaul): Remove this check when gradient accumulation with two models is enabled in accelerate. if args.train_text_encoder and args.gradient_accumulation_steps > 1 and accelerator.num_processes > 1: raise ValueError( "Gradient accumulation is not supported when training the text encoder in distributed training. " "Please set gradient_accumulation_steps to 1. This feature will be supported in the future." ) # Make one log on every process with the configuration for debugging. logging.basicConfig( format="%(asctime)s - %(levelname)s - %(name)s - %(message)s", datefmt="%m/%d/%Y %H:%M:%S", level=logging.INFO, ) logger.info(accelerator.state, main_process_only=False) if accelerator.is_local_main_process: transformers.utils.logging.set_verbosity_warning() diffusers.utils.logging.set_verbosity_info() else: transformers.utils.logging.set_verbosity_error() diffusers.utils.logging.set_verbosity_error() # If passed along, set the training seed now. if args.seed is not None: set_seed(args.seed) # Generate class images if prior preservation is enabled. if args.with_prior_preservation: class_images_dir = Path(args.class_data_dir) if not class_images_dir.exists(): class_images_dir.mkdir(parents=True) cur_class_images = len(list(class_images_dir.iterdir())) if cur_class_images < args.num_class_images: torch_dtype = torch.float16 if accelerator.device.type == "cuda" else torch.float32 if args.prior_generation_precision == "fp32": torch_dtype = torch.float32 elif args.prior_generation_precision == "fp16": torch_dtype = torch.float16 elif args.prior_generation_precision == "bf16": torch_dtype = torch.bfloat16 pipeline = DiffusionPipeline.from_pretrained( args.pretrained_model_name_or_path, torch_dtype=torch_dtype, safety_checker=None, revision=args.revision, variant=args.variant, ) pipeline.set_progress_bar_config(disable=True) num_new_images = args.num_class_images - cur_class_images logger.info(f"Number of class images to sample: {num_new_images}.") sample_dataset = PromptDataset(args.class_prompt, num_new_images) sample_dataloader = torch.utils.data.DataLoader(sample_dataset, batch_size=args.sample_batch_size) sample_dataloader = accelerator.prepare(sample_dataloader) pipeline.to(accelerator.device) for example in tqdm( sample_dataloader, desc="Generating class images", disable=not accelerator.is_local_main_process ): images = pipeline(example["prompt"]).images for i, image in enumerate(images): hash_image = insecure_hashlib.sha1(image.tobytes()).hexdigest() image_filename = class_images_dir / f"{example['index'][i] + cur_class_images}-{hash_image}.jpg" image.save(image_filename) del pipeline if torch.cuda.is_available(): torch.cuda.empty_cache() # Handle the repository creation if accelerator.is_main_process: if args.output_dir is not None: os.makedirs(args.output_dir, exist_ok=True) if args.push_to_hub: repo_id = create_repo( repo_id=args.hub_model_id or Path(args.output_dir).name, exist_ok=True, token=args.hub_token ).repo_id # Load the tokenizer if args.tokenizer_name: tokenizer = AutoTokenizer.from_pretrained(args.tokenizer_name, revision=args.revision, use_fast=False) elif args.pretrained_model_name_or_path: tokenizer = AutoTokenizer.from_pretrained( args.pretrained_model_name_or_path, subfolder="tokenizer", revision=args.revision, use_fast=False, ) # import correct text encoder class text_encoder_cls = import_model_class_from_model_name_or_path(args.pretrained_model_name_or_path, args.revision) # Load scheduler and models noise_scheduler = DDPMScheduler.from_pretrained(args.pretrained_model_name_or_path, subfolder="scheduler") text_encoder = text_encoder_cls.from_pretrained( args.pretrained_model_name_or_path, subfolder="text_encoder", revision=args.revision, variant=args.variant ) try: vae = AutoencoderKL.from_pretrained( args.pretrained_model_name_or_path, subfolder="vae", revision=args.revision, variant=args.variant ) except OSError: # IF does not have a VAE so let's just set it to None # We don't have to error out here vae = None unet = UNet2DConditionModel.from_pretrained( args.pretrained_model_name_or_path, subfolder="unet", revision=args.revision, variant=args.variant ) # We only train the additional adapter LoRA layers if vae is not None: vae.requires_grad_(False) text_encoder.requires_grad_(False) unet.requires_grad_(False) # For mixed precision training we cast all non-trainable weights (vae, non-lora text_encoder and non-lora unet) to half-precision # as these weights are only used for inference, keeping weights in full precision is not required. weight_dtype = torch.float32 if accelerator.mixed_precision == "fp16": weight_dtype = torch.float16 elif accelerator.mixed_precision == "bf16": weight_dtype = torch.bfloat16 # Move unet, vae and text_encoder to device and cast to weight_dtype unet.to(accelerator.device, dtype=weight_dtype) if vae is not None: vae.to(accelerator.device, dtype=weight_dtype) text_encoder.to(accelerator.device, dtype=weight_dtype) if args.enable_xformers_memory_efficient_attention: if is_xformers_available(): import xformers xformers_version = version.parse(xformers.__version__) if xformers_version == version.parse("0.0.16"): logger.warning( "xFormers 0.0.16 cannot be used for training in some GPUs. If you observe problems during training, please update xFormers to at least 0.0.17. See https://huggingface.co/docs/diffusers/main/en/optimization/xformers for more details." ) unet.enable_xformers_memory_efficient_attention() else: raise ValueError("xformers is not available. Make sure it is installed correctly") if args.gradient_checkpointing: unet.enable_gradient_checkpointing() if args.train_text_encoder: text_encoder.gradient_checkpointing_enable() # now we will add new LoRA weights to the attention layers unet_lora_config = LoraConfig( r=args.rank, lora_alpha=args.rank, init_lora_weights="gaussian", target_modules=["to_k", "to_q", "to_v", "to_out.0", "add_k_proj", "add_v_proj"], ) unet.add_adapter(unet_lora_config) # The text encoder comes from 🤗 transformers, we will also attach adapters to it. if args.train_text_encoder: text_lora_config = LoraConfig( r=args.rank, lora_alpha=args.rank, init_lora_weights="gaussian", target_modules=["q_proj", "k_proj", "v_proj", "out_proj"], ) text_encoder.add_adapter(text_lora_config) def unwrap_model(model): model = accelerator.unwrap_model(model) model = model._orig_mod if is_compiled_module(model) else model return model # create custom saving & loading hooks so that `accelerator.save_state(...)` serializes in a nice format def save_model_hook(models, weights, output_dir): if accelerator.is_main_process: # there are only two options here. Either are just the unet attn processor layers # or there are the unet and text encoder atten layers unet_lora_layers_to_save = None text_encoder_lora_layers_to_save = None for model in models: if isinstance(model, type(unwrap_model(unet))): unet_lora_layers_to_save = convert_state_dict_to_diffusers(get_peft_model_state_dict(model)) elif isinstance(model, type(unwrap_model(text_encoder))): text_encoder_lora_layers_to_save = convert_state_dict_to_diffusers( get_peft_model_state_dict(model) ) else: raise ValueError(f"unexpected save model: {model.__class__}") # make sure to pop weight so that corresponding model is not saved again weights.pop() LoraLoaderMixin.save_lora_weights( output_dir, unet_lora_layers=unet_lora_layers_to_save, text_encoder_lora_layers=text_encoder_lora_layers_to_save, ) def load_model_hook(models, input_dir): unet_ = None text_encoder_ = None while len(models) > 0: model = models.pop() if isinstance(model, type(unwrap_model(unet))): unet_ = model elif isinstance(model, type(unwrap_model(text_encoder))): text_encoder_ = model else: raise ValueError(f"unexpected save model: {model.__class__}") lora_state_dict, network_alphas = LoraLoaderMixin.lora_state_dict(input_dir) unet_state_dict = {f'{k.replace("unet.", "")}': v for k, v in lora_state_dict.items() if k.startswith("unet.")} unet_state_dict = convert_unet_state_dict_to_peft(unet_state_dict) incompatible_keys = set_peft_model_state_dict(unet_, unet_state_dict, adapter_name="default") if incompatible_keys is not None: # check only for unexpected keys unexpected_keys = getattr(incompatible_keys, "unexpected_keys", None) if unexpected_keys: logger.warning( f"Loading adapter weights from state_dict led to unexpected keys not found in the model: " f" {unexpected_keys}. " ) if args.train_text_encoder: _set_state_dict_into_text_encoder(lora_state_dict, prefix="text_encoder.", text_encoder=text_encoder_) # Make sure the trainable params are in float32. This is again needed since the base models # are in `weight_dtype`. More details: # https://github.com/huggingface/diffusers/pull/6514#discussion_r1449796804 if args.mixed_precision == "fp16": models = [unet_] if args.train_text_encoder: models.append(text_encoder_) # only upcast trainable parameters (LoRA) into fp32 cast_training_params(models, dtype=torch.float32) accelerator.register_save_state_pre_hook(save_model_hook) accelerator.register_load_state_pre_hook(load_model_hook) # Enable TF32 for faster training on Ampere GPUs, # cf https://pytorch.org/docs/stable/notes/cuda.html#tensorfloat-32-tf32-on-ampere-devices if args.allow_tf32: torch.backends.cuda.matmul.allow_tf32 = True if args.scale_lr: args.learning_rate = ( args.learning_rate * args.gradient_accumulation_steps * args.train_batch_size * accelerator.num_processes ) # Make sure the trainable params are in float32. if args.mixed_precision == "fp16": models = [unet] if args.train_text_encoder: models.append(text_encoder) # only upcast trainable parameters (LoRA) into fp32 cast_training_params(models, dtype=torch.float32) # Use 8-bit Adam for lower memory usage or to fine-tune the model in 16GB GPUs if args.use_8bit_adam: try: import bitsandbytes as bnb except ImportError: raise ImportError( "To use 8-bit Adam, please install the bitsandbytes library: `pip install bitsandbytes`." ) optimizer_class = bnb.optim.AdamW8bit else: optimizer_class = torch.optim.AdamW # Optimizer creation params_to_optimize = list(filter(lambda p: p.requires_grad, unet.parameters())) if args.train_text_encoder: params_to_optimize = params_to_optimize + list(filter(lambda p: p.requires_grad, text_encoder.parameters())) optimizer = optimizer_class( params_to_optimize, lr=args.learning_rate, betas=(args.adam_beta1, args.adam_beta2), weight_decay=args.adam_weight_decay, eps=args.adam_epsilon, ) if args.pre_compute_text_embeddings: def compute_text_embeddings(prompt): with torch.no_grad(): text_inputs = tokenize_prompt(tokenizer, prompt, tokenizer_max_length=args.tokenizer_max_length) prompt_embeds = encode_prompt( text_encoder, text_inputs.input_ids, text_inputs.attention_mask, text_encoder_use_attention_mask=args.text_encoder_use_attention_mask, ) return prompt_embeds pre_computed_encoder_hidden_states = compute_text_embeddings(args.instance_prompt) validation_prompt_negative_prompt_embeds = compute_text_embeddings("") if args.validation_prompt is not None: validation_prompt_encoder_hidden_states = compute_text_embeddings(args.validation_prompt) else: validation_prompt_encoder_hidden_states = None if args.class_prompt is not None: pre_computed_class_prompt_encoder_hidden_states = compute_text_embeddings(args.class_prompt) else: pre_computed_class_prompt_encoder_hidden_states = None text_encoder = None tokenizer = None gc.collect() torch.cuda.empty_cache() else: pre_computed_encoder_hidden_states = None validation_prompt_encoder_hidden_states = None validation_prompt_negative_prompt_embeds = None pre_computed_class_prompt_encoder_hidden_states = None # Dataset and DataLoaders creation: train_dataset = DreamBoothDataset( instance_data_root=args.instance_data_dir, instance_prompt=args.instance_prompt, class_data_root=args.class_data_dir if args.with_prior_preservation else None, class_prompt=args.class_prompt, class_num=args.num_class_images, tokenizer=tokenizer, size=args.resolution, center_crop=args.center_crop, encoder_hidden_states=pre_computed_encoder_hidden_states, class_prompt_encoder_hidden_states=pre_computed_class_prompt_encoder_hidden_states, tokenizer_max_length=args.tokenizer_max_length, ) train_dataloader = torch.utils.data.DataLoader( train_dataset, batch_size=args.train_batch_size, shuffle=True, collate_fn=lambda examples: collate_fn(examples, args.with_prior_preservation), num_workers=args.dataloader_num_workers, ) # Scheduler and math around the number of training steps. overrode_max_train_steps = False num_update_steps_per_epoch = math.ceil(len(train_dataloader) / args.gradient_accumulation_steps) if args.max_train_steps is None: args.max_train_steps = args.num_train_epochs * num_update_steps_per_epoch overrode_max_train_steps = True lr_scheduler = get_scheduler( args.lr_scheduler, optimizer=optimizer, num_warmup_steps=args.lr_warmup_steps * accelerator.num_processes, num_training_steps=args.max_train_steps * accelerator.num_processes, num_cycles=args.lr_num_cycles, power=args.lr_power, ) # Prepare everything with our `accelerator`. if args.train_text_encoder: unet, text_encoder, optimizer, train_dataloader, lr_scheduler = accelerator.prepare( unet, text_encoder, optimizer, train_dataloader, lr_scheduler ) else: unet, optimizer, train_dataloader, lr_scheduler = accelerator.prepare( unet, optimizer, train_dataloader, lr_scheduler ) # We need to recalculate our total training steps as the size of the training dataloader may have changed. num_update_steps_per_epoch = math.ceil(len(train_dataloader) / args.gradient_accumulation_steps) if overrode_max_train_steps: args.max_train_steps = args.num_train_epochs * num_update_steps_per_epoch # Afterwards we recalculate our number of training epochs args.num_train_epochs = math.ceil(args.max_train_steps / num_update_steps_per_epoch) # We need to initialize the trackers we use, and also store our configuration. # The trackers initializes automatically on the main process. if accelerator.is_main_process: tracker_config = vars(copy.deepcopy(args)) tracker_config.pop("validation_images") accelerator.init_trackers("dreambooth-lora", config=tracker_config) # Train! total_batch_size = args.train_batch_size * accelerator.num_processes * args.gradient_accumulation_steps logger.info("***** Running training *****") logger.info(f" Num examples = {len(train_dataset)}") logger.info(f" Num batches each epoch = {len(train_dataloader)}") logger.info(f" Num Epochs = {args.num_train_epochs}") logger.info(f" Instantaneous batch size per device = {args.train_batch_size}") logger.info(f" Total train batch size (w. parallel, distributed & accumulation) = {total_batch_size}") logger.info(f" Gradient Accumulation steps = {args.gradient_accumulation_steps}") logger.info(f" Total optimization steps = {args.max_train_steps}") global_step = 0 first_epoch = 0 # Potentially load in the weights and states from a previous save if args.resume_from_checkpoint: if args.resume_from_checkpoint != "latest": path = os.path.basename(args.resume_from_checkpoint) else: # Get the mos recent checkpoint dirs = os.listdir(args.output_dir) dirs = [d for d in dirs if d.startswith("checkpoint")] dirs = sorted(dirs, key=lambda x: int(x.split("-")[1])) path = dirs[-1] if len(dirs) > 0 else None if path is None: accelerator.print( f"Checkpoint '{args.resume_from_checkpoint}' does not exist. Starting a new training run." ) args.resume_from_checkpoint = None initial_global_step = 0 else: accelerator.print(f"Resuming from checkpoint {path}") accelerator.load_state(os.path.join(args.output_dir, path)) global_step = int(path.split("-")[1]) initial_global_step = global_step first_epoch = global_step // num_update_steps_per_epoch else: initial_global_step = 0 progress_bar = tqdm( range(0, args.max_train_steps), initial=initial_global_step, desc="Steps", # Only show the progress bar once on each machine. disable=not accelerator.is_local_main_process, ) for epoch in range(first_epoch, args.num_train_epochs): unet.train() if args.train_text_encoder: text_encoder.train() for step, batch in enumerate(train_dataloader): with accelerator.accumulate(unet): pixel_values = batch["pixel_values"].to(dtype=weight_dtype) if vae is not None: # Convert images to latent space model_input = vae.encode(pixel_values).latent_dist.sample() model_input = model_input * vae.config.scaling_factor else: model_input = pixel_values # Sample noise that we'll add to the latents noise = torch.randn_like(model_input) bsz, channels, height, width = model_input.shape # Sample a random timestep for each image timesteps = torch.randint( 0, noise_scheduler.config.num_train_timesteps, (bsz,), device=model_input.device ) timesteps = timesteps.long() # Add noise to the model input according to the noise magnitude at each timestep # (this is the forward diffusion process) noisy_model_input = noise_scheduler.add_noise(model_input, noise, timesteps) # Get the text embedding for conditioning if args.pre_compute_text_embeddings: encoder_hidden_states = batch["input_ids"] else: encoder_hidden_states = encode_prompt( text_encoder, batch["input_ids"], batch["attention_mask"], text_encoder_use_attention_mask=args.text_encoder_use_attention_mask, ) if unwrap_model(unet).config.in_channels == channels * 2: noisy_model_input = torch.cat([noisy_model_input, noisy_model_input], dim=1) if args.class_labels_conditioning == "timesteps": class_labels = timesteps else: class_labels = None # Predict the noise residual model_pred = unet( noisy_model_input, timesteps, encoder_hidden_states, class_labels=class_labels, return_dict=False, )[0] # if model predicts variance, throw away the prediction. we will only train on the # simplified training objective. This means that all schedulers using the fine tuned # model must be configured to use one of the fixed variance variance types. if model_pred.shape[1] == 6: model_pred, _ = torch.chunk(model_pred, 2, dim=1) # Get the target for loss depending on the prediction type if noise_scheduler.config.prediction_type == "epsilon": target = noise elif noise_scheduler.config.prediction_type == "v_prediction": target = noise_scheduler.get_velocity(model_input, noise, timesteps) else: raise ValueError(f"Unknown prediction type {noise_scheduler.config.prediction_type}") if args.with_prior_preservation: # Chunk the noise and model_pred into two parts and compute the loss on each part separately. model_pred, model_pred_prior = torch.chunk(model_pred, 2, dim=0) target, target_prior = torch.chunk(target, 2, dim=0) # Compute instance loss loss = F.mse_loss(model_pred.float(), target.float(), reduction="mean") # Compute prior loss prior_loss = F.mse_loss(model_pred_prior.float(), target_prior.float(), reduction="mean") # Add the prior loss to the instance loss. loss = loss + args.prior_loss_weight * prior_loss else: loss = F.mse_loss(model_pred.float(), target.float(), reduction="mean") accelerator.backward(loss) if accelerator.sync_gradients: accelerator.clip_grad_norm_(params_to_optimize, args.max_grad_norm) optimizer.step() lr_scheduler.step() optimizer.zero_grad() # Checks if the accelerator has performed an optimization step behind the scenes if accelerator.sync_gradients: progress_bar.update(1) global_step += 1 if accelerator.is_main_process: if global_step % args.checkpointing_steps == 0: # _before_ saving state, check if this save would set us over the `checkpoints_total_limit` if args.checkpoints_total_limit is not None: checkpoints = os.listdir(args.output_dir) checkpoints = [d for d in checkpoints if d.startswith("checkpoint")] checkpoints = sorted(checkpoints, key=lambda x: int(x.split("-")[1])) # before we save the new checkpoint, we need to have at _most_ `checkpoints_total_limit - 1` checkpoints if len(checkpoints) >= args.checkpoints_total_limit: num_to_remove = len(checkpoints) - args.checkpoints_total_limit + 1 removing_checkpoints = checkpoints[0:num_to_remove] logger.info( f"{len(checkpoints)} checkpoints already exist, removing {len(removing_checkpoints)} checkpoints" ) logger.info(f"removing checkpoints: {', '.join(removing_checkpoints)}") for removing_checkpoint in removing_checkpoints: removing_checkpoint = os.path.join(args.output_dir, removing_checkpoint) shutil.rmtree(removing_checkpoint) save_path = os.path.join(args.output_dir, f"checkpoint-{global_step}") accelerator.save_state(save_path) logger.info(f"Saved state to {save_path}") logs = {"loss": loss.detach().item(), "lr": lr_scheduler.get_last_lr()[0]} progress_bar.set_postfix(**logs) accelerator.log(logs, step=global_step) if global_step >= args.max_train_steps: break if accelerator.is_main_process: if args.validation_prompt is not None and epoch % args.validation_epochs == 0: # create pipeline pipeline = DiffusionPipeline.from_pretrained( args.pretrained_model_name_or_path, unet=unwrap_model(unet), text_encoder=None if args.pre_compute_text_embeddings else unwrap_model(text_encoder), revision=args.revision, variant=args.variant, torch_dtype=weight_dtype, ) if args.pre_compute_text_embeddings: pipeline_args = { "prompt_embeds": validation_prompt_encoder_hidden_states, "negative_prompt_embeds": validation_prompt_negative_prompt_embeds, } else: pipeline_args = {"prompt": args.validation_prompt} images = log_validation( pipeline, args, accelerator, pipeline_args, epoch, ) # Save the lora layers accelerator.wait_for_everyone() if accelerator.is_main_process: unet = unwrap_model(unet) unet = unet.to(torch.float32) unet_lora_state_dict = convert_state_dict_to_diffusers(get_peft_model_state_dict(unet)) if args.train_text_encoder: text_encoder = unwrap_model(text_encoder) text_encoder_state_dict = convert_state_dict_to_diffusers(get_peft_model_state_dict(text_encoder)) else: text_encoder_state_dict = None LoraLoaderMixin.save_lora_weights( save_directory=args.output_dir, unet_lora_layers=unet_lora_state_dict, text_encoder_lora_layers=text_encoder_state_dict, ) # Final inference # Load previous pipeline pipeline = DiffusionPipeline.from_pretrained( args.pretrained_model_name_or_path, revision=args.revision, variant=args.variant, torch_dtype=weight_dtype ) # load attention processors pipeline.load_lora_weights(args.output_dir, weight_name="pytorch_lora_weights.safetensors") # run inference images = [] if args.validation_prompt and args.num_validation_images > 0: pipeline_args = {"prompt": args.validation_prompt, "num_inference_steps": 25} images = log_validation( pipeline, args, accelerator, pipeline_args, epoch, is_final_validation=True, ) if args.push_to_hub: save_model_card( repo_id, images=images, base_model=args.pretrained_model_name_or_path, train_text_encoder=args.train_text_encoder, prompt=args.instance_prompt, repo_folder=args.output_dir, pipeline=pipeline, ) upload_folder( repo_id=repo_id, folder_path=args.output_dir, commit_message="End of training", ignore_patterns=["step_*", "epoch_*"], ) accelerator.end_training() if __name__ == "__main__": args = parse_args() main(args)
diffusers/examples/dreambooth/train_dreambooth_lora.py/0
{ "file_path": "diffusers/examples/dreambooth/train_dreambooth_lora.py", "repo_id": "diffusers", "token_count": 25093 }
114
# Multi Subject Dreambooth for Inpainting Models Please note that this project is not actively maintained. However, you can open an issue and tag @gzguevara. [DreamBooth](https://arxiv.org/abs/2208.12242) is a method to personalize text2image models like stable diffusion given just a few(3~5) images of a subject. This project consists of **two parts**. Training Stable Diffusion for inpainting requieres prompt-image-mask pairs. The Unet of inpainiting models have 5 additional input channels (4 for the encoded masked-image and 1 for the mask itself). **The first part**, the `multi_inpaint_dataset.ipynb` notebook, demonstrates how make a 🤗 dataset of prompt-image-mask pairs. You can, however, skip the first part and move straight to the second part with the example datasets in this project. ([cat toy dataset masked](https://huggingface.co/datasets/gzguevara/cat_toy_masked), [mr. potato head dataset masked](https://huggingface.co/datasets/gzguevara/mr_potato_head_masked)) **The second part**, the `train_multi_subject_inpainting.py` training script, demonstrates how to implement a training procedure for one or more subjects and adapt it for stable diffusion for inpainting. ## 1. Data Collection: Make Prompt-Image-Mask Pairs Earlier training scripts have provided approaches like random masking for the training images. This project provides a notebook for more precise mask setting. The notebook can be found here: [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/drive/1JNEASI_B7pLW1srxhgln6nM0HoGAQT32?usp=sharing) The `multi_inpaint_dataset.ipynb` notebook, takes training & validation images, on which the user draws masks and provides prompts to make a prompt-image-mask pairs. This ensures that during training, the loss is computed on the area masking the object of interest, rather than on random areas. Moreover, the `multi_inpaint_dataset.ipynb` notebook allows you to build a validation dataset with corresponding masks for monitoring the training process. Example below: ![train_val_pairs](https://drive.google.com/uc?id=1PzwH8E3icl_ubVmA19G0HZGLImFX3x5I) You can build multiple datasets for every subject and upload them to the 🤗 hub. Later, when launching the training script you can indicate the paths of the datasets, on which you would like to finetune Stable Diffusion for inpaining. ## 2. Train Multi Subject Dreambooth for Inpainting ### 2.1. Setting The Training Configuration Before launching the training script, make sure to select the inpainting the target model, the output directory and the 🤗 datasets. ```bash export MODEL_NAME="runwayml/stable-diffusion-inpainting" export OUTPUT_DIR="path-to-save-model" export DATASET_1="gzguevara/mr_potato_head_masked" export DATASET_2="gzguevara/cat_toy_masked" ... # Further paths to 🤗 datasets ``` ### 2.2. Launching The Training Script ```bash accelerate launch train_multi_subject_dreambooth_inpaint.py \ --pretrained_model_name_or_path=$MODEL_NAME \ --instance_data_dir $DATASET_1 $DATASET_2 \ --output_dir=$OUTPUT_DIR \ --resolution=512 \ --train_batch_size=1 \ --gradient_accumulation_steps=2 \ --learning_rate=3e-6 \ --max_train_steps=500 \ --report_to_wandb ``` ### 2.3. Fine-tune text encoder with the UNet. The script also allows to fine-tune the `text_encoder` along with the `unet`. It's been observed experimentally that fine-tuning `text_encoder` gives much better results especially on faces. Pass the `--train_text_encoder` argument to the script to enable training `text_encoder`. ___Note: Training text encoder requires more memory, with this option the training won't fit on 16GB GPU. It needs at least 24GB VRAM.___ ```bash accelerate launch train_multi_subject_dreambooth_inpaint.py \ --pretrained_model_name_or_path=$MODEL_NAME \ --instance_data_dir $DATASET_1 $DATASET_2 \ --output_dir=$OUTPUT_DIR \ --resolution=512 \ --train_batch_size=1 \ --gradient_accumulation_steps=2 \ --learning_rate=2e-6 \ --max_train_steps=500 \ --report_to_wandb \ --train_text_encoder ``` ## 3. Results A [![Weights & Biases](https://img.shields.io/badge/Weights%20&%20Biases-Report-blue)](https://wandb.ai/gzguevara/uncategorized/reports/Multi-Subject-Dreambooth-for-Inpainting--Vmlldzo2MzY5NDQ4?accessToken=y0nya2d7baguhbryxaikbfr1203amvn1jsmyl07vk122mrs7tnph037u1nqgse8t) is provided showing the training progress by every 50 steps. Note, the reported weights & baises run was performed on a A100 GPU with the following stetting: ```bash accelerate launch train_multi_subject_dreambooth_inpaint.py \ --pretrained_model_name_or_path=$MODEL_NAME \ --instance_data_dir $DATASET_1 $DATASET_2 \ --output_dir=$OUTPUT_DIR \ --resolution=512 \ --train_batch_size=10 \ --gradient_accumulation_steps=1 \ --learning_rate=1e-6 \ --max_train_steps=500 \ --report_to_wandb \ --train_text_encoder ``` Here you can see the target objects on my desk and next to my plant: ![Results](https://drive.google.com/uc?id=1kQisOiiF5cj4rOYjdq8SCZenNsUP2aK0)
diffusers/examples/research_projects/multi_subject_dreambooth_inpainting/README.md/0
{ "file_path": "diffusers/examples/research_projects/multi_subject_dreambooth_inpainting/README.md", "repo_id": "diffusers", "token_count": 1665 }
115
## Training examples Creating a training image set is [described in a different document](https://huggingface.co/docs/datasets/image_process#image-datasets). ### Installing the dependencies Before running the scripts, make sure to install the library's training dependencies: **Important** To make sure you can successfully run the latest versions of the example scripts, we highly recommend **installing from source** and keeping the install up to date as we update the example scripts frequently and install some example-specific requirements. To do this, execute the following steps in a new virtual environment: ```bash git clone https://github.com/huggingface/diffusers cd diffusers pip install . ``` Then cd in the example folder and run ```bash pip install -r requirements.txt ``` And initialize an [🤗Accelerate](https://github.com/huggingface/accelerate/) environment with: ```bash accelerate config ``` #### Use ONNXRuntime to accelerate training In order to leverage onnxruntime to accelerate training, please use train_unconditional_ort.py The command to train a DDPM UNet model on the Oxford Flowers dataset with onnxruntime: ```bash accelerate launch train_unconditional.py \ --dataset_name="huggan/flowers-102-categories" \ --resolution=64 --center_crop --random_flip \ --output_dir="ddpm-ema-flowers-64" \ --use_ema \ --train_batch_size=16 \ --num_epochs=1 \ --gradient_accumulation_steps=1 \ --learning_rate=1e-4 \ --lr_warmup_steps=500 \ --mixed_precision=fp16 ``` Please contact Prathik Rao (prathikr), Sunghoon Choi (hanbitmyths), Ashwini Khade (askhade), or Peng Wang (pengwa) on github with any questions.
diffusers/examples/research_projects/onnxruntime/unconditional_image_generation/README.md/0
{ "file_path": "diffusers/examples/research_projects/onnxruntime/unconditional_image_generation/README.md", "repo_id": "diffusers", "token_count": 500 }
116
import time import jax import jax.numpy as jnp import numpy as np from flax.jax_utils import replicate from jax import pmap # Let's cache the model compilation, so that it doesn't take as long the next time around. from jax.experimental.compilation_cache import compilation_cache as cc from diffusers import FlaxStableDiffusionXLPipeline cc.initialize_cache("/tmp/sdxl_cache") NUM_DEVICES = jax.device_count() # 1. Let's start by downloading the model and loading it into our pipeline class # Adhering to JAX's functional approach, the model's parameters are returned seperatetely and # will have to be passed to the pipeline during inference pipeline, params = FlaxStableDiffusionXLPipeline.from_pretrained( "stabilityai/stable-diffusion-xl-base-1.0", revision="refs/pr/95", split_head_dim=True ) # 2. We cast all parameters to bfloat16 EXCEPT the scheduler which we leave in # float32 to keep maximal precision scheduler_state = params.pop("scheduler") params = jax.tree_util.tree_map(lambda x: x.astype(jnp.bfloat16), params) params["scheduler"] = scheduler_state # 3. Next, we define the different inputs to the pipeline default_prompt = "a colorful photo of a castle in the middle of a forest with trees and bushes, by Ismail Inceoglu, shadows, high contrast, dynamic shading, hdr, detailed vegetation, digital painting, digital drawing, detailed painting, a detailed digital painting, gothic art, featured on deviantart" default_neg_prompt = "fog, grainy, purple" default_seed = 33 default_guidance_scale = 5.0 default_num_steps = 25 width = 1024 height = 1024 # 4. In order to be able to compile the pipeline # all inputs have to be tensors or strings # Let's tokenize the prompt and negative prompt def tokenize_prompt(prompt, neg_prompt): prompt_ids = pipeline.prepare_inputs(prompt) neg_prompt_ids = pipeline.prepare_inputs(neg_prompt) return prompt_ids, neg_prompt_ids # 5. To make full use of JAX's parallelization capabilities # the parameters and input tensors are duplicated across devices # To make sure every device generates a different image, we create # different seeds for each image. The model parameters won't change # during inference so we do not wrap them into a function p_params = replicate(params) def replicate_all(prompt_ids, neg_prompt_ids, seed): p_prompt_ids = replicate(prompt_ids) p_neg_prompt_ids = replicate(neg_prompt_ids) rng = jax.random.PRNGKey(seed) rng = jax.random.split(rng, NUM_DEVICES) return p_prompt_ids, p_neg_prompt_ids, rng # 6. To compile the pipeline._generate function, we must pass all parameters # to the function and tell JAX which are static arguments, that is, arguments that # are known at compile time and won't change. In our case, it is num_inference_steps, # height, width and return_latents. # Once the function is compiled, these parameters are ommited from future calls and # cannot be changed without modifying the code and recompiling. def aot_compile( prompt=default_prompt, negative_prompt=default_neg_prompt, seed=default_seed, guidance_scale=default_guidance_scale, num_inference_steps=default_num_steps, ): prompt_ids, neg_prompt_ids = tokenize_prompt(prompt, negative_prompt) prompt_ids, neg_prompt_ids, rng = replicate_all(prompt_ids, neg_prompt_ids, seed) g = jnp.array([guidance_scale] * prompt_ids.shape[0], dtype=jnp.float32) g = g[:, None] return ( pmap(pipeline._generate, static_broadcasted_argnums=[3, 4, 5, 9]) .lower( prompt_ids, p_params, rng, num_inference_steps, # num_inference_steps height, # height width, # width g, None, neg_prompt_ids, False, # return_latents ) .compile() ) start = time.time() print("Compiling ...") p_generate = aot_compile() print(f"Compiled in {time.time() - start}") # 7. Let's now put it all together in a generate function. def generate(prompt, negative_prompt, seed=default_seed, guidance_scale=default_guidance_scale): prompt_ids, neg_prompt_ids = tokenize_prompt(prompt, negative_prompt) prompt_ids, neg_prompt_ids, rng = replicate_all(prompt_ids, neg_prompt_ids, seed) g = jnp.array([guidance_scale] * prompt_ids.shape[0], dtype=jnp.float32) g = g[:, None] images = p_generate(prompt_ids, p_params, rng, g, None, neg_prompt_ids) # convert the images to PIL images = images.reshape((images.shape[0] * images.shape[1],) + images.shape[-3:]) return pipeline.numpy_to_pil(np.array(images)) # 8. The first forward pass after AOT compilation still takes a while longer than # subsequent passes, this is because on the first pass, JAX uses Python dispatch, which # Fills the C++ dispatch cache. # When using jit, this extra step is done automatically, but when using AOT compilation, # it doesn't happen until the function call is made. start = time.time() prompt = "photo of a rhino dressed suit and tie sitting at a table in a bar with a bar stools, award winning photography, Elke vogelsang" neg_prompt = "cartoon, illustration, animation. face. male, female" images = generate(prompt, neg_prompt) print(f"First inference in {time.time() - start}") # 9. From this point forward, any calls to generate should result in a faster inference # time and it won't change. start = time.time() prompt = "photo of a rhino dressed suit and tie sitting at a table in a bar with a bar stools, award winning photography, Elke vogelsang" neg_prompt = "cartoon, illustration, animation. face. male, female" images = generate(prompt, neg_prompt) print(f"Inference in {time.time() - start}") for i, image in enumerate(images): image.save(f"castle_{i}.png")
diffusers/examples/research_projects/sdxl_flax/sdxl_single_aot.py/0
{ "file_path": "diffusers/examples/research_projects/sdxl_flax/sdxl_single_aot.py", "repo_id": "diffusers", "token_count": 1969 }
117
# Würstchen text-to-image fine-tuning ## Running locally with PyTorch Before running the scripts, make sure to install the library's training dependencies: **Important** To make sure you can successfully run the latest versions of the example scripts, we highly recommend **installing from source** and keeping the install up to date. To do this, execute the following steps in a new virtual environment: ```bash git clone https://github.com/huggingface/diffusers cd diffusers pip install . ``` Then cd into the example folder and run ```bash cd examples/wuerstchen/text_to_image pip install -r requirements.txt ``` And initialize an [🤗Accelerate](https://github.com/huggingface/accelerate/) environment with: ```bash accelerate config ``` For this example we want to directly store the trained LoRA embeddings on the Hub, so we need to be logged in and add the `--push_to_hub` flag to the training script. To log in, run: ```bash huggingface-cli login ``` ## Prior training You can fine-tune the Würstchen prior model with the `train_text_to_image_prior.py` script. Note that we currently support `--gradient_checkpointing` for prior model fine-tuning so you can use it for more GPU memory constrained setups. <br> <!-- accelerate_snippet_start --> ```bash export DATASET_NAME="lambdalabs/pokemon-blip-captions" accelerate launch train_text_to_image_prior.py \ --mixed_precision="fp16" \ --dataset_name=$DATASET_NAME \ --resolution=768 \ --train_batch_size=4 \ --gradient_accumulation_steps=4 \ --gradient_checkpointing \ --dataloader_num_workers=4 \ --max_train_steps=15000 \ --learning_rate=1e-05 \ --max_grad_norm=1 \ --checkpoints_total_limit=3 \ --lr_scheduler="constant" --lr_warmup_steps=0 \ --validation_prompts="A robot pokemon, 4k photo" \ --report_to="wandb" \ --push_to_hub \ --output_dir="wuerstchen-prior-pokemon-model" ``` <!-- accelerate_snippet_end --> ## Training with LoRA Low-Rank Adaption of Large Language Models (or LoRA) was first introduced by Microsoft in [LoRA: Low-Rank Adaptation of Large Language Models](https://arxiv.org/abs/2106.09685) by *Edward J. Hu, Yelong Shen, Phillip Wallis, Zeyuan Allen-Zhu, Yuanzhi Li, Shean Wang, Lu Wang, Weizhu Chen*. In a nutshell, LoRA allows adapting pretrained models by adding pairs of rank-decomposition matrices to existing weights and **only** training those newly added weights. This has a couple of advantages: - Previous pretrained weights are kept frozen so that the model is not prone to [catastrophic forgetting](https://www.pnas.org/doi/10.1073/pnas.1611835114). - Rank-decomposition matrices have significantly fewer parameters than original model, which means that trained LoRA weights are easily portable. - LoRA attention layers allow to control to which extent the model is adapted toward new training images via a `scale` parameter. ### Prior Training First, you need to set up your development environment as explained in the [installation](#Running-locally-with-PyTorch) section. Make sure to set the `DATASET_NAME` environment variable. Here, we will use the [Pokemon captions dataset](https://huggingface.co/datasets/lambdalabs/pokemon-blip-captions). ```bash export DATASET_NAME="lambdalabs/pokemon-blip-captions" accelerate launch train_text_to_image_lora_prior.py \ --mixed_precision="fp16" \ --dataset_name=$DATASET_NAME --caption_column="text" \ --resolution=768 \ --train_batch_size=8 \ --num_train_epochs=100 --checkpointing_steps=5000 \ --learning_rate=1e-04 --lr_scheduler="constant" --lr_warmup_steps=0 \ --seed=42 \ --rank=4 \ --validation_prompt="cute dragon creature" \ --report_to="wandb" \ --push_to_hub \ --output_dir="wuerstchen-prior-pokemon-lora" ```
diffusers/examples/wuerstchen/text_to_image/README.md/0
{ "file_path": "diffusers/examples/wuerstchen/text_to_image/README.md", "repo_id": "diffusers", "token_count": 1206 }
118
import argparse import os import torch from diffusers import ( CMStochasticIterativeScheduler, ConsistencyModelPipeline, UNet2DModel, ) TEST_UNET_CONFIG = { "sample_size": 32, "in_channels": 3, "out_channels": 3, "layers_per_block": 2, "num_class_embeds": 1000, "block_out_channels": [32, 64], "attention_head_dim": 8, "down_block_types": [ "ResnetDownsampleBlock2D", "AttnDownBlock2D", ], "up_block_types": [ "AttnUpBlock2D", "ResnetUpsampleBlock2D", ], "resnet_time_scale_shift": "scale_shift", "attn_norm_num_groups": 32, "upsample_type": "resnet", "downsample_type": "resnet", } IMAGENET_64_UNET_CONFIG = { "sample_size": 64, "in_channels": 3, "out_channels": 3, "layers_per_block": 3, "num_class_embeds": 1000, "block_out_channels": [192, 192 * 2, 192 * 3, 192 * 4], "attention_head_dim": 64, "down_block_types": [ "ResnetDownsampleBlock2D", "AttnDownBlock2D", "AttnDownBlock2D", "AttnDownBlock2D", ], "up_block_types": [ "AttnUpBlock2D", "AttnUpBlock2D", "AttnUpBlock2D", "ResnetUpsampleBlock2D", ], "resnet_time_scale_shift": "scale_shift", "attn_norm_num_groups": 32, "upsample_type": "resnet", "downsample_type": "resnet", } LSUN_256_UNET_CONFIG = { "sample_size": 256, "in_channels": 3, "out_channels": 3, "layers_per_block": 2, "num_class_embeds": None, "block_out_channels": [256, 256, 256 * 2, 256 * 2, 256 * 4, 256 * 4], "attention_head_dim": 64, "down_block_types": [ "ResnetDownsampleBlock2D", "ResnetDownsampleBlock2D", "ResnetDownsampleBlock2D", "AttnDownBlock2D", "AttnDownBlock2D", "AttnDownBlock2D", ], "up_block_types": [ "AttnUpBlock2D", "AttnUpBlock2D", "AttnUpBlock2D", "ResnetUpsampleBlock2D", "ResnetUpsampleBlock2D", "ResnetUpsampleBlock2D", ], "resnet_time_scale_shift": "default", "upsample_type": "resnet", "downsample_type": "resnet", } CD_SCHEDULER_CONFIG = { "num_train_timesteps": 40, "sigma_min": 0.002, "sigma_max": 80.0, } CT_IMAGENET_64_SCHEDULER_CONFIG = { "num_train_timesteps": 201, "sigma_min": 0.002, "sigma_max": 80.0, } CT_LSUN_256_SCHEDULER_CONFIG = { "num_train_timesteps": 151, "sigma_min": 0.002, "sigma_max": 80.0, } def str2bool(v): """ https://stackoverflow.com/questions/15008758/parsing-boolean-values-with-argparse """ if isinstance(v, bool): return v if v.lower() in ("yes", "true", "t", "y", "1"): return True elif v.lower() in ("no", "false", "f", "n", "0"): return False else: raise argparse.ArgumentTypeError("boolean value expected") def convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix, has_skip=False): new_checkpoint[f"{new_prefix}.norm1.weight"] = checkpoint[f"{old_prefix}.in_layers.0.weight"] new_checkpoint[f"{new_prefix}.norm1.bias"] = checkpoint[f"{old_prefix}.in_layers.0.bias"] new_checkpoint[f"{new_prefix}.conv1.weight"] = checkpoint[f"{old_prefix}.in_layers.2.weight"] new_checkpoint[f"{new_prefix}.conv1.bias"] = checkpoint[f"{old_prefix}.in_layers.2.bias"] new_checkpoint[f"{new_prefix}.time_emb_proj.weight"] = checkpoint[f"{old_prefix}.emb_layers.1.weight"] new_checkpoint[f"{new_prefix}.time_emb_proj.bias"] = checkpoint[f"{old_prefix}.emb_layers.1.bias"] new_checkpoint[f"{new_prefix}.norm2.weight"] = checkpoint[f"{old_prefix}.out_layers.0.weight"] new_checkpoint[f"{new_prefix}.norm2.bias"] = checkpoint[f"{old_prefix}.out_layers.0.bias"] new_checkpoint[f"{new_prefix}.conv2.weight"] = checkpoint[f"{old_prefix}.out_layers.3.weight"] new_checkpoint[f"{new_prefix}.conv2.bias"] = checkpoint[f"{old_prefix}.out_layers.3.bias"] if has_skip: new_checkpoint[f"{new_prefix}.conv_shortcut.weight"] = checkpoint[f"{old_prefix}.skip_connection.weight"] new_checkpoint[f"{new_prefix}.conv_shortcut.bias"] = checkpoint[f"{old_prefix}.skip_connection.bias"] return new_checkpoint def convert_attention(checkpoint, new_checkpoint, old_prefix, new_prefix, attention_dim=None): weight_q, weight_k, weight_v = checkpoint[f"{old_prefix}.qkv.weight"].chunk(3, dim=0) bias_q, bias_k, bias_v = checkpoint[f"{old_prefix}.qkv.bias"].chunk(3, dim=0) new_checkpoint[f"{new_prefix}.group_norm.weight"] = checkpoint[f"{old_prefix}.norm.weight"] new_checkpoint[f"{new_prefix}.group_norm.bias"] = checkpoint[f"{old_prefix}.norm.bias"] new_checkpoint[f"{new_prefix}.to_q.weight"] = weight_q.squeeze(-1).squeeze(-1) new_checkpoint[f"{new_prefix}.to_q.bias"] = bias_q.squeeze(-1).squeeze(-1) new_checkpoint[f"{new_prefix}.to_k.weight"] = weight_k.squeeze(-1).squeeze(-1) new_checkpoint[f"{new_prefix}.to_k.bias"] = bias_k.squeeze(-1).squeeze(-1) new_checkpoint[f"{new_prefix}.to_v.weight"] = weight_v.squeeze(-1).squeeze(-1) new_checkpoint[f"{new_prefix}.to_v.bias"] = bias_v.squeeze(-1).squeeze(-1) new_checkpoint[f"{new_prefix}.to_out.0.weight"] = ( checkpoint[f"{old_prefix}.proj_out.weight"].squeeze(-1).squeeze(-1) ) new_checkpoint[f"{new_prefix}.to_out.0.bias"] = checkpoint[f"{old_prefix}.proj_out.bias"].squeeze(-1).squeeze(-1) return new_checkpoint def con_pt_to_diffuser(checkpoint_path: str, unet_config): checkpoint = torch.load(checkpoint_path, map_location="cpu") new_checkpoint = {} new_checkpoint["time_embedding.linear_1.weight"] = checkpoint["time_embed.0.weight"] new_checkpoint["time_embedding.linear_1.bias"] = checkpoint["time_embed.0.bias"] new_checkpoint["time_embedding.linear_2.weight"] = checkpoint["time_embed.2.weight"] new_checkpoint["time_embedding.linear_2.bias"] = checkpoint["time_embed.2.bias"] if unet_config["num_class_embeds"] is not None: new_checkpoint["class_embedding.weight"] = checkpoint["label_emb.weight"] new_checkpoint["conv_in.weight"] = checkpoint["input_blocks.0.0.weight"] new_checkpoint["conv_in.bias"] = checkpoint["input_blocks.0.0.bias"] down_block_types = unet_config["down_block_types"] layers_per_block = unet_config["layers_per_block"] attention_head_dim = unet_config["attention_head_dim"] channels_list = unet_config["block_out_channels"] current_layer = 1 prev_channels = channels_list[0] for i, layer_type in enumerate(down_block_types): current_channels = channels_list[i] downsample_block_has_skip = current_channels != prev_channels if layer_type == "ResnetDownsampleBlock2D": for j in range(layers_per_block): new_prefix = f"down_blocks.{i}.resnets.{j}" old_prefix = f"input_blocks.{current_layer}.0" has_skip = True if j == 0 and downsample_block_has_skip else False new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix, has_skip=has_skip) current_layer += 1 elif layer_type == "AttnDownBlock2D": for j in range(layers_per_block): new_prefix = f"down_blocks.{i}.resnets.{j}" old_prefix = f"input_blocks.{current_layer}.0" has_skip = True if j == 0 and downsample_block_has_skip else False new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix, has_skip=has_skip) new_prefix = f"down_blocks.{i}.attentions.{j}" old_prefix = f"input_blocks.{current_layer}.1" new_checkpoint = convert_attention( checkpoint, new_checkpoint, old_prefix, new_prefix, attention_head_dim ) current_layer += 1 if i != len(down_block_types) - 1: new_prefix = f"down_blocks.{i}.downsamplers.0" old_prefix = f"input_blocks.{current_layer}.0" new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix) current_layer += 1 prev_channels = current_channels # hardcoded the mid-block for now new_prefix = "mid_block.resnets.0" old_prefix = "middle_block.0" new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix) new_prefix = "mid_block.attentions.0" old_prefix = "middle_block.1" new_checkpoint = convert_attention(checkpoint, new_checkpoint, old_prefix, new_prefix, attention_head_dim) new_prefix = "mid_block.resnets.1" old_prefix = "middle_block.2" new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix) current_layer = 0 up_block_types = unet_config["up_block_types"] for i, layer_type in enumerate(up_block_types): if layer_type == "ResnetUpsampleBlock2D": for j in range(layers_per_block + 1): new_prefix = f"up_blocks.{i}.resnets.{j}" old_prefix = f"output_blocks.{current_layer}.0" new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix, has_skip=True) current_layer += 1 if i != len(up_block_types) - 1: new_prefix = f"up_blocks.{i}.upsamplers.0" old_prefix = f"output_blocks.{current_layer-1}.1" new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix) elif layer_type == "AttnUpBlock2D": for j in range(layers_per_block + 1): new_prefix = f"up_blocks.{i}.resnets.{j}" old_prefix = f"output_blocks.{current_layer}.0" new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix, has_skip=True) new_prefix = f"up_blocks.{i}.attentions.{j}" old_prefix = f"output_blocks.{current_layer}.1" new_checkpoint = convert_attention( checkpoint, new_checkpoint, old_prefix, new_prefix, attention_head_dim ) current_layer += 1 if i != len(up_block_types) - 1: new_prefix = f"up_blocks.{i}.upsamplers.0" old_prefix = f"output_blocks.{current_layer-1}.2" new_checkpoint = convert_resnet(checkpoint, new_checkpoint, old_prefix, new_prefix) new_checkpoint["conv_norm_out.weight"] = checkpoint["out.0.weight"] new_checkpoint["conv_norm_out.bias"] = checkpoint["out.0.bias"] new_checkpoint["conv_out.weight"] = checkpoint["out.2.weight"] new_checkpoint["conv_out.bias"] = checkpoint["out.2.bias"] return new_checkpoint if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument("--unet_path", default=None, type=str, required=True, help="Path to the unet.pt to convert.") parser.add_argument( "--dump_path", default=None, type=str, required=True, help="Path to output the converted UNet model." ) parser.add_argument("--class_cond", default=True, type=str, help="Whether the model is class-conditional.") args = parser.parse_args() args.class_cond = str2bool(args.class_cond) ckpt_name = os.path.basename(args.unet_path) print(f"Checkpoint: {ckpt_name}") # Get U-Net config if "imagenet64" in ckpt_name: unet_config = IMAGENET_64_UNET_CONFIG elif "256" in ckpt_name and (("bedroom" in ckpt_name) or ("cat" in ckpt_name)): unet_config = LSUN_256_UNET_CONFIG elif "test" in ckpt_name: unet_config = TEST_UNET_CONFIG else: raise ValueError(f"Checkpoint type {ckpt_name} is not currently supported.") if not args.class_cond: unet_config["num_class_embeds"] = None converted_unet_ckpt = con_pt_to_diffuser(args.unet_path, unet_config) image_unet = UNet2DModel(**unet_config) image_unet.load_state_dict(converted_unet_ckpt) # Get scheduler config if "cd" in ckpt_name or "test" in ckpt_name: scheduler_config = CD_SCHEDULER_CONFIG elif "ct" in ckpt_name and "imagenet64" in ckpt_name: scheduler_config = CT_IMAGENET_64_SCHEDULER_CONFIG elif "ct" in ckpt_name and "256" in ckpt_name and (("bedroom" in ckpt_name) or ("cat" in ckpt_name)): scheduler_config = CT_LSUN_256_SCHEDULER_CONFIG else: raise ValueError(f"Checkpoint type {ckpt_name} is not currently supported.") cm_scheduler = CMStochasticIterativeScheduler(**scheduler_config) consistency_model = ConsistencyModelPipeline(unet=image_unet, scheduler=cm_scheduler) consistency_model.save_pretrained(args.dump_path)
diffusers/scripts/convert_consistency_to_diffusers.py/0
{ "file_path": "diffusers/scripts/convert_consistency_to_diffusers.py", "repo_id": "diffusers", "token_count": 5773 }
119
import json import os import torch from diffusers import UNet1DModel os.makedirs("hub/hopper-medium-v2/unet/hor32", exist_ok=True) os.makedirs("hub/hopper-medium-v2/unet/hor128", exist_ok=True) os.makedirs("hub/hopper-medium-v2/value_function", exist_ok=True) def unet(hor): if hor == 128: down_block_types = ("DownResnetBlock1D", "DownResnetBlock1D", "DownResnetBlock1D") block_out_channels = (32, 128, 256) up_block_types = ("UpResnetBlock1D", "UpResnetBlock1D") elif hor == 32: down_block_types = ("DownResnetBlock1D", "DownResnetBlock1D", "DownResnetBlock1D", "DownResnetBlock1D") block_out_channels = (32, 64, 128, 256) up_block_types = ("UpResnetBlock1D", "UpResnetBlock1D", "UpResnetBlock1D") model = torch.load(f"/Users/bglickenhaus/Documents/diffuser/temporal_unet-hopper-mediumv2-hor{hor}.torch") state_dict = model.state_dict() config = { "down_block_types": down_block_types, "block_out_channels": block_out_channels, "up_block_types": up_block_types, "layers_per_block": 1, "use_timestep_embedding": True, "out_block_type": "OutConv1DBlock", "norm_num_groups": 8, "downsample_each_block": False, "in_channels": 14, "out_channels": 14, "extra_in_channels": 0, "time_embedding_type": "positional", "flip_sin_to_cos": False, "freq_shift": 1, "sample_size": 65536, "mid_block_type": "MidResTemporalBlock1D", "act_fn": "mish", } hf_value_function = UNet1DModel(**config) print(f"length of state dict: {len(state_dict.keys())}") print(f"length of value function dict: {len(hf_value_function.state_dict().keys())}") mapping = dict(zip(model.state_dict().keys(), hf_value_function.state_dict().keys())) for k, v in mapping.items(): state_dict[v] = state_dict.pop(k) hf_value_function.load_state_dict(state_dict) torch.save(hf_value_function.state_dict(), f"hub/hopper-medium-v2/unet/hor{hor}/diffusion_pytorch_model.bin") with open(f"hub/hopper-medium-v2/unet/hor{hor}/config.json", "w") as f: json.dump(config, f) def value_function(): config = { "in_channels": 14, "down_block_types": ("DownResnetBlock1D", "DownResnetBlock1D", "DownResnetBlock1D", "DownResnetBlock1D"), "up_block_types": (), "out_block_type": "ValueFunction", "mid_block_type": "ValueFunctionMidBlock1D", "block_out_channels": (32, 64, 128, 256), "layers_per_block": 1, "downsample_each_block": True, "sample_size": 65536, "out_channels": 14, "extra_in_channels": 0, "time_embedding_type": "positional", "use_timestep_embedding": True, "flip_sin_to_cos": False, "freq_shift": 1, "norm_num_groups": 8, "act_fn": "mish", } model = torch.load("/Users/bglickenhaus/Documents/diffuser/value_function-hopper-mediumv2-hor32.torch") state_dict = model hf_value_function = UNet1DModel(**config) print(f"length of state dict: {len(state_dict.keys())}") print(f"length of value function dict: {len(hf_value_function.state_dict().keys())}") mapping = dict(zip(state_dict.keys(), hf_value_function.state_dict().keys())) for k, v in mapping.items(): state_dict[v] = state_dict.pop(k) hf_value_function.load_state_dict(state_dict) torch.save(hf_value_function.state_dict(), "hub/hopper-medium-v2/value_function/diffusion_pytorch_model.bin") with open("hub/hopper-medium-v2/value_function/config.json", "w") as f: json.dump(config, f) if __name__ == "__main__": unet(32) # unet(128) value_function()
diffusers/scripts/convert_models_diffuser_to_diffusers.py/0
{ "file_path": "diffusers/scripts/convert_models_diffuser_to_diffusers.py", "repo_id": "diffusers", "token_count": 1700 }
120
import argparse import sys import tensorrt as trt def convert_models(onnx_path: str, num_controlnet: int, output_path: str, fp16: bool = False, sd_xl: bool = False): """ Function to convert models in stable diffusion controlnet pipeline into TensorRT format Example: python convert_stable_diffusion_controlnet_to_tensorrt.py --onnx_path path-to-models-stable_diffusion/RevAnimated-v1-2-2/unet/model.onnx --output_path path-to-models-stable_diffusion/RevAnimated-v1-2-2/unet/model.engine --fp16 --num_controlnet 2 Example for SD XL: python convert_stable_diffusion_controlnet_to_tensorrt.py --onnx_path path-to-models-stable_diffusion/stable-diffusion-xl-base-1.0/unet/model.onnx --output_path path-to-models-stable_diffusion/stable-diffusion-xl-base-1.0/unet/model.engine --fp16 --num_controlnet 1 --sd_xl Returns: unet/model.engine run test script in diffusers/examples/community python test_onnx_controlnet.py --sd_model danbrown/RevAnimated-v1-2-2 --onnx_model_dir path-to-models-stable_diffusion/RevAnimated-v1-2-2 --unet_engine_path path-to-models-stable_diffusion/stable-diffusion-xl-base-1.0/unet/model.engine --qr_img_path path-to-qr-code-image """ # UNET if sd_xl: batch_size = 1 unet_in_channels = 4 unet_sample_size = 64 num_tokens = 77 text_hidden_size = 2048 img_size = 512 text_embeds_shape = (2 * batch_size, 1280) time_ids_shape = (2 * batch_size, 6) else: batch_size = 1 unet_in_channels = 4 unet_sample_size = 64 num_tokens = 77 text_hidden_size = 768 img_size = 512 batch_size = 1 latents_shape = (2 * batch_size, unet_in_channels, unet_sample_size, unet_sample_size) embed_shape = (2 * batch_size, num_tokens, text_hidden_size) controlnet_conds_shape = (num_controlnet, 2 * batch_size, 3, img_size, img_size) TRT_LOGGER = trt.Logger(trt.Logger.VERBOSE) TRT_BUILDER = trt.Builder(TRT_LOGGER) TRT_RUNTIME = trt.Runtime(TRT_LOGGER) network = TRT_BUILDER.create_network(1 << int(trt.NetworkDefinitionCreationFlag.EXPLICIT_BATCH)) onnx_parser = trt.OnnxParser(network, TRT_LOGGER) parse_success = onnx_parser.parse_from_file(onnx_path) for idx in range(onnx_parser.num_errors): print(onnx_parser.get_error(idx)) if not parse_success: sys.exit("ONNX model parsing failed") print("Load Onnx model done") profile = TRT_BUILDER.create_optimization_profile() profile.set_shape("sample", latents_shape, latents_shape, latents_shape) profile.set_shape("encoder_hidden_states", embed_shape, embed_shape, embed_shape) profile.set_shape("controlnet_conds", controlnet_conds_shape, controlnet_conds_shape, controlnet_conds_shape) if sd_xl: profile.set_shape("text_embeds", text_embeds_shape, text_embeds_shape, text_embeds_shape) profile.set_shape("time_ids", time_ids_shape, time_ids_shape, time_ids_shape) config = TRT_BUILDER.create_builder_config() config.add_optimization_profile(profile) config.set_preview_feature(trt.PreviewFeature.DISABLE_EXTERNAL_TACTIC_SOURCES_FOR_CORE_0805, True) if fp16: config.set_flag(trt.BuilderFlag.FP16) plan = TRT_BUILDER.build_serialized_network(network, config) if plan is None: sys.exit("Failed building engine") print("Succeeded building engine") engine = TRT_RUNTIME.deserialize_cuda_engine(plan) ## save TRT engine with open(output_path, "wb") as f: f.write(engine.serialize()) if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument("--sd_xl", action="store_true", default=False, help="SD XL pipeline") parser.add_argument( "--onnx_path", type=str, required=True, help="Path to the onnx checkpoint to convert", ) parser.add_argument("--num_controlnet", type=int) parser.add_argument("--output_path", type=str, required=True, help="Path to the output model.") parser.add_argument("--fp16", action="store_true", default=False, help="Export the models in `float16` mode") args = parser.parse_args() convert_models(args.onnx_path, args.num_controlnet, args.output_path, args.fp16, args.sd_xl)
diffusers/scripts/convert_stable_diffusion_controlnet_to_tensorrt.py/0
{ "file_path": "diffusers/scripts/convert_stable_diffusion_controlnet_to_tensorrt.py", "repo_id": "diffusers", "token_count": 1860 }
121
#!/usr/bin/env python # Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from argparse import ArgumentParser from .env import EnvironmentCommand from .fp16_safetensors import FP16SafetensorsCommand def main(): parser = ArgumentParser("Diffusers CLI tool", usage="diffusers-cli <command> [<args>]") commands_parser = parser.add_subparsers(help="diffusers-cli command helpers") # Register commands EnvironmentCommand.register_subcommand(commands_parser) FP16SafetensorsCommand.register_subcommand(commands_parser) # Let's go args = parser.parse_args() if not hasattr(args, "func"): parser.print_help() exit(1) # Run service = args.func(args) service.run() if __name__ == "__main__": main()
diffusers/src/diffusers/commands/diffusers_cli.py/0
{ "file_path": "diffusers/src/diffusers/commands/diffusers_cli.py", "repo_id": "diffusers", "token_count": 411 }
122
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import re from ..utils import is_peft_version, logging logger = logging.get_logger(__name__) def _maybe_map_sgm_blocks_to_diffusers(state_dict, unet_config, delimiter="_", block_slice_pos=5): # 1. get all state_dict_keys all_keys = list(state_dict.keys()) sgm_patterns = ["input_blocks", "middle_block", "output_blocks"] # 2. check if needs remapping, if not return original dict is_in_sgm_format = False for key in all_keys: if any(p in key for p in sgm_patterns): is_in_sgm_format = True break if not is_in_sgm_format: return state_dict # 3. Else remap from SGM patterns new_state_dict = {} inner_block_map = ["resnets", "attentions", "upsamplers"] # Retrieves # of down, mid and up blocks input_block_ids, middle_block_ids, output_block_ids = set(), set(), set() for layer in all_keys: if "text" in layer: new_state_dict[layer] = state_dict.pop(layer) else: layer_id = int(layer.split(delimiter)[:block_slice_pos][-1]) if sgm_patterns[0] in layer: input_block_ids.add(layer_id) elif sgm_patterns[1] in layer: middle_block_ids.add(layer_id) elif sgm_patterns[2] in layer: output_block_ids.add(layer_id) else: raise ValueError(f"Checkpoint not supported because layer {layer} not supported.") input_blocks = { layer_id: [key for key in state_dict if f"input_blocks{delimiter}{layer_id}" in key] for layer_id in input_block_ids } middle_blocks = { layer_id: [key for key in state_dict if f"middle_block{delimiter}{layer_id}" in key] for layer_id in middle_block_ids } output_blocks = { layer_id: [key for key in state_dict if f"output_blocks{delimiter}{layer_id}" in key] for layer_id in output_block_ids } # Rename keys accordingly for i in input_block_ids: block_id = (i - 1) // (unet_config.layers_per_block + 1) layer_in_block_id = (i - 1) % (unet_config.layers_per_block + 1) for key in input_blocks[i]: inner_block_id = int(key.split(delimiter)[block_slice_pos]) inner_block_key = inner_block_map[inner_block_id] if "op" not in key else "downsamplers" inner_layers_in_block = str(layer_in_block_id) if "op" not in key else "0" new_key = delimiter.join( key.split(delimiter)[: block_slice_pos - 1] + [str(block_id), inner_block_key, inner_layers_in_block] + key.split(delimiter)[block_slice_pos + 1 :] ) new_state_dict[new_key] = state_dict.pop(key) for i in middle_block_ids: key_part = None if i == 0: key_part = [inner_block_map[0], "0"] elif i == 1: key_part = [inner_block_map[1], "0"] elif i == 2: key_part = [inner_block_map[0], "1"] else: raise ValueError(f"Invalid middle block id {i}.") for key in middle_blocks[i]: new_key = delimiter.join( key.split(delimiter)[: block_slice_pos - 1] + key_part + key.split(delimiter)[block_slice_pos:] ) new_state_dict[new_key] = state_dict.pop(key) for i in output_block_ids: block_id = i // (unet_config.layers_per_block + 1) layer_in_block_id = i % (unet_config.layers_per_block + 1) for key in output_blocks[i]: inner_block_id = int(key.split(delimiter)[block_slice_pos]) inner_block_key = inner_block_map[inner_block_id] inner_layers_in_block = str(layer_in_block_id) if inner_block_id < 2 else "0" new_key = delimiter.join( key.split(delimiter)[: block_slice_pos - 1] + [str(block_id), inner_block_key, inner_layers_in_block] + key.split(delimiter)[block_slice_pos + 1 :] ) new_state_dict[new_key] = state_dict.pop(key) if len(state_dict) > 0: raise ValueError("At this point all state dict entries have to be converted.") return new_state_dict def _convert_kohya_lora_to_diffusers(state_dict, unet_name="unet", text_encoder_name="text_encoder"): unet_state_dict = {} te_state_dict = {} te2_state_dict = {} network_alphas = {} is_unet_dora_lora = any("dora_scale" in k and "lora_unet_" in k for k in state_dict) is_te_dora_lora = any("dora_scale" in k and ("lora_te_" in k or "lora_te1_" in k) for k in state_dict) is_te2_dora_lora = any("dora_scale" in k and "lora_te2_" in k for k in state_dict) if is_unet_dora_lora or is_te_dora_lora or is_te2_dora_lora: if is_peft_version("<", "0.9.0"): raise ValueError( "You need `peft` 0.9.0 at least to use DoRA-enabled LoRAs. Please upgrade your installation of `peft`." ) # every down weight has a corresponding up weight and potentially an alpha weight lora_keys = [k for k in state_dict.keys() if k.endswith("lora_down.weight")] for key in lora_keys: lora_name = key.split(".")[0] lora_name_up = lora_name + ".lora_up.weight" lora_name_alpha = lora_name + ".alpha" if lora_name.startswith("lora_unet_"): diffusers_name = key.replace("lora_unet_", "").replace("_", ".") if "input.blocks" in diffusers_name: diffusers_name = diffusers_name.replace("input.blocks", "down_blocks") else: diffusers_name = diffusers_name.replace("down.blocks", "down_blocks") if "middle.block" in diffusers_name: diffusers_name = diffusers_name.replace("middle.block", "mid_block") else: diffusers_name = diffusers_name.replace("mid.block", "mid_block") if "output.blocks" in diffusers_name: diffusers_name = diffusers_name.replace("output.blocks", "up_blocks") else: diffusers_name = diffusers_name.replace("up.blocks", "up_blocks") diffusers_name = diffusers_name.replace("transformer.blocks", "transformer_blocks") diffusers_name = diffusers_name.replace("to.q.lora", "to_q_lora") diffusers_name = diffusers_name.replace("to.k.lora", "to_k_lora") diffusers_name = diffusers_name.replace("to.v.lora", "to_v_lora") diffusers_name = diffusers_name.replace("to.out.0.lora", "to_out_lora") diffusers_name = diffusers_name.replace("proj.in", "proj_in") diffusers_name = diffusers_name.replace("proj.out", "proj_out") diffusers_name = diffusers_name.replace("emb.layers", "time_emb_proj") # SDXL specificity. if "emb" in diffusers_name and "time.emb.proj" not in diffusers_name: pattern = r"\.\d+(?=\D*$)" diffusers_name = re.sub(pattern, "", diffusers_name, count=1) if ".in." in diffusers_name: diffusers_name = diffusers_name.replace("in.layers.2", "conv1") if ".out." in diffusers_name: diffusers_name = diffusers_name.replace("out.layers.3", "conv2") if "downsamplers" in diffusers_name or "upsamplers" in diffusers_name: diffusers_name = diffusers_name.replace("op", "conv") if "skip" in diffusers_name: diffusers_name = diffusers_name.replace("skip.connection", "conv_shortcut") # LyCORIS specificity. if "time.emb.proj" in diffusers_name: diffusers_name = diffusers_name.replace("time.emb.proj", "time_emb_proj") if "conv.shortcut" in diffusers_name: diffusers_name = diffusers_name.replace("conv.shortcut", "conv_shortcut") # General coverage. if "transformer_blocks" in diffusers_name: if "attn1" in diffusers_name or "attn2" in diffusers_name: diffusers_name = diffusers_name.replace("attn1", "attn1.processor") diffusers_name = diffusers_name.replace("attn2", "attn2.processor") unet_state_dict[diffusers_name] = state_dict.pop(key) unet_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) elif "ff" in diffusers_name: unet_state_dict[diffusers_name] = state_dict.pop(key) unet_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) elif any(key in diffusers_name for key in ("proj_in", "proj_out")): unet_state_dict[diffusers_name] = state_dict.pop(key) unet_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) else: unet_state_dict[diffusers_name] = state_dict.pop(key) unet_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) if is_unet_dora_lora: dora_scale_key_to_replace = "_lora.down." if "_lora.down." in diffusers_name else ".lora.down." unet_state_dict[ diffusers_name.replace(dora_scale_key_to_replace, ".lora_magnitude_vector.") ] = state_dict.pop(key.replace("lora_down.weight", "dora_scale")) elif lora_name.startswith(("lora_te_", "lora_te1_", "lora_te2_")): if lora_name.startswith(("lora_te_", "lora_te1_")): key_to_replace = "lora_te_" if lora_name.startswith("lora_te_") else "lora_te1_" else: key_to_replace = "lora_te2_" diffusers_name = key.replace(key_to_replace, "").replace("_", ".") diffusers_name = diffusers_name.replace("text.model", "text_model") diffusers_name = diffusers_name.replace("self.attn", "self_attn") diffusers_name = diffusers_name.replace("q.proj.lora", "to_q_lora") diffusers_name = diffusers_name.replace("k.proj.lora", "to_k_lora") diffusers_name = diffusers_name.replace("v.proj.lora", "to_v_lora") diffusers_name = diffusers_name.replace("out.proj.lora", "to_out_lora") if "self_attn" in diffusers_name: if lora_name.startswith(("lora_te_", "lora_te1_")): te_state_dict[diffusers_name] = state_dict.pop(key) te_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) else: te2_state_dict[diffusers_name] = state_dict.pop(key) te2_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) elif "mlp" in diffusers_name: # Be aware that this is the new diffusers convention and the rest of the code might # not utilize it yet. diffusers_name = diffusers_name.replace(".lora.", ".lora_linear_layer.") if lora_name.startswith(("lora_te_", "lora_te1_")): te_state_dict[diffusers_name] = state_dict.pop(key) te_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) else: te2_state_dict[diffusers_name] = state_dict.pop(key) te2_state_dict[diffusers_name.replace(".down.", ".up.")] = state_dict.pop(lora_name_up) if (is_te_dora_lora or is_te2_dora_lora) and lora_name.startswith(("lora_te_", "lora_te1_", "lora_te2_")): dora_scale_key_to_replace_te = ( "_lora.down." if "_lora.down." in diffusers_name else ".lora_linear_layer." ) if lora_name.startswith(("lora_te_", "lora_te1_")): te_state_dict[ diffusers_name.replace(dora_scale_key_to_replace_te, ".lora_magnitude_vector.") ] = state_dict.pop(key.replace("lora_down.weight", "dora_scale")) elif lora_name.startswith("lora_te2_"): te2_state_dict[ diffusers_name.replace(dora_scale_key_to_replace_te, ".lora_magnitude_vector.") ] = state_dict.pop(key.replace("lora_down.weight", "dora_scale")) # Rename the alphas so that they can be mapped appropriately. if lora_name_alpha in state_dict: alpha = state_dict.pop(lora_name_alpha).item() if lora_name_alpha.startswith("lora_unet_"): prefix = "unet." elif lora_name_alpha.startswith(("lora_te_", "lora_te1_")): prefix = "text_encoder." else: prefix = "text_encoder_2." new_name = prefix + diffusers_name.split(".lora.")[0] + ".alpha" network_alphas.update({new_name: alpha}) if len(state_dict) > 0: raise ValueError(f"The following keys have not been correctly be renamed: \n\n {', '.join(state_dict.keys())}") logger.info("Kohya-style checkpoint detected.") unet_state_dict = {f"{unet_name}.{module_name}": params for module_name, params in unet_state_dict.items()} te_state_dict = {f"{text_encoder_name}.{module_name}": params for module_name, params in te_state_dict.items()} te2_state_dict = ( {f"text_encoder_2.{module_name}": params for module_name, params in te2_state_dict.items()} if len(te2_state_dict) > 0 else None ) if te2_state_dict is not None: te_state_dict.update(te2_state_dict) new_state_dict = {**unet_state_dict, **te_state_dict} return new_state_dict, network_alphas
diffusers/src/diffusers/loaders/lora_conversion_utils.py/0
{ "file_path": "diffusers/src/diffusers/loaders/lora_conversion_utils.py", "repo_id": "diffusers", "token_count": 6889 }
123
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from typing import Optional, Tuple, Union import torch import torch.nn as nn from ...configuration_utils import ConfigMixin, register_to_config from ...utils.accelerate_utils import apply_forward_hook from ..modeling_outputs import AutoencoderKLOutput from ..modeling_utils import ModelMixin from .vae import DecoderOutput, DiagonalGaussianDistribution, Encoder, MaskConditionDecoder class AsymmetricAutoencoderKL(ModelMixin, ConfigMixin): r""" Designing a Better Asymmetric VQGAN for StableDiffusion https://arxiv.org/abs/2306.04632 . A VAE model with KL loss for encoding images into latents and decoding latent representations into images. This model inherits from [`ModelMixin`]. Check the superclass documentation for it's generic methods implemented for all models (such as downloading or saving). Parameters: in_channels (int, *optional*, defaults to 3): Number of channels in the input image. out_channels (int, *optional*, defaults to 3): Number of channels in the output. down_block_types (`Tuple[str]`, *optional*, defaults to `("DownEncoderBlock2D",)`): Tuple of downsample block types. down_block_out_channels (`Tuple[int]`, *optional*, defaults to `(64,)`): Tuple of down block output channels. layers_per_down_block (`int`, *optional*, defaults to `1`): Number layers for down block. up_block_types (`Tuple[str]`, *optional*, defaults to `("UpDecoderBlock2D",)`): Tuple of upsample block types. up_block_out_channels (`Tuple[int]`, *optional*, defaults to `(64,)`): Tuple of up block output channels. layers_per_up_block (`int`, *optional*, defaults to `1`): Number layers for up block. act_fn (`str`, *optional*, defaults to `"silu"`): The activation function to use. latent_channels (`int`, *optional*, defaults to 4): Number of channels in the latent space. sample_size (`int`, *optional*, defaults to `32`): Sample input size. norm_num_groups (`int`, *optional*, defaults to `32`): Number of groups to use for the first normalization layer in ResNet blocks. scaling_factor (`float`, *optional*, defaults to 0.18215): The component-wise standard deviation of the trained latent space computed using the first batch of the training set. This is used to scale the latent space to have unit variance when training the diffusion model. The latents are scaled with the formula `z = z * scaling_factor` before being passed to the diffusion model. When decoding, the latents are scaled back to the original scale with the formula: `z = 1 / scaling_factor * z`. For more details, refer to sections 4.3.2 and D.1 of the [High-Resolution Image Synthesis with Latent Diffusion Models](https://arxiv.org/abs/2112.10752) paper. """ @register_to_config def __init__( self, in_channels: int = 3, out_channels: int = 3, down_block_types: Tuple[str, ...] = ("DownEncoderBlock2D",), down_block_out_channels: Tuple[int, ...] = (64,), layers_per_down_block: int = 1, up_block_types: Tuple[str, ...] = ("UpDecoderBlock2D",), up_block_out_channels: Tuple[int, ...] = (64,), layers_per_up_block: int = 1, act_fn: str = "silu", latent_channels: int = 4, norm_num_groups: int = 32, sample_size: int = 32, scaling_factor: float = 0.18215, ) -> None: super().__init__() # pass init params to Encoder self.encoder = Encoder( in_channels=in_channels, out_channels=latent_channels, down_block_types=down_block_types, block_out_channels=down_block_out_channels, layers_per_block=layers_per_down_block, act_fn=act_fn, norm_num_groups=norm_num_groups, double_z=True, ) # pass init params to Decoder self.decoder = MaskConditionDecoder( in_channels=latent_channels, out_channels=out_channels, up_block_types=up_block_types, block_out_channels=up_block_out_channels, layers_per_block=layers_per_up_block, act_fn=act_fn, norm_num_groups=norm_num_groups, ) self.quant_conv = nn.Conv2d(2 * latent_channels, 2 * latent_channels, 1) self.post_quant_conv = nn.Conv2d(latent_channels, latent_channels, 1) self.use_slicing = False self.use_tiling = False self.register_to_config(block_out_channels=up_block_out_channels) self.register_to_config(force_upcast=False) @apply_forward_hook def encode( self, x: torch.FloatTensor, return_dict: bool = True ) -> Union[AutoencoderKLOutput, Tuple[torch.FloatTensor]]: h = self.encoder(x) moments = self.quant_conv(h) posterior = DiagonalGaussianDistribution(moments) if not return_dict: return (posterior,) return AutoencoderKLOutput(latent_dist=posterior) def _decode( self, z: torch.FloatTensor, image: Optional[torch.FloatTensor] = None, mask: Optional[torch.FloatTensor] = None, return_dict: bool = True, ) -> Union[DecoderOutput, Tuple[torch.FloatTensor]]: z = self.post_quant_conv(z) dec = self.decoder(z, image, mask) if not return_dict: return (dec,) return DecoderOutput(sample=dec) @apply_forward_hook def decode( self, z: torch.FloatTensor, generator: Optional[torch.Generator] = None, image: Optional[torch.FloatTensor] = None, mask: Optional[torch.FloatTensor] = None, return_dict: bool = True, ) -> Union[DecoderOutput, Tuple[torch.FloatTensor]]: decoded = self._decode(z, image, mask).sample if not return_dict: return (decoded,) return DecoderOutput(sample=decoded) def forward( self, sample: torch.FloatTensor, mask: Optional[torch.FloatTensor] = None, sample_posterior: bool = False, return_dict: bool = True, generator: Optional[torch.Generator] = None, ) -> Union[DecoderOutput, Tuple[torch.FloatTensor]]: r""" Args: sample (`torch.FloatTensor`): Input sample. mask (`torch.FloatTensor`, *optional*, defaults to `None`): Optional inpainting mask. sample_posterior (`bool`, *optional*, defaults to `False`): Whether to sample from the posterior. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`DecoderOutput`] instead of a plain tuple. """ x = sample posterior = self.encode(x).latent_dist if sample_posterior: z = posterior.sample(generator=generator) else: z = posterior.mode() dec = self.decode(z, sample, mask).sample if not return_dict: return (dec,) return DecoderOutput(sample=dec)
diffusers/src/diffusers/models/autoencoders/autoencoder_asym_kl.py/0
{ "file_path": "diffusers/src/diffusers/models/autoencoders/autoencoder_asym_kl.py", "repo_id": "diffusers", "token_count": 3208 }
124
# coding=utf-8 # Copyright 2024 The HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """PyTorch - Flax general utilities.""" from pickle import UnpicklingError import jax import jax.numpy as jnp import numpy as np from flax.serialization import from_bytes from flax.traverse_util import flatten_dict from ..utils import logging logger = logging.get_logger(__name__) ##################### # Flax => PyTorch # ##################### # from https://github.com/huggingface/transformers/blob/main/src/transformers/modeling_flax_pytorch_utils.py#L224-L352 def load_flax_checkpoint_in_pytorch_model(pt_model, model_file): try: with open(model_file, "rb") as flax_state_f: flax_state = from_bytes(None, flax_state_f.read()) except UnpicklingError as e: try: with open(model_file) as f: if f.read().startswith("version"): raise OSError( "You seem to have cloned a repository without having git-lfs installed. Please" " install git-lfs and run `git lfs install` followed by `git lfs pull` in the" " folder you cloned." ) else: raise ValueError from e except (UnicodeDecodeError, ValueError): raise EnvironmentError(f"Unable to convert {model_file} to Flax deserializable object. ") return load_flax_weights_in_pytorch_model(pt_model, flax_state) def load_flax_weights_in_pytorch_model(pt_model, flax_state): """Load flax checkpoints in a PyTorch model""" try: import torch # noqa: F401 except ImportError: logger.error( "Loading Flax weights in PyTorch requires both PyTorch and Flax to be installed. Please see" " https://pytorch.org/ and https://flax.readthedocs.io/en/latest/installation.html for installation" " instructions." ) raise # check if we have bf16 weights is_type_bf16 = flatten_dict(jax.tree_util.tree_map(lambda x: x.dtype == jnp.bfloat16, flax_state)).values() if any(is_type_bf16): # convert all weights to fp32 if they are bf16 since torch.from_numpy can-not handle bf16 # and bf16 is not fully supported in PT yet. logger.warning( "Found ``bfloat16`` weights in Flax model. Casting all ``bfloat16`` weights to ``float32`` " "before loading those in PyTorch model." ) flax_state = jax.tree_util.tree_map( lambda params: params.astype(np.float32) if params.dtype == jnp.bfloat16 else params, flax_state ) pt_model.base_model_prefix = "" flax_state_dict = flatten_dict(flax_state, sep=".") pt_model_dict = pt_model.state_dict() # keep track of unexpected & missing keys unexpected_keys = [] missing_keys = set(pt_model_dict.keys()) for flax_key_tuple, flax_tensor in flax_state_dict.items(): flax_key_tuple_array = flax_key_tuple.split(".") if flax_key_tuple_array[-1] == "kernel" and flax_tensor.ndim == 4: flax_key_tuple_array = flax_key_tuple_array[:-1] + ["weight"] flax_tensor = jnp.transpose(flax_tensor, (3, 2, 0, 1)) elif flax_key_tuple_array[-1] == "kernel": flax_key_tuple_array = flax_key_tuple_array[:-1] + ["weight"] flax_tensor = flax_tensor.T elif flax_key_tuple_array[-1] == "scale": flax_key_tuple_array = flax_key_tuple_array[:-1] + ["weight"] if "time_embedding" not in flax_key_tuple_array: for i, flax_key_tuple_string in enumerate(flax_key_tuple_array): flax_key_tuple_array[i] = ( flax_key_tuple_string.replace("_0", ".0") .replace("_1", ".1") .replace("_2", ".2") .replace("_3", ".3") .replace("_4", ".4") .replace("_5", ".5") .replace("_6", ".6") .replace("_7", ".7") .replace("_8", ".8") .replace("_9", ".9") ) flax_key = ".".join(flax_key_tuple_array) if flax_key in pt_model_dict: if flax_tensor.shape != pt_model_dict[flax_key].shape: raise ValueError( f"Flax checkpoint seems to be incorrect. Weight {flax_key_tuple} was expected " f"to be of shape {pt_model_dict[flax_key].shape}, but is {flax_tensor.shape}." ) else: # add weight to pytorch dict flax_tensor = np.asarray(flax_tensor) if not isinstance(flax_tensor, np.ndarray) else flax_tensor pt_model_dict[flax_key] = torch.from_numpy(flax_tensor) # remove from missing keys missing_keys.remove(flax_key) else: # weight is not expected by PyTorch model unexpected_keys.append(flax_key) pt_model.load_state_dict(pt_model_dict) # re-transform missing_keys to list missing_keys = list(missing_keys) if len(unexpected_keys) > 0: logger.warning( "Some weights of the Flax model were not used when initializing the PyTorch model" f" {pt_model.__class__.__name__}: {unexpected_keys}\n- This IS expected if you are initializing" f" {pt_model.__class__.__name__} from a Flax model trained on another task or with another architecture" " (e.g. initializing a BertForSequenceClassification model from a FlaxBertForPreTraining model).\n- This" f" IS NOT expected if you are initializing {pt_model.__class__.__name__} from a Flax model that you expect" " to be exactly identical (e.g. initializing a BertForSequenceClassification model from a" " FlaxBertForSequenceClassification model)." ) if len(missing_keys) > 0: logger.warning( f"Some weights of {pt_model.__class__.__name__} were not initialized from the Flax model and are newly" f" initialized: {missing_keys}\nYou should probably TRAIN this model on a down-stream task to be able to" " use it for predictions and inference." ) return pt_model
diffusers/src/diffusers/models/modeling_pytorch_flax_utils.py/0
{ "file_path": "diffusers/src/diffusers/models/modeling_pytorch_flax_utils.py", "repo_id": "diffusers", "token_count": 3050 }
125
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from ..utils import deprecate from .unets.unet_1d_blocks import ( AttnDownBlock1D, AttnUpBlock1D, DownBlock1D, DownBlock1DNoSkip, DownResnetBlock1D, Downsample1d, MidResTemporalBlock1D, OutConv1DBlock, OutValueFunctionBlock, ResConvBlock, SelfAttention1d, UNetMidBlock1D, UpBlock1D, UpBlock1DNoSkip, UpResnetBlock1D, Upsample1d, ValueFunctionMidBlock1D, ) class DownResnetBlock1D(DownResnetBlock1D): deprecation_message = "Importing `DownResnetBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import DownResnetBlock1D`, instead." deprecate("DownResnetBlock1D", "0.29", deprecation_message) class UpResnetBlock1D(UpResnetBlock1D): deprecation_message = "Importing `UpResnetBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import UpResnetBlock1D`, instead." deprecate("UpResnetBlock1D", "0.29", deprecation_message) class ValueFunctionMidBlock1D(ValueFunctionMidBlock1D): deprecation_message = "Importing `ValueFunctionMidBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import ValueFunctionMidBlock1D`, instead." deprecate("ValueFunctionMidBlock1D", "0.29", deprecation_message) class OutConv1DBlock(OutConv1DBlock): deprecation_message = "Importing `OutConv1DBlock` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import OutConv1DBlock`, instead." deprecate("OutConv1DBlock", "0.29", deprecation_message) class OutValueFunctionBlock(OutValueFunctionBlock): deprecation_message = "Importing `OutValueFunctionBlock` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import OutValueFunctionBlock`, instead." deprecate("OutValueFunctionBlock", "0.29", deprecation_message) class Downsample1d(Downsample1d): deprecation_message = "Importing `Downsample1d` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import Downsample1d`, instead." deprecate("Downsample1d", "0.29", deprecation_message) class Upsample1d(Upsample1d): deprecation_message = "Importing `Upsample1d` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import Upsample1d`, instead." deprecate("Upsample1d", "0.29", deprecation_message) class SelfAttention1d(SelfAttention1d): deprecation_message = "Importing `SelfAttention1d` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import SelfAttention1d`, instead." deprecate("SelfAttention1d", "0.29", deprecation_message) class ResConvBlock(ResConvBlock): deprecation_message = "Importing `ResConvBlock` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import ResConvBlock`, instead." deprecate("ResConvBlock", "0.29", deprecation_message) class UNetMidBlock1D(UNetMidBlock1D): deprecation_message = "Importing `UNetMidBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import UNetMidBlock1D`, instead." deprecate("UNetMidBlock1D", "0.29", deprecation_message) class AttnDownBlock1D(AttnDownBlock1D): deprecation_message = "Importing `AttnDownBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import AttnDownBlock1D`, instead." deprecate("AttnDownBlock1D", "0.29", deprecation_message) class DownBlock1D(DownBlock1D): deprecation_message = "Importing `DownBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import DownBlock1D`, instead." deprecate("DownBlock1D", "0.29", deprecation_message) class DownBlock1DNoSkip(DownBlock1DNoSkip): deprecation_message = "Importing `DownBlock1DNoSkip` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import DownBlock1DNoSkip`, instead." deprecate("DownBlock1DNoSkip", "0.29", deprecation_message) class AttnUpBlock1D(AttnUpBlock1D): deprecation_message = "Importing `AttnUpBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import AttnUpBlock1D`, instead." deprecate("AttnUpBlock1D", "0.29", deprecation_message) class UpBlock1D(UpBlock1D): deprecation_message = "Importing `UpBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import UpBlock1D`, instead." deprecate("UpBlock1D", "0.29", deprecation_message) class UpBlock1DNoSkip(UpBlock1DNoSkip): deprecation_message = "Importing `UpBlock1DNoSkip` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import UpBlock1DNoSkip`, instead." deprecate("UpBlock1DNoSkip", "0.29", deprecation_message) class MidResTemporalBlock1D(MidResTemporalBlock1D): deprecation_message = "Importing `MidResTemporalBlock1D` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import MidResTemporalBlock1D`, instead." deprecate("MidResTemporalBlock1D", "0.29", deprecation_message) def get_down_block( down_block_type: str, num_layers: int, in_channels: int, out_channels: int, temb_channels: int, add_downsample: bool, ): deprecation_message = "Importing `get_down_block` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import get_down_block`, instead." deprecate("get_down_block", "0.29", deprecation_message) from .unets.unet_1d_blocks import get_down_block return get_down_block( down_block_type=down_block_type, num_layers=num_layers, in_channels=in_channels, out_channels=out_channels, temb_channels=temb_channels, add_downsample=add_downsample, ) def get_up_block( up_block_type: str, num_layers: int, in_channels: int, out_channels: int, temb_channels: int, add_upsample: bool ): deprecation_message = "Importing `get_up_block` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import get_up_block`, instead." deprecate("get_up_block", "0.29", deprecation_message) from .unets.unet_1d_blocks import get_up_block return get_up_block( up_block_type=up_block_type, num_layers=num_layers, in_channels=in_channels, out_channels=out_channels, temb_channels=temb_channels, add_upsample=add_upsample, ) def get_mid_block( mid_block_type: str, num_layers: int, in_channels: int, mid_channels: int, out_channels: int, embed_dim: int, add_downsample: bool, ): deprecation_message = "Importing `get_mid_block` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import get_mid_block`, instead." deprecate("get_mid_block", "0.29", deprecation_message) from .unets.unet_1d_blocks import get_mid_block return get_mid_block( mid_block_type=mid_block_type, num_layers=num_layers, in_channels=in_channels, mid_channels=mid_channels, out_channels=out_channels, embed_dim=embed_dim, add_downsample=add_downsample, ) def get_out_block( *, out_block_type: str, num_groups_out: int, embed_dim: int, out_channels: int, act_fn: str, fc_dim: int ): deprecation_message = "Importing `get_out_block` from `diffusers.models.unet_1d_blocks` is deprecated and this will be removed in a future version. Please use `from diffusers.models.unets.unet_1d_blocks import get_out_block`, instead." deprecate("get_out_block", "0.29", deprecation_message) from .unets.unet_1d_blocks import get_out_block return get_out_block( out_block_type=out_block_type, num_groups_out=num_groups_out, embed_dim=embed_dim, out_channels=out_channels, act_fn=act_fn, fc_dim=fc_dim, )
diffusers/src/diffusers/models/unet_1d_blocks.py/0
{ "file_path": "diffusers/src/diffusers/models/unet_1d_blocks.py", "repo_id": "diffusers", "token_count": 3632 }
126
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from typing import Any, Dict, Optional, Tuple, Union import torch import torch.nn as nn import torch.utils.checkpoint from ...configuration_utils import ConfigMixin, FrozenDict, register_to_config from ...loaders import UNet2DConditionLoadersMixin from ...utils import logging from ..attention_processor import ( ADDED_KV_ATTENTION_PROCESSORS, CROSS_ATTENTION_PROCESSORS, Attention, AttentionProcessor, AttnAddedKVProcessor, AttnProcessor, ) from ..embeddings import TimestepEmbedding, Timesteps from ..modeling_utils import ModelMixin from ..transformers.transformer_temporal import TransformerTemporalModel from .unet_2d_blocks import UNetMidBlock2DCrossAttn from .unet_2d_condition import UNet2DConditionModel from .unet_3d_blocks import ( CrossAttnDownBlockMotion, CrossAttnUpBlockMotion, DownBlockMotion, UNetMidBlockCrossAttnMotion, UpBlockMotion, get_down_block, get_up_block, ) from .unet_3d_condition import UNet3DConditionOutput logger = logging.get_logger(__name__) # pylint: disable=invalid-name class MotionModules(nn.Module): def __init__( self, in_channels: int, layers_per_block: int = 2, num_attention_heads: int = 8, attention_bias: bool = False, cross_attention_dim: Optional[int] = None, activation_fn: str = "geglu", norm_num_groups: int = 32, max_seq_length: int = 32, ): super().__init__() self.motion_modules = nn.ModuleList([]) for i in range(layers_per_block): self.motion_modules.append( TransformerTemporalModel( in_channels=in_channels, norm_num_groups=norm_num_groups, cross_attention_dim=cross_attention_dim, activation_fn=activation_fn, attention_bias=attention_bias, num_attention_heads=num_attention_heads, attention_head_dim=in_channels // num_attention_heads, positional_embeddings="sinusoidal", num_positional_embeddings=max_seq_length, ) ) class MotionAdapter(ModelMixin, ConfigMixin): @register_to_config def __init__( self, block_out_channels: Tuple[int, ...] = (320, 640, 1280, 1280), motion_layers_per_block: int = 2, motion_mid_block_layers_per_block: int = 1, motion_num_attention_heads: int = 8, motion_norm_num_groups: int = 32, motion_max_seq_length: int = 32, use_motion_mid_block: bool = True, conv_in_channels: Optional[int] = None, ): """Container to store AnimateDiff Motion Modules Args: block_out_channels (`Tuple[int]`, *optional*, defaults to `(320, 640, 1280, 1280)`): The tuple of output channels for each UNet block. motion_layers_per_block (`int`, *optional*, defaults to 2): The number of motion layers per UNet block. motion_mid_block_layers_per_block (`int`, *optional*, defaults to 1): The number of motion layers in the middle UNet block. motion_num_attention_heads (`int`, *optional*, defaults to 8): The number of heads to use in each attention layer of the motion module. motion_norm_num_groups (`int`, *optional*, defaults to 32): The number of groups to use in each group normalization layer of the motion module. motion_max_seq_length (`int`, *optional*, defaults to 32): The maximum sequence length to use in the motion module. use_motion_mid_block (`bool`, *optional*, defaults to True): Whether to use a motion module in the middle of the UNet. """ super().__init__() down_blocks = [] up_blocks = [] if conv_in_channels: # input self.conv_in = nn.Conv2d(conv_in_channels, block_out_channels[0], kernel_size=3, padding=1) else: self.conv_in = None for i, channel in enumerate(block_out_channels): output_channel = block_out_channels[i] down_blocks.append( MotionModules( in_channels=output_channel, norm_num_groups=motion_norm_num_groups, cross_attention_dim=None, activation_fn="geglu", attention_bias=False, num_attention_heads=motion_num_attention_heads, max_seq_length=motion_max_seq_length, layers_per_block=motion_layers_per_block, ) ) if use_motion_mid_block: self.mid_block = MotionModules( in_channels=block_out_channels[-1], norm_num_groups=motion_norm_num_groups, cross_attention_dim=None, activation_fn="geglu", attention_bias=False, num_attention_heads=motion_num_attention_heads, layers_per_block=motion_mid_block_layers_per_block, max_seq_length=motion_max_seq_length, ) else: self.mid_block = None reversed_block_out_channels = list(reversed(block_out_channels)) output_channel = reversed_block_out_channels[0] for i, channel in enumerate(reversed_block_out_channels): output_channel = reversed_block_out_channels[i] up_blocks.append( MotionModules( in_channels=output_channel, norm_num_groups=motion_norm_num_groups, cross_attention_dim=None, activation_fn="geglu", attention_bias=False, num_attention_heads=motion_num_attention_heads, max_seq_length=motion_max_seq_length, layers_per_block=motion_layers_per_block + 1, ) ) self.down_blocks = nn.ModuleList(down_blocks) self.up_blocks = nn.ModuleList(up_blocks) def forward(self, sample): pass class UNetMotionModel(ModelMixin, ConfigMixin, UNet2DConditionLoadersMixin): r""" A modified conditional 2D UNet model that takes a noisy sample, conditional state, and a timestep and returns a sample shaped output. This model inherits from [`ModelMixin`]. Check the superclass documentation for it's generic methods implemented for all models (such as downloading or saving). """ _supports_gradient_checkpointing = True @register_to_config def __init__( self, sample_size: Optional[int] = None, in_channels: int = 4, out_channels: int = 4, down_block_types: Tuple[str, ...] = ( "CrossAttnDownBlockMotion", "CrossAttnDownBlockMotion", "CrossAttnDownBlockMotion", "DownBlockMotion", ), up_block_types: Tuple[str, ...] = ( "UpBlockMotion", "CrossAttnUpBlockMotion", "CrossAttnUpBlockMotion", "CrossAttnUpBlockMotion", ), block_out_channels: Tuple[int, ...] = (320, 640, 1280, 1280), layers_per_block: int = 2, downsample_padding: int = 1, mid_block_scale_factor: float = 1, act_fn: str = "silu", norm_num_groups: int = 32, norm_eps: float = 1e-5, cross_attention_dim: int = 1280, use_linear_projection: bool = False, num_attention_heads: Union[int, Tuple[int, ...]] = 8, motion_max_seq_length: int = 32, motion_num_attention_heads: int = 8, use_motion_mid_block: int = True, encoder_hid_dim: Optional[int] = None, encoder_hid_dim_type: Optional[str] = None, time_cond_proj_dim: Optional[int] = None, ): super().__init__() self.sample_size = sample_size # Check inputs if len(down_block_types) != len(up_block_types): raise ValueError( f"Must provide the same number of `down_block_types` as `up_block_types`. `down_block_types`: {down_block_types}. `up_block_types`: {up_block_types}." ) if len(block_out_channels) != len(down_block_types): raise ValueError( f"Must provide the same number of `block_out_channels` as `down_block_types`. `block_out_channels`: {block_out_channels}. `down_block_types`: {down_block_types}." ) if not isinstance(num_attention_heads, int) and len(num_attention_heads) != len(down_block_types): raise ValueError( f"Must provide the same number of `num_attention_heads` as `down_block_types`. `num_attention_heads`: {num_attention_heads}. `down_block_types`: {down_block_types}." ) # input conv_in_kernel = 3 conv_out_kernel = 3 conv_in_padding = (conv_in_kernel - 1) // 2 self.conv_in = nn.Conv2d( in_channels, block_out_channels[0], kernel_size=conv_in_kernel, padding=conv_in_padding ) # time time_embed_dim = block_out_channels[0] * 4 self.time_proj = Timesteps(block_out_channels[0], True, 0) timestep_input_dim = block_out_channels[0] self.time_embedding = TimestepEmbedding( timestep_input_dim, time_embed_dim, act_fn=act_fn, cond_proj_dim=time_cond_proj_dim ) if encoder_hid_dim_type is None: self.encoder_hid_proj = None # class embedding self.down_blocks = nn.ModuleList([]) self.up_blocks = nn.ModuleList([]) if isinstance(num_attention_heads, int): num_attention_heads = (num_attention_heads,) * len(down_block_types) # down output_channel = block_out_channels[0] for i, down_block_type in enumerate(down_block_types): input_channel = output_channel output_channel = block_out_channels[i] is_final_block = i == len(block_out_channels) - 1 down_block = get_down_block( down_block_type, num_layers=layers_per_block, in_channels=input_channel, out_channels=output_channel, temb_channels=time_embed_dim, add_downsample=not is_final_block, resnet_eps=norm_eps, resnet_act_fn=act_fn, resnet_groups=norm_num_groups, cross_attention_dim=cross_attention_dim, num_attention_heads=num_attention_heads[i], downsample_padding=downsample_padding, use_linear_projection=use_linear_projection, dual_cross_attention=False, temporal_num_attention_heads=motion_num_attention_heads, temporal_max_seq_length=motion_max_seq_length, ) self.down_blocks.append(down_block) # mid if use_motion_mid_block: self.mid_block = UNetMidBlockCrossAttnMotion( in_channels=block_out_channels[-1], temb_channels=time_embed_dim, resnet_eps=norm_eps, resnet_act_fn=act_fn, output_scale_factor=mid_block_scale_factor, cross_attention_dim=cross_attention_dim, num_attention_heads=num_attention_heads[-1], resnet_groups=norm_num_groups, dual_cross_attention=False, use_linear_projection=use_linear_projection, temporal_num_attention_heads=motion_num_attention_heads, temporal_max_seq_length=motion_max_seq_length, ) else: self.mid_block = UNetMidBlock2DCrossAttn( in_channels=block_out_channels[-1], temb_channels=time_embed_dim, resnet_eps=norm_eps, resnet_act_fn=act_fn, output_scale_factor=mid_block_scale_factor, cross_attention_dim=cross_attention_dim, num_attention_heads=num_attention_heads[-1], resnet_groups=norm_num_groups, dual_cross_attention=False, use_linear_projection=use_linear_projection, ) # count how many layers upsample the images self.num_upsamplers = 0 # up reversed_block_out_channels = list(reversed(block_out_channels)) reversed_num_attention_heads = list(reversed(num_attention_heads)) output_channel = reversed_block_out_channels[0] for i, up_block_type in enumerate(up_block_types): is_final_block = i == len(block_out_channels) - 1 prev_output_channel = output_channel output_channel = reversed_block_out_channels[i] input_channel = reversed_block_out_channels[min(i + 1, len(block_out_channels) - 1)] # add upsample block for all BUT final layer if not is_final_block: add_upsample = True self.num_upsamplers += 1 else: add_upsample = False up_block = get_up_block( up_block_type, num_layers=layers_per_block + 1, in_channels=input_channel, out_channels=output_channel, prev_output_channel=prev_output_channel, temb_channels=time_embed_dim, add_upsample=add_upsample, resnet_eps=norm_eps, resnet_act_fn=act_fn, resnet_groups=norm_num_groups, cross_attention_dim=cross_attention_dim, num_attention_heads=reversed_num_attention_heads[i], dual_cross_attention=False, resolution_idx=i, use_linear_projection=use_linear_projection, temporal_num_attention_heads=motion_num_attention_heads, temporal_max_seq_length=motion_max_seq_length, ) self.up_blocks.append(up_block) prev_output_channel = output_channel # out if norm_num_groups is not None: self.conv_norm_out = nn.GroupNorm( num_channels=block_out_channels[0], num_groups=norm_num_groups, eps=norm_eps ) self.conv_act = nn.SiLU() else: self.conv_norm_out = None self.conv_act = None conv_out_padding = (conv_out_kernel - 1) // 2 self.conv_out = nn.Conv2d( block_out_channels[0], out_channels, kernel_size=conv_out_kernel, padding=conv_out_padding ) @classmethod def from_unet2d( cls, unet: UNet2DConditionModel, motion_adapter: Optional[MotionAdapter] = None, load_weights: bool = True, ): has_motion_adapter = motion_adapter is not None if has_motion_adapter: motion_adapter.to(device=unet.device) # based on https://github.com/guoyww/AnimateDiff/blob/895f3220c06318ea0760131ec70408b466c49333/animatediff/models/unet.py#L459 config = dict(unet.config) config["_class_name"] = cls.__name__ down_blocks = [] for down_blocks_type in config["down_block_types"]: if "CrossAttn" in down_blocks_type: down_blocks.append("CrossAttnDownBlockMotion") else: down_blocks.append("DownBlockMotion") config["down_block_types"] = down_blocks up_blocks = [] for down_blocks_type in config["up_block_types"]: if "CrossAttn" in down_blocks_type: up_blocks.append("CrossAttnUpBlockMotion") else: up_blocks.append("UpBlockMotion") config["up_block_types"] = up_blocks if has_motion_adapter: config["motion_num_attention_heads"] = motion_adapter.config["motion_num_attention_heads"] config["motion_max_seq_length"] = motion_adapter.config["motion_max_seq_length"] config["use_motion_mid_block"] = motion_adapter.config["use_motion_mid_block"] # For PIA UNets we need to set the number input channels to 9 if motion_adapter.config["conv_in_channels"]: config["in_channels"] = motion_adapter.config["conv_in_channels"] # Need this for backwards compatibility with UNet2DConditionModel checkpoints if not config.get("num_attention_heads"): config["num_attention_heads"] = config["attention_head_dim"] config = FrozenDict(config) model = cls.from_config(config) if not load_weights: return model # Logic for loading PIA UNets which allow the first 4 channels to be any UNet2DConditionModel conv_in weight # while the last 5 channels must be PIA conv_in weights. if has_motion_adapter and motion_adapter.config["conv_in_channels"]: model.conv_in = motion_adapter.conv_in updated_conv_in_weight = torch.cat( [unet.conv_in.weight, motion_adapter.conv_in.weight[:, 4:, :, :]], dim=1 ) model.conv_in.load_state_dict({"weight": updated_conv_in_weight, "bias": unet.conv_in.bias}) else: model.conv_in.load_state_dict(unet.conv_in.state_dict()) model.time_proj.load_state_dict(unet.time_proj.state_dict()) model.time_embedding.load_state_dict(unet.time_embedding.state_dict()) for i, down_block in enumerate(unet.down_blocks): model.down_blocks[i].resnets.load_state_dict(down_block.resnets.state_dict()) if hasattr(model.down_blocks[i], "attentions"): model.down_blocks[i].attentions.load_state_dict(down_block.attentions.state_dict()) if model.down_blocks[i].downsamplers: model.down_blocks[i].downsamplers.load_state_dict(down_block.downsamplers.state_dict()) for i, up_block in enumerate(unet.up_blocks): model.up_blocks[i].resnets.load_state_dict(up_block.resnets.state_dict()) if hasattr(model.up_blocks[i], "attentions"): model.up_blocks[i].attentions.load_state_dict(up_block.attentions.state_dict()) if model.up_blocks[i].upsamplers: model.up_blocks[i].upsamplers.load_state_dict(up_block.upsamplers.state_dict()) model.mid_block.resnets.load_state_dict(unet.mid_block.resnets.state_dict()) model.mid_block.attentions.load_state_dict(unet.mid_block.attentions.state_dict()) if unet.conv_norm_out is not None: model.conv_norm_out.load_state_dict(unet.conv_norm_out.state_dict()) if unet.conv_act is not None: model.conv_act.load_state_dict(unet.conv_act.state_dict()) model.conv_out.load_state_dict(unet.conv_out.state_dict()) if has_motion_adapter: model.load_motion_modules(motion_adapter) # ensure that the Motion UNet is the same dtype as the UNet2DConditionModel model.to(unet.dtype) return model def freeze_unet2d_params(self) -> None: """Freeze the weights of just the UNet2DConditionModel, and leave the motion modules unfrozen for fine tuning. """ # Freeze everything for param in self.parameters(): param.requires_grad = False # Unfreeze Motion Modules for down_block in self.down_blocks: motion_modules = down_block.motion_modules for param in motion_modules.parameters(): param.requires_grad = True for up_block in self.up_blocks: motion_modules = up_block.motion_modules for param in motion_modules.parameters(): param.requires_grad = True if hasattr(self.mid_block, "motion_modules"): motion_modules = self.mid_block.motion_modules for param in motion_modules.parameters(): param.requires_grad = True def load_motion_modules(self, motion_adapter: Optional[MotionAdapter]) -> None: for i, down_block in enumerate(motion_adapter.down_blocks): self.down_blocks[i].motion_modules.load_state_dict(down_block.motion_modules.state_dict()) for i, up_block in enumerate(motion_adapter.up_blocks): self.up_blocks[i].motion_modules.load_state_dict(up_block.motion_modules.state_dict()) # to support older motion modules that don't have a mid_block if hasattr(self.mid_block, "motion_modules"): self.mid_block.motion_modules.load_state_dict(motion_adapter.mid_block.motion_modules.state_dict()) def save_motion_modules( self, save_directory: str, is_main_process: bool = True, safe_serialization: bool = True, variant: Optional[str] = None, push_to_hub: bool = False, **kwargs, ) -> None: state_dict = self.state_dict() # Extract all motion modules motion_state_dict = {} for k, v in state_dict.items(): if "motion_modules" in k: motion_state_dict[k] = v adapter = MotionAdapter( block_out_channels=self.config["block_out_channels"], motion_layers_per_block=self.config["layers_per_block"], motion_norm_num_groups=self.config["norm_num_groups"], motion_num_attention_heads=self.config["motion_num_attention_heads"], motion_max_seq_length=self.config["motion_max_seq_length"], use_motion_mid_block=self.config["use_motion_mid_block"], ) adapter.load_state_dict(motion_state_dict) adapter.save_pretrained( save_directory=save_directory, is_main_process=is_main_process, safe_serialization=safe_serialization, variant=variant, push_to_hub=push_to_hub, **kwargs, ) @property # Copied from diffusers.models.unets.unet_2d_condition.UNet2DConditionModel.attn_processors def attn_processors(self) -> Dict[str, AttentionProcessor]: r""" Returns: `dict` of attention processors: A dictionary containing all attention processors used in the model with indexed by its weight name. """ # set recursively processors = {} def fn_recursive_add_processors(name: str, module: torch.nn.Module, processors: Dict[str, AttentionProcessor]): if hasattr(module, "get_processor"): processors[f"{name}.processor"] = module.get_processor(return_deprecated_lora=True) for sub_name, child in module.named_children(): fn_recursive_add_processors(f"{name}.{sub_name}", child, processors) return processors for name, module in self.named_children(): fn_recursive_add_processors(name, module, processors) return processors # Copied from diffusers.models.unets.unet_2d_condition.UNet2DConditionModel.set_attn_processor def set_attn_processor(self, processor: Union[AttentionProcessor, Dict[str, AttentionProcessor]]): r""" Sets the attention processor to use to compute attention. Parameters: processor (`dict` of `AttentionProcessor` or only `AttentionProcessor`): The instantiated processor class or a dictionary of processor classes that will be set as the processor for **all** `Attention` layers. If `processor` is a dict, the key needs to define the path to the corresponding cross attention processor. This is strongly recommended when setting trainable attention processors. """ count = len(self.attn_processors.keys()) if isinstance(processor, dict) and len(processor) != count: raise ValueError( f"A dict of processors was passed, but the number of processors {len(processor)} does not match the" f" number of attention layers: {count}. Please make sure to pass {count} processor classes." ) def fn_recursive_attn_processor(name: str, module: torch.nn.Module, processor): if hasattr(module, "set_processor"): if not isinstance(processor, dict): module.set_processor(processor) else: module.set_processor(processor.pop(f"{name}.processor")) for sub_name, child in module.named_children(): fn_recursive_attn_processor(f"{name}.{sub_name}", child, processor) for name, module in self.named_children(): fn_recursive_attn_processor(name, module, processor) # Copied from diffusers.models.unets.unet_3d_condition.UNet3DConditionModel.enable_forward_chunking def enable_forward_chunking(self, chunk_size: Optional[int] = None, dim: int = 0) -> None: """ Sets the attention processor to use [feed forward chunking](https://huggingface.co/blog/reformer#2-chunked-feed-forward-layers). Parameters: chunk_size (`int`, *optional*): The chunk size of the feed-forward layers. If not specified, will run feed-forward layer individually over each tensor of dim=`dim`. dim (`int`, *optional*, defaults to `0`): The dimension over which the feed-forward computation should be chunked. Choose between dim=0 (batch) or dim=1 (sequence length). """ if dim not in [0, 1]: raise ValueError(f"Make sure to set `dim` to either 0 or 1, not {dim}") # By default chunk size is 1 chunk_size = chunk_size or 1 def fn_recursive_feed_forward(module: torch.nn.Module, chunk_size: int, dim: int): if hasattr(module, "set_chunk_feed_forward"): module.set_chunk_feed_forward(chunk_size=chunk_size, dim=dim) for child in module.children(): fn_recursive_feed_forward(child, chunk_size, dim) for module in self.children(): fn_recursive_feed_forward(module, chunk_size, dim) # Copied from diffusers.models.unets.unet_3d_condition.UNet3DConditionModel.disable_forward_chunking def disable_forward_chunking(self) -> None: def fn_recursive_feed_forward(module: torch.nn.Module, chunk_size: int, dim: int): if hasattr(module, "set_chunk_feed_forward"): module.set_chunk_feed_forward(chunk_size=chunk_size, dim=dim) for child in module.children(): fn_recursive_feed_forward(child, chunk_size, dim) for module in self.children(): fn_recursive_feed_forward(module, None, 0) # Copied from diffusers.models.unets.unet_2d_condition.UNet2DConditionModel.set_default_attn_processor def set_default_attn_processor(self) -> None: """ Disables custom attention processors and sets the default attention implementation. """ if all(proc.__class__ in ADDED_KV_ATTENTION_PROCESSORS for proc in self.attn_processors.values()): processor = AttnAddedKVProcessor() elif all(proc.__class__ in CROSS_ATTENTION_PROCESSORS for proc in self.attn_processors.values()): processor = AttnProcessor() else: raise ValueError( f"Cannot call `set_default_attn_processor` when attention processors are of type {next(iter(self.attn_processors.values()))}" ) self.set_attn_processor(processor) def _set_gradient_checkpointing(self, module, value: bool = False) -> None: if isinstance(module, (CrossAttnDownBlockMotion, DownBlockMotion, CrossAttnUpBlockMotion, UpBlockMotion)): module.gradient_checkpointing = value # Copied from diffusers.models.unets.unet_2d_condition.UNet2DConditionModel.enable_freeu def enable_freeu(self, s1: float, s2: float, b1: float, b2: float) -> None: r"""Enables the FreeU mechanism from https://arxiv.org/abs/2309.11497. The suffixes after the scaling factors represent the stage blocks where they are being applied. Please refer to the [official repository](https://github.com/ChenyangSi/FreeU) for combinations of values that are known to work well for different pipelines such as Stable Diffusion v1, v2, and Stable Diffusion XL. Args: s1 (`float`): Scaling factor for stage 1 to attenuate the contributions of the skip features. This is done to mitigate the "oversmoothing effect" in the enhanced denoising process. s2 (`float`): Scaling factor for stage 2 to attenuate the contributions of the skip features. This is done to mitigate the "oversmoothing effect" in the enhanced denoising process. b1 (`float`): Scaling factor for stage 1 to amplify the contributions of backbone features. b2 (`float`): Scaling factor for stage 2 to amplify the contributions of backbone features. """ for i, upsample_block in enumerate(self.up_blocks): setattr(upsample_block, "s1", s1) setattr(upsample_block, "s2", s2) setattr(upsample_block, "b1", b1) setattr(upsample_block, "b2", b2) # Copied from diffusers.models.unets.unet_2d_condition.UNet2DConditionModel.disable_freeu def disable_freeu(self) -> None: """Disables the FreeU mechanism.""" freeu_keys = {"s1", "s2", "b1", "b2"} for i, upsample_block in enumerate(self.up_blocks): for k in freeu_keys: if hasattr(upsample_block, k) or getattr(upsample_block, k, None) is not None: setattr(upsample_block, k, None) # Copied from diffusers.models.unets.unet_2d_condition.UNet2DConditionModel.fuse_qkv_projections def fuse_qkv_projections(self): """ Enables fused QKV projections. For self-attention modules, all projection matrices (i.e., query, key, value) are fused. For cross-attention modules, key and value projection matrices are fused. <Tip warning={true}> This API is 🧪 experimental. </Tip> """ self.original_attn_processors = None for _, attn_processor in self.attn_processors.items(): if "Added" in str(attn_processor.__class__.__name__): raise ValueError("`fuse_qkv_projections()` is not supported for models having added KV projections.") self.original_attn_processors = self.attn_processors for module in self.modules(): if isinstance(module, Attention): module.fuse_projections(fuse=True) # Copied from diffusers.models.unets.unet_2d_condition.UNet2DConditionModel.unfuse_qkv_projections def unfuse_qkv_projections(self): """Disables the fused QKV projection if enabled. <Tip warning={true}> This API is 🧪 experimental. </Tip> """ if self.original_attn_processors is not None: self.set_attn_processor(self.original_attn_processors) def forward( self, sample: torch.FloatTensor, timestep: Union[torch.Tensor, float, int], encoder_hidden_states: torch.Tensor, timestep_cond: Optional[torch.Tensor] = None, attention_mask: Optional[torch.Tensor] = None, cross_attention_kwargs: Optional[Dict[str, Any]] = None, added_cond_kwargs: Optional[Dict[str, torch.Tensor]] = None, down_block_additional_residuals: Optional[Tuple[torch.Tensor]] = None, mid_block_additional_residual: Optional[torch.Tensor] = None, return_dict: bool = True, ) -> Union[UNet3DConditionOutput, Tuple[torch.Tensor]]: r""" The [`UNetMotionModel`] forward method. Args: sample (`torch.FloatTensor`): The noisy input tensor with the following shape `(batch, num_frames, channel, height, width`. timestep (`torch.FloatTensor` or `float` or `int`): The number of timesteps to denoise an input. encoder_hidden_states (`torch.FloatTensor`): The encoder hidden states with shape `(batch, sequence_length, feature_dim)`. timestep_cond: (`torch.Tensor`, *optional*, defaults to `None`): Conditional embeddings for timestep. If provided, the embeddings will be summed with the samples passed through the `self.time_embedding` layer to obtain the timestep embeddings. attention_mask (`torch.Tensor`, *optional*, defaults to `None`): An attention mask of shape `(batch, key_tokens)` is applied to `encoder_hidden_states`. If `1` the mask is kept, otherwise if `0` it is discarded. Mask will be converted into a bias, which adds large negative values to the attention scores corresponding to "discard" tokens. cross_attention_kwargs (`dict`, *optional*): A kwargs dictionary that if specified is passed along to the `AttentionProcessor` as defined under `self.processor` in [diffusers.models.attention_processor](https://github.com/huggingface/diffusers/blob/main/src/diffusers/models/attention_processor.py). down_block_additional_residuals: (`tuple` of `torch.Tensor`, *optional*): A tuple of tensors that if specified are added to the residuals of down unet blocks. mid_block_additional_residual: (`torch.Tensor`, *optional*): A tensor that if specified is added to the residual of the middle unet block. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~models.unet_3d_condition.UNet3DConditionOutput`] instead of a plain tuple. Returns: [`~models.unet_3d_condition.UNet3DConditionOutput`] or `tuple`: If `return_dict` is True, an [`~models.unet_3d_condition.UNet3DConditionOutput`] is returned, otherwise a `tuple` is returned where the first element is the sample tensor. """ # By default samples have to be AT least a multiple of the overall upsampling factor. # The overall upsampling factor is equal to 2 ** (# num of upsampling layears). # However, the upsampling interpolation output size can be forced to fit any upsampling size # on the fly if necessary. default_overall_up_factor = 2**self.num_upsamplers # upsample size should be forwarded when sample is not a multiple of `default_overall_up_factor` forward_upsample_size = False upsample_size = None if any(s % default_overall_up_factor != 0 for s in sample.shape[-2:]): logger.info("Forward upsample size to force interpolation output size.") forward_upsample_size = True # prepare attention_mask if attention_mask is not None: attention_mask = (1 - attention_mask.to(sample.dtype)) * -10000.0 attention_mask = attention_mask.unsqueeze(1) # 1. time timesteps = timestep if not torch.is_tensor(timesteps): # TODO: this requires sync between CPU and GPU. So try to pass timesteps as tensors if you can # This would be a good case for the `match` statement (Python 3.10+) is_mps = sample.device.type == "mps" if isinstance(timestep, float): dtype = torch.float32 if is_mps else torch.float64 else: dtype = torch.int32 if is_mps else torch.int64 timesteps = torch.tensor([timesteps], dtype=dtype, device=sample.device) elif len(timesteps.shape) == 0: timesteps = timesteps[None].to(sample.device) # broadcast to batch dimension in a way that's compatible with ONNX/Core ML num_frames = sample.shape[2] timesteps = timesteps.expand(sample.shape[0]) t_emb = self.time_proj(timesteps) # timesteps does not contain any weights and will always return f32 tensors # but time_embedding might actually be running in fp16. so we need to cast here. # there might be better ways to encapsulate this. t_emb = t_emb.to(dtype=self.dtype) emb = self.time_embedding(t_emb, timestep_cond) emb = emb.repeat_interleave(repeats=num_frames, dim=0) encoder_hidden_states = encoder_hidden_states.repeat_interleave(repeats=num_frames, dim=0) if self.encoder_hid_proj is not None and self.config.encoder_hid_dim_type == "ip_image_proj": if "image_embeds" not in added_cond_kwargs: raise ValueError( f"{self.__class__} has the config param `encoder_hid_dim_type` set to 'ip_image_proj' which requires the keyword argument `image_embeds` to be passed in `added_conditions`" ) image_embeds = added_cond_kwargs.get("image_embeds") image_embeds = self.encoder_hid_proj(image_embeds) image_embeds = [image_embed.repeat_interleave(repeats=num_frames, dim=0) for image_embed in image_embeds] encoder_hidden_states = (encoder_hidden_states, image_embeds) # 2. pre-process sample = sample.permute(0, 2, 1, 3, 4).reshape((sample.shape[0] * num_frames, -1) + sample.shape[3:]) sample = self.conv_in(sample) # 3. down down_block_res_samples = (sample,) for downsample_block in self.down_blocks: if hasattr(downsample_block, "has_cross_attention") and downsample_block.has_cross_attention: sample, res_samples = downsample_block( hidden_states=sample, temb=emb, encoder_hidden_states=encoder_hidden_states, attention_mask=attention_mask, num_frames=num_frames, cross_attention_kwargs=cross_attention_kwargs, ) else: sample, res_samples = downsample_block(hidden_states=sample, temb=emb, num_frames=num_frames) down_block_res_samples += res_samples if down_block_additional_residuals is not None: new_down_block_res_samples = () for down_block_res_sample, down_block_additional_residual in zip( down_block_res_samples, down_block_additional_residuals ): down_block_res_sample = down_block_res_sample + down_block_additional_residual new_down_block_res_samples += (down_block_res_sample,) down_block_res_samples = new_down_block_res_samples # 4. mid if self.mid_block is not None: # To support older versions of motion modules that don't have a mid_block if hasattr(self.mid_block, "motion_modules"): sample = self.mid_block( sample, emb, encoder_hidden_states=encoder_hidden_states, attention_mask=attention_mask, num_frames=num_frames, cross_attention_kwargs=cross_attention_kwargs, ) else: sample = self.mid_block( sample, emb, encoder_hidden_states=encoder_hidden_states, attention_mask=attention_mask, cross_attention_kwargs=cross_attention_kwargs, ) if mid_block_additional_residual is not None: sample = sample + mid_block_additional_residual # 5. up for i, upsample_block in enumerate(self.up_blocks): is_final_block = i == len(self.up_blocks) - 1 res_samples = down_block_res_samples[-len(upsample_block.resnets) :] down_block_res_samples = down_block_res_samples[: -len(upsample_block.resnets)] # if we have not reached the final block and need to forward the # upsample size, we do it here if not is_final_block and forward_upsample_size: upsample_size = down_block_res_samples[-1].shape[2:] if hasattr(upsample_block, "has_cross_attention") and upsample_block.has_cross_attention: sample = upsample_block( hidden_states=sample, temb=emb, res_hidden_states_tuple=res_samples, encoder_hidden_states=encoder_hidden_states, upsample_size=upsample_size, attention_mask=attention_mask, num_frames=num_frames, cross_attention_kwargs=cross_attention_kwargs, ) else: sample = upsample_block( hidden_states=sample, temb=emb, res_hidden_states_tuple=res_samples, upsample_size=upsample_size, num_frames=num_frames, ) # 6. post-process if self.conv_norm_out: sample = self.conv_norm_out(sample) sample = self.conv_act(sample) sample = self.conv_out(sample) # reshape to (batch, channel, framerate, width, height) sample = sample[None, :].reshape((-1, num_frames) + sample.shape[1:]).permute(0, 2, 1, 3, 4) if not return_dict: return (sample,) return UNet3DConditionOutput(sample=sample)
diffusers/src/diffusers/models/unets/unet_motion_model.py/0
{ "file_path": "diffusers/src/diffusers/models/unets/unet_motion_model.py", "repo_id": "diffusers", "token_count": 19435 }
127
import os from typing import Any, Callable, Dict, List, Optional, Tuple, Union import torch from torch import nn from ...models.controlnet import ControlNetModel, ControlNetOutput from ...models.modeling_utils import ModelMixin from ...utils import logging logger = logging.get_logger(__name__) class MultiControlNetModel(ModelMixin): r""" Multiple `ControlNetModel` wrapper class for Multi-ControlNet This module is a wrapper for multiple instances of the `ControlNetModel`. The `forward()` API is designed to be compatible with `ControlNetModel`. Args: controlnets (`List[ControlNetModel]`): Provides additional conditioning to the unet during the denoising process. You must set multiple `ControlNetModel` as a list. """ def __init__(self, controlnets: Union[List[ControlNetModel], Tuple[ControlNetModel]]): super().__init__() self.nets = nn.ModuleList(controlnets) def forward( self, sample: torch.FloatTensor, timestep: Union[torch.Tensor, float, int], encoder_hidden_states: torch.Tensor, controlnet_cond: List[torch.tensor], conditioning_scale: List[float], class_labels: Optional[torch.Tensor] = None, timestep_cond: Optional[torch.Tensor] = None, attention_mask: Optional[torch.Tensor] = None, added_cond_kwargs: Optional[Dict[str, torch.Tensor]] = None, cross_attention_kwargs: Optional[Dict[str, Any]] = None, guess_mode: bool = False, return_dict: bool = True, ) -> Union[ControlNetOutput, Tuple]: for i, (image, scale, controlnet) in enumerate(zip(controlnet_cond, conditioning_scale, self.nets)): down_samples, mid_sample = controlnet( sample=sample, timestep=timestep, encoder_hidden_states=encoder_hidden_states, controlnet_cond=image, conditioning_scale=scale, class_labels=class_labels, timestep_cond=timestep_cond, attention_mask=attention_mask, added_cond_kwargs=added_cond_kwargs, cross_attention_kwargs=cross_attention_kwargs, guess_mode=guess_mode, return_dict=return_dict, ) # merge samples if i == 0: down_block_res_samples, mid_block_res_sample = down_samples, mid_sample else: down_block_res_samples = [ samples_prev + samples_curr for samples_prev, samples_curr in zip(down_block_res_samples, down_samples) ] mid_block_res_sample += mid_sample return down_block_res_samples, mid_block_res_sample def save_pretrained( self, save_directory: Union[str, os.PathLike], is_main_process: bool = True, save_function: Callable = None, safe_serialization: bool = True, variant: Optional[str] = None, ): """ Save a model and its configuration file to a directory, so that it can be re-loaded using the `[`~pipelines.controlnet.MultiControlNetModel.from_pretrained`]` class method. Arguments: save_directory (`str` or `os.PathLike`): Directory to which to save. Will be created if it doesn't exist. is_main_process (`bool`, *optional*, defaults to `True`): Whether the process calling this is the main process or not. Useful when in distributed training like TPUs and need to call this function on all processes. In this case, set `is_main_process=True` only on the main process to avoid race conditions. save_function (`Callable`): The function to use to save the state dictionary. Useful on distributed training like TPUs when one need to replace `torch.save` by another method. Can be configured with the environment variable `DIFFUSERS_SAVE_MODE`. safe_serialization (`bool`, *optional*, defaults to `True`): Whether to save the model using `safetensors` or the traditional PyTorch way (that uses `pickle`). variant (`str`, *optional*): If specified, weights are saved in the format pytorch_model.<variant>.bin. """ idx = 0 model_path_to_save = save_directory for controlnet in self.nets: controlnet.save_pretrained( model_path_to_save, is_main_process=is_main_process, save_function=save_function, safe_serialization=safe_serialization, variant=variant, ) idx += 1 model_path_to_save = model_path_to_save + f"_{idx}" @classmethod def from_pretrained(cls, pretrained_model_path: Optional[Union[str, os.PathLike]], **kwargs): r""" Instantiate a pretrained MultiControlNet model from multiple pre-trained controlnet models. The model is set in evaluation mode by default using `model.eval()` (Dropout modules are deactivated). To train the model, you should first set it back in training mode with `model.train()`. The warning *Weights from XXX not initialized from pretrained model* means that the weights of XXX do not come pretrained with the rest of the model. It is up to you to train those weights with a downstream fine-tuning task. The warning *Weights from XXX not used in YYY* means that the layer XXX is not used by YYY, therefore those weights are discarded. Parameters: pretrained_model_path (`os.PathLike`): A path to a *directory* containing model weights saved using [`~diffusers.pipelines.controlnet.MultiControlNetModel.save_pretrained`], e.g., `./my_model_directory/controlnet`. torch_dtype (`str` or `torch.dtype`, *optional*): Override the default `torch.dtype` and load the model under this dtype. If `"auto"` is passed the dtype will be automatically derived from the model's weights. output_loading_info(`bool`, *optional*, defaults to `False`): Whether or not to also return a dictionary containing missing keys, unexpected keys and error messages. device_map (`str` or `Dict[str, Union[int, str, torch.device]]`, *optional*): A map that specifies where each submodule should go. It doesn't need to be refined to each parameter/buffer name, once a given module name is inside, every submodule of it will be sent to the same device. To have Accelerate compute the most optimized `device_map` automatically, set `device_map="auto"`. For more information about each option see [designing a device map](https://hf.co/docs/accelerate/main/en/usage_guides/big_modeling#designing-a-device-map). max_memory (`Dict`, *optional*): A dictionary device identifier to maximum memory. Will default to the maximum memory available for each GPU and the available CPU RAM if unset. low_cpu_mem_usage (`bool`, *optional*, defaults to `True` if torch version >= 1.9.0 else `False`): Speed up model loading by not initializing the weights and only loading the pre-trained weights. This also tries to not use more than 1x model size in CPU memory (including peak memory) while loading the model. This is only supported when torch version >= 1.9.0. If you are using an older version of torch, setting this argument to `True` will raise an error. variant (`str`, *optional*): If specified load weights from `variant` filename, *e.g.* pytorch_model.<variant>.bin. `variant` is ignored when using `from_flax`. use_safetensors (`bool`, *optional*, defaults to `None`): If set to `None`, the `safetensors` weights will be downloaded if they're available **and** if the `safetensors` library is installed. If set to `True`, the model will be forcibly loaded from `safetensors` weights. If set to `False`, loading will *not* use `safetensors`. """ idx = 0 controlnets = [] # load controlnet and append to list until no controlnet directory exists anymore # first controlnet has to be saved under `./mydirectory/controlnet` to be compliant with `DiffusionPipeline.from_prertained` # second, third, ... controlnets have to be saved under `./mydirectory/controlnet_1`, `./mydirectory/controlnet_2`, ... model_path_to_load = pretrained_model_path while os.path.isdir(model_path_to_load): controlnet = ControlNetModel.from_pretrained(model_path_to_load, **kwargs) controlnets.append(controlnet) idx += 1 model_path_to_load = pretrained_model_path + f"_{idx}" logger.info(f"{len(controlnets)} controlnets loaded from {pretrained_model_path}.") if len(controlnets) == 0: raise ValueError( f"No ControlNets found under {os.path.dirname(pretrained_model_path)}. Expected at least {pretrained_model_path + '_0'}." ) return cls(controlnets)
diffusers/src/diffusers/pipelines/controlnet/multicontrolnet.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/controlnet/multicontrolnet.py", "repo_id": "diffusers", "token_count": 3924 }
128
import html import inspect import re import urllib.parse as ul from typing import Any, Callable, Dict, List, Optional, Union import torch from transformers import CLIPImageProcessor, T5EncoderModel, T5Tokenizer from ...loaders import LoraLoaderMixin from ...models import UNet2DConditionModel from ...schedulers import DDPMScheduler from ...utils import ( BACKENDS_MAPPING, is_accelerate_available, is_bs4_available, is_ftfy_available, logging, replace_example_docstring, ) from ...utils.torch_utils import randn_tensor from ..pipeline_utils import DiffusionPipeline from .pipeline_output import IFPipelineOutput from .safety_checker import IFSafetyChecker from .watermark import IFWatermarker logger = logging.get_logger(__name__) # pylint: disable=invalid-name if is_bs4_available(): from bs4 import BeautifulSoup if is_ftfy_available(): import ftfy EXAMPLE_DOC_STRING = """ Examples: ```py >>> from diffusers import IFPipeline, IFSuperResolutionPipeline, DiffusionPipeline >>> from diffusers.utils import pt_to_pil >>> import torch >>> pipe = IFPipeline.from_pretrained("DeepFloyd/IF-I-XL-v1.0", variant="fp16", torch_dtype=torch.float16) >>> pipe.enable_model_cpu_offload() >>> prompt = 'a photo of a kangaroo wearing an orange hoodie and blue sunglasses standing in front of the eiffel tower holding a sign that says "very deep learning"' >>> prompt_embeds, negative_embeds = pipe.encode_prompt(prompt) >>> image = pipe(prompt_embeds=prompt_embeds, negative_prompt_embeds=negative_embeds, output_type="pt").images >>> # save intermediate image >>> pil_image = pt_to_pil(image) >>> pil_image[0].save("./if_stage_I.png") >>> super_res_1_pipe = IFSuperResolutionPipeline.from_pretrained( ... "DeepFloyd/IF-II-L-v1.0", text_encoder=None, variant="fp16", torch_dtype=torch.float16 ... ) >>> super_res_1_pipe.enable_model_cpu_offload() >>> image = super_res_1_pipe( ... image=image, prompt_embeds=prompt_embeds, negative_prompt_embeds=negative_embeds, output_type="pt" ... ).images >>> # save intermediate image >>> pil_image = pt_to_pil(image) >>> pil_image[0].save("./if_stage_I.png") >>> safety_modules = { ... "feature_extractor": pipe.feature_extractor, ... "safety_checker": pipe.safety_checker, ... "watermarker": pipe.watermarker, ... } >>> super_res_2_pipe = DiffusionPipeline.from_pretrained( ... "stabilityai/stable-diffusion-x4-upscaler", **safety_modules, torch_dtype=torch.float16 ... ) >>> super_res_2_pipe.enable_model_cpu_offload() >>> image = super_res_2_pipe( ... prompt=prompt, ... image=image, ... ).images >>> image[0].save("./if_stage_II.png") ``` """ class IFPipeline(DiffusionPipeline, LoraLoaderMixin): tokenizer: T5Tokenizer text_encoder: T5EncoderModel unet: UNet2DConditionModel scheduler: DDPMScheduler feature_extractor: Optional[CLIPImageProcessor] safety_checker: Optional[IFSafetyChecker] watermarker: Optional[IFWatermarker] bad_punct_regex = re.compile( r"[" + "#®•©™&@·º½¾¿¡§~" + r"\)" + r"\(" + r"\]" + r"\[" + r"\}" + r"\{" + r"\|" + "\\" + r"\/" + r"\*" + r"]{1,}" ) # noqa _optional_components = ["tokenizer", "text_encoder", "safety_checker", "feature_extractor", "watermarker"] model_cpu_offload_seq = "text_encoder->unet" def __init__( self, tokenizer: T5Tokenizer, text_encoder: T5EncoderModel, unet: UNet2DConditionModel, scheduler: DDPMScheduler, safety_checker: Optional[IFSafetyChecker], feature_extractor: Optional[CLIPImageProcessor], watermarker: Optional[IFWatermarker], requires_safety_checker: bool = True, ): super().__init__() if safety_checker is None and requires_safety_checker: logger.warning( f"You have disabled the safety checker for {self.__class__} by passing `safety_checker=None`. Ensure" " that you abide to the conditions of the IF license and do not expose unfiltered" " results in services or applications open to the public. Both the diffusers team and Hugging Face" " strongly recommend to keep the safety filter enabled in all public facing circumstances, disabling" " it only for use-cases that involve analyzing network behavior or auditing its results. For more" " information, please have a look at https://github.com/huggingface/diffusers/pull/254 ." ) if safety_checker is not None and feature_extractor is None: raise ValueError( "Make sure to define a feature extractor when loading {self.__class__} if you want to use the safety" " checker. If you do not want to use the safety checker, you can pass `'safety_checker=None'` instead." ) self.register_modules( tokenizer=tokenizer, text_encoder=text_encoder, unet=unet, scheduler=scheduler, safety_checker=safety_checker, feature_extractor=feature_extractor, watermarker=watermarker, ) self.register_to_config(requires_safety_checker=requires_safety_checker) def remove_all_hooks(self): if is_accelerate_available(): from accelerate.hooks import remove_hook_from_module else: raise ImportError("Please install accelerate via `pip install accelerate`") for model in [self.text_encoder, self.unet, self.safety_checker]: if model is not None: remove_hook_from_module(model, recurse=True) self.unet_offload_hook = None self.text_encoder_offload_hook = None self.final_offload_hook = None @torch.no_grad() def encode_prompt( self, prompt: Union[str, List[str]], do_classifier_free_guidance: bool = True, num_images_per_prompt: int = 1, device: Optional[torch.device] = None, negative_prompt: Optional[Union[str, List[str]]] = None, prompt_embeds: Optional[torch.FloatTensor] = None, negative_prompt_embeds: Optional[torch.FloatTensor] = None, clean_caption: bool = False, ): r""" Encodes the prompt into text encoder hidden states. Args: prompt (`str` or `List[str]`, *optional*): prompt to be encoded do_classifier_free_guidance (`bool`, *optional*, defaults to `True`): whether to use classifier free guidance or not num_images_per_prompt (`int`, *optional*, defaults to 1): number of images that should be generated per prompt device: (`torch.device`, *optional*): torch device to place the resulting embeddings on negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. If not defined, one has to pass `negative_prompt_embeds`. instead. If not defined, one has to pass `negative_prompt_embeds`. instead. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, text embeddings will be generated from `prompt` input argument. negative_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, negative_prompt_embeds will be generated from `negative_prompt` input argument. clean_caption (bool, defaults to `False`): If `True`, the function will preprocess and clean the provided caption before encoding. """ if prompt is not None and negative_prompt is not None: if type(prompt) is not type(negative_prompt): raise TypeError( f"`negative_prompt` should be the same type to `prompt`, but got {type(negative_prompt)} !=" f" {type(prompt)}." ) if device is None: device = self._execution_device if prompt is not None and isinstance(prompt, str): batch_size = 1 elif prompt is not None and isinstance(prompt, list): batch_size = len(prompt) else: batch_size = prompt_embeds.shape[0] # while T5 can handle much longer input sequences than 77, the text encoder was trained with a max length of 77 for IF max_length = 77 if prompt_embeds is None: prompt = self._text_preprocessing(prompt, clean_caption=clean_caption) text_inputs = self.tokenizer( prompt, padding="max_length", max_length=max_length, truncation=True, add_special_tokens=True, return_tensors="pt", ) text_input_ids = text_inputs.input_ids untruncated_ids = self.tokenizer(prompt, padding="longest", return_tensors="pt").input_ids if untruncated_ids.shape[-1] >= text_input_ids.shape[-1] and not torch.equal( text_input_ids, untruncated_ids ): removed_text = self.tokenizer.batch_decode(untruncated_ids[:, max_length - 1 : -1]) logger.warning( "The following part of your input was truncated because CLIP can only handle sequences up to" f" {max_length} tokens: {removed_text}" ) attention_mask = text_inputs.attention_mask.to(device) prompt_embeds = self.text_encoder( text_input_ids.to(device), attention_mask=attention_mask, ) prompt_embeds = prompt_embeds[0] if self.text_encoder is not None: dtype = self.text_encoder.dtype elif self.unet is not None: dtype = self.unet.dtype else: dtype = None prompt_embeds = prompt_embeds.to(dtype=dtype, device=device) bs_embed, seq_len, _ = prompt_embeds.shape # duplicate text embeddings for each generation per prompt, using mps friendly method prompt_embeds = prompt_embeds.repeat(1, num_images_per_prompt, 1) prompt_embeds = prompt_embeds.view(bs_embed * num_images_per_prompt, seq_len, -1) # get unconditional embeddings for classifier free guidance if do_classifier_free_guidance and negative_prompt_embeds is None: uncond_tokens: List[str] if negative_prompt is None: uncond_tokens = [""] * batch_size elif isinstance(negative_prompt, str): uncond_tokens = [negative_prompt] elif batch_size != len(negative_prompt): raise ValueError( f"`negative_prompt`: {negative_prompt} has batch size {len(negative_prompt)}, but `prompt`:" f" {prompt} has batch size {batch_size}. Please make sure that passed `negative_prompt` matches" " the batch size of `prompt`." ) else: uncond_tokens = negative_prompt uncond_tokens = self._text_preprocessing(uncond_tokens, clean_caption=clean_caption) max_length = prompt_embeds.shape[1] uncond_input = self.tokenizer( uncond_tokens, padding="max_length", max_length=max_length, truncation=True, return_attention_mask=True, add_special_tokens=True, return_tensors="pt", ) attention_mask = uncond_input.attention_mask.to(device) negative_prompt_embeds = self.text_encoder( uncond_input.input_ids.to(device), attention_mask=attention_mask, ) negative_prompt_embeds = negative_prompt_embeds[0] if do_classifier_free_guidance: # duplicate unconditional embeddings for each generation per prompt, using mps friendly method seq_len = negative_prompt_embeds.shape[1] negative_prompt_embeds = negative_prompt_embeds.to(dtype=dtype, device=device) negative_prompt_embeds = negative_prompt_embeds.repeat(1, num_images_per_prompt, 1) negative_prompt_embeds = negative_prompt_embeds.view(batch_size * num_images_per_prompt, seq_len, -1) # For classifier free guidance, we need to do two forward passes. # Here we concatenate the unconditional and text embeddings into a single batch # to avoid doing two forward passes else: negative_prompt_embeds = None return prompt_embeds, negative_prompt_embeds def run_safety_checker(self, image, device, dtype): if self.safety_checker is not None: safety_checker_input = self.feature_extractor(self.numpy_to_pil(image), return_tensors="pt").to(device) image, nsfw_detected, watermark_detected = self.safety_checker( images=image, clip_input=safety_checker_input.pixel_values.to(dtype=dtype), ) else: nsfw_detected = None watermark_detected = None if hasattr(self, "unet_offload_hook") and self.unet_offload_hook is not None: self.unet_offload_hook.offload() return image, nsfw_detected, watermark_detected # Copied from diffusers.pipelines.stable_diffusion.pipeline_stable_diffusion.StableDiffusionPipeline.prepare_extra_step_kwargs def prepare_extra_step_kwargs(self, generator, eta): # prepare extra kwargs for the scheduler step, since not all schedulers have the same signature # eta (η) is only used with the DDIMScheduler, it will be ignored for other schedulers. # eta corresponds to η in DDIM paper: https://arxiv.org/abs/2010.02502 # and should be between [0, 1] accepts_eta = "eta" in set(inspect.signature(self.scheduler.step).parameters.keys()) extra_step_kwargs = {} if accepts_eta: extra_step_kwargs["eta"] = eta # check if the scheduler accepts generator accepts_generator = "generator" in set(inspect.signature(self.scheduler.step).parameters.keys()) if accepts_generator: extra_step_kwargs["generator"] = generator return extra_step_kwargs def check_inputs( self, prompt, callback_steps, negative_prompt=None, prompt_embeds=None, negative_prompt_embeds=None, ): if (callback_steps is None) or ( callback_steps is not None and (not isinstance(callback_steps, int) or callback_steps <= 0) ): raise ValueError( f"`callback_steps` has to be a positive integer but is {callback_steps} of type" f" {type(callback_steps)}." ) if prompt is not None and prompt_embeds is not None: raise ValueError( f"Cannot forward both `prompt`: {prompt} and `prompt_embeds`: {prompt_embeds}. Please make sure to" " only forward one of the two." ) elif prompt is None and prompt_embeds is None: raise ValueError( "Provide either `prompt` or `prompt_embeds`. Cannot leave both `prompt` and `prompt_embeds` undefined." ) elif prompt is not None and (not isinstance(prompt, str) and not isinstance(prompt, list)): raise ValueError(f"`prompt` has to be of type `str` or `list` but is {type(prompt)}") if negative_prompt is not None and negative_prompt_embeds is not None: raise ValueError( f"Cannot forward both `negative_prompt`: {negative_prompt} and `negative_prompt_embeds`:" f" {negative_prompt_embeds}. Please make sure to only forward one of the two." ) if prompt_embeds is not None and negative_prompt_embeds is not None: if prompt_embeds.shape != negative_prompt_embeds.shape: raise ValueError( "`prompt_embeds` and `negative_prompt_embeds` must have the same shape when passed directly, but" f" got: `prompt_embeds` {prompt_embeds.shape} != `negative_prompt_embeds`" f" {negative_prompt_embeds.shape}." ) def prepare_intermediate_images(self, batch_size, num_channels, height, width, dtype, device, generator): shape = (batch_size, num_channels, height, width) if isinstance(generator, list) and len(generator) != batch_size: raise ValueError( f"You have passed a list of generators of length {len(generator)}, but requested an effective batch" f" size of {batch_size}. Make sure the batch size matches the length of the generators." ) intermediate_images = randn_tensor(shape, generator=generator, device=device, dtype=dtype) # scale the initial noise by the standard deviation required by the scheduler intermediate_images = intermediate_images * self.scheduler.init_noise_sigma return intermediate_images def _text_preprocessing(self, text, clean_caption=False): if clean_caption and not is_bs4_available(): logger.warning(BACKENDS_MAPPING["bs4"][-1].format("Setting `clean_caption=True`")) logger.warning("Setting `clean_caption` to False...") clean_caption = False if clean_caption and not is_ftfy_available(): logger.warning(BACKENDS_MAPPING["ftfy"][-1].format("Setting `clean_caption=True`")) logger.warning("Setting `clean_caption` to False...") clean_caption = False if not isinstance(text, (tuple, list)): text = [text] def process(text: str): if clean_caption: text = self._clean_caption(text) text = self._clean_caption(text) else: text = text.lower().strip() return text return [process(t) for t in text] def _clean_caption(self, caption): caption = str(caption) caption = ul.unquote_plus(caption) caption = caption.strip().lower() caption = re.sub("<person>", "person", caption) # urls: caption = re.sub( r"\b((?:https?:(?:\/{1,3}|[a-zA-Z0-9%])|[a-zA-Z0-9.\-]+[.](?:com|co|ru|net|org|edu|gov|it)[\w/-]*\b\/?(?!@)))", # noqa "", caption, ) # regex for urls caption = re.sub( r"\b((?:www:(?:\/{1,3}|[a-zA-Z0-9%])|[a-zA-Z0-9.\-]+[.](?:com|co|ru|net|org|edu|gov|it)[\w/-]*\b\/?(?!@)))", # noqa "", caption, ) # regex for urls # html: caption = BeautifulSoup(caption, features="html.parser").text # @<nickname> caption = re.sub(r"@[\w\d]+\b", "", caption) # 31C0—31EF CJK Strokes # 31F0—31FF Katakana Phonetic Extensions # 3200—32FF Enclosed CJK Letters and Months # 3300—33FF CJK Compatibility # 3400—4DBF CJK Unified Ideographs Extension A # 4DC0—4DFF Yijing Hexagram Symbols # 4E00—9FFF CJK Unified Ideographs caption = re.sub(r"[\u31c0-\u31ef]+", "", caption) caption = re.sub(r"[\u31f0-\u31ff]+", "", caption) caption = re.sub(r"[\u3200-\u32ff]+", "", caption) caption = re.sub(r"[\u3300-\u33ff]+", "", caption) caption = re.sub(r"[\u3400-\u4dbf]+", "", caption) caption = re.sub(r"[\u4dc0-\u4dff]+", "", caption) caption = re.sub(r"[\u4e00-\u9fff]+", "", caption) ####################################################### # все виды тире / all types of dash --> "-" caption = re.sub( r"[\u002D\u058A\u05BE\u1400\u1806\u2010-\u2015\u2E17\u2E1A\u2E3A\u2E3B\u2E40\u301C\u3030\u30A0\uFE31\uFE32\uFE58\uFE63\uFF0D]+", # noqa "-", caption, ) # кавычки к одному стандарту caption = re.sub(r"[`´«»“”¨]", '"', caption) caption = re.sub(r"[‘’]", "'", caption) # &quot; caption = re.sub(r"&quot;?", "", caption) # &amp caption = re.sub(r"&amp", "", caption) # ip adresses: caption = re.sub(r"\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}", " ", caption) # article ids: caption = re.sub(r"\d:\d\d\s+$", "", caption) # \n caption = re.sub(r"\\n", " ", caption) # "#123" caption = re.sub(r"#\d{1,3}\b", "", caption) # "#12345.." caption = re.sub(r"#\d{5,}\b", "", caption) # "123456.." caption = re.sub(r"\b\d{6,}\b", "", caption) # filenames: caption = re.sub(r"[\S]+\.(?:png|jpg|jpeg|bmp|webp|eps|pdf|apk|mp4)", "", caption) # caption = re.sub(r"[\"\']{2,}", r'"', caption) # """AUSVERKAUFT""" caption = re.sub(r"[\.]{2,}", r" ", caption) # """AUSVERKAUFT""" caption = re.sub(self.bad_punct_regex, r" ", caption) # ***AUSVERKAUFT***, #AUSVERKAUFT caption = re.sub(r"\s+\.\s+", r" ", caption) # " . " # this-is-my-cute-cat / this_is_my_cute_cat regex2 = re.compile(r"(?:\-|\_)") if len(re.findall(regex2, caption)) > 3: caption = re.sub(regex2, " ", caption) caption = ftfy.fix_text(caption) caption = html.unescape(html.unescape(caption)) caption = re.sub(r"\b[a-zA-Z]{1,3}\d{3,15}\b", "", caption) # jc6640 caption = re.sub(r"\b[a-zA-Z]+\d+[a-zA-Z]+\b", "", caption) # jc6640vc caption = re.sub(r"\b\d+[a-zA-Z]+\d+\b", "", caption) # 6640vc231 caption = re.sub(r"(worldwide\s+)?(free\s+)?shipping", "", caption) caption = re.sub(r"(free\s)?download(\sfree)?", "", caption) caption = re.sub(r"\bclick\b\s(?:for|on)\s\w+", "", caption) caption = re.sub(r"\b(?:png|jpg|jpeg|bmp|webp|eps|pdf|apk|mp4)(\simage[s]?)?", "", caption) caption = re.sub(r"\bpage\s+\d+\b", "", caption) caption = re.sub(r"\b\d*[a-zA-Z]+\d+[a-zA-Z]+\d+[a-zA-Z\d]*\b", r" ", caption) # j2d1a2a... caption = re.sub(r"\b\d+\.?\d*[xх×]\d+\.?\d*\b", "", caption) caption = re.sub(r"\b\s+\:\s+", r": ", caption) caption = re.sub(r"(\D[,\./])\b", r"\1 ", caption) caption = re.sub(r"\s+", " ", caption) caption.strip() caption = re.sub(r"^[\"\']([\w\W]+)[\"\']$", r"\1", caption) caption = re.sub(r"^[\'\_,\-\:;]", r"", caption) caption = re.sub(r"[\'\_,\-\:\-\+]$", r"", caption) caption = re.sub(r"^\.\S+$", "", caption) return caption.strip() @torch.no_grad() @replace_example_docstring(EXAMPLE_DOC_STRING) def __call__( self, prompt: Union[str, List[str]] = None, num_inference_steps: int = 100, timesteps: List[int] = None, guidance_scale: float = 7.0, negative_prompt: Optional[Union[str, List[str]]] = None, num_images_per_prompt: Optional[int] = 1, height: Optional[int] = None, width: Optional[int] = None, eta: float = 0.0, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, prompt_embeds: Optional[torch.FloatTensor] = None, negative_prompt_embeds: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", return_dict: bool = True, callback: Optional[Callable[[int, int, torch.FloatTensor], None]] = None, callback_steps: int = 1, clean_caption: bool = True, cross_attention_kwargs: Optional[Dict[str, Any]] = None, ): """ Function invoked when calling the pipeline for generation. Args: prompt (`str` or `List[str]`, *optional*): The prompt or prompts to guide the image generation. If not defined, one has to pass `prompt_embeds`. instead. num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. timesteps (`List[int]`, *optional*): Custom timesteps to use for the denoising process. If not defined, equal spaced `num_inference_steps` timesteps are used. Must be in descending order. guidance_scale (`float`, *optional*, defaults to 7.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. If not defined, one has to pass `negative_prompt_embeds` instead. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. height (`int`, *optional*, defaults to self.unet.config.sample_size): The height in pixels of the generated image. width (`int`, *optional*, defaults to self.unet.config.sample_size): The width in pixels of the generated image. eta (`float`, *optional*, defaults to 0.0): Corresponds to parameter eta (η) in the DDIM paper: https://arxiv.org/abs/2010.02502. Only applies to [`schedulers.DDIMScheduler`], will be ignored for others. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): One or a list of [torch generator(s)](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, text embeddings will be generated from `prompt` input argument. negative_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, negative_prompt_embeds will be generated from `negative_prompt` input argument. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between [PIL](https://pillow.readthedocs.io/en/stable/): `PIL.Image.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.stable_diffusion.IFPipelineOutput`] instead of a plain tuple. callback (`Callable`, *optional*): A function that will be called every `callback_steps` steps during inference. The function will be called with the following arguments: `callback(step: int, timestep: int, latents: torch.FloatTensor)`. callback_steps (`int`, *optional*, defaults to 1): The frequency at which the `callback` function will be called. If not specified, the callback will be called at every step. clean_caption (`bool`, *optional*, defaults to `True`): Whether or not to clean the caption before creating embeddings. Requires `beautifulsoup4` and `ftfy` to be installed. If the dependencies are not installed, the embeddings will be created from the raw prompt. cross_attention_kwargs (`dict`, *optional*): A kwargs dictionary that if specified is passed along to the `AttentionProcessor` as defined under `self.processor` in [diffusers.models.attention_processor](https://github.com/huggingface/diffusers/blob/main/src/diffusers/models/attention_processor.py). Examples: Returns: [`~pipelines.stable_diffusion.IFPipelineOutput`] or `tuple`: [`~pipelines.stable_diffusion.IFPipelineOutput`] if `return_dict` is True, otherwise a `tuple. When returning a tuple, the first element is a list with the generated images, and the second element is a list of `bool`s denoting whether the corresponding generated image likely represents "not-safe-for-work" (nsfw) or watermarked content, according to the `safety_checker`. """ # 1. Check inputs. Raise error if not correct self.check_inputs(prompt, callback_steps, negative_prompt, prompt_embeds, negative_prompt_embeds) # 2. Define call parameters height = height or self.unet.config.sample_size width = width or self.unet.config.sample_size if prompt is not None and isinstance(prompt, str): batch_size = 1 elif prompt is not None and isinstance(prompt, list): batch_size = len(prompt) else: batch_size = prompt_embeds.shape[0] device = self._execution_device # here `guidance_scale` is defined analog to the guidance weight `w` of equation (2) # of the Imagen paper: https://arxiv.org/pdf/2205.11487.pdf . `guidance_scale = 1` # corresponds to doing no classifier free guidance. do_classifier_free_guidance = guidance_scale > 1.0 # 3. Encode input prompt prompt_embeds, negative_prompt_embeds = self.encode_prompt( prompt, do_classifier_free_guidance, num_images_per_prompt=num_images_per_prompt, device=device, negative_prompt=negative_prompt, prompt_embeds=prompt_embeds, negative_prompt_embeds=negative_prompt_embeds, clean_caption=clean_caption, ) if do_classifier_free_guidance: prompt_embeds = torch.cat([negative_prompt_embeds, prompt_embeds]) # 4. Prepare timesteps if timesteps is not None: self.scheduler.set_timesteps(timesteps=timesteps, device=device) timesteps = self.scheduler.timesteps num_inference_steps = len(timesteps) else: self.scheduler.set_timesteps(num_inference_steps, device=device) timesteps = self.scheduler.timesteps if hasattr(self.scheduler, "set_begin_index"): self.scheduler.set_begin_index(0) # 5. Prepare intermediate images intermediate_images = self.prepare_intermediate_images( batch_size * num_images_per_prompt, self.unet.config.in_channels, height, width, prompt_embeds.dtype, device, generator, ) # 6. Prepare extra step kwargs. TODO: Logic should ideally just be moved out of the pipeline extra_step_kwargs = self.prepare_extra_step_kwargs(generator, eta) # HACK: see comment in `enable_model_cpu_offload` if hasattr(self, "text_encoder_offload_hook") and self.text_encoder_offload_hook is not None: self.text_encoder_offload_hook.offload() # 7. Denoising loop num_warmup_steps = len(timesteps) - num_inference_steps * self.scheduler.order with self.progress_bar(total=num_inference_steps) as progress_bar: for i, t in enumerate(timesteps): model_input = ( torch.cat([intermediate_images] * 2) if do_classifier_free_guidance else intermediate_images ) model_input = self.scheduler.scale_model_input(model_input, t) # predict the noise residual noise_pred = self.unet( model_input, t, encoder_hidden_states=prompt_embeds, cross_attention_kwargs=cross_attention_kwargs, return_dict=False, )[0] # perform guidance if do_classifier_free_guidance: noise_pred_uncond, noise_pred_text = noise_pred.chunk(2) noise_pred_uncond, _ = noise_pred_uncond.split(model_input.shape[1], dim=1) noise_pred_text, predicted_variance = noise_pred_text.split(model_input.shape[1], dim=1) noise_pred = noise_pred_uncond + guidance_scale * (noise_pred_text - noise_pred_uncond) noise_pred = torch.cat([noise_pred, predicted_variance], dim=1) if self.scheduler.config.variance_type not in ["learned", "learned_range"]: noise_pred, _ = noise_pred.split(model_input.shape[1], dim=1) # compute the previous noisy sample x_t -> x_t-1 intermediate_images = self.scheduler.step( noise_pred, t, intermediate_images, **extra_step_kwargs, return_dict=False )[0] # call the callback, if provided if i == len(timesteps) - 1 or ((i + 1) > num_warmup_steps and (i + 1) % self.scheduler.order == 0): progress_bar.update() if callback is not None and i % callback_steps == 0: callback(i, t, intermediate_images) image = intermediate_images if output_type == "pil": # 8. Post-processing image = (image / 2 + 0.5).clamp(0, 1) image = image.cpu().permute(0, 2, 3, 1).float().numpy() # 9. Run safety checker image, nsfw_detected, watermark_detected = self.run_safety_checker(image, device, prompt_embeds.dtype) # 10. Convert to PIL image = self.numpy_to_pil(image) # 11. Apply watermark if self.watermarker is not None: image = self.watermarker.apply_watermark(image, self.unet.config.sample_size) elif output_type == "pt": nsfw_detected = None watermark_detected = None if hasattr(self, "unet_offload_hook") and self.unet_offload_hook is not None: self.unet_offload_hook.offload() else: # 8. Post-processing image = (image / 2 + 0.5).clamp(0, 1) image = image.cpu().permute(0, 2, 3, 1).float().numpy() # 9. Run safety checker image, nsfw_detected, watermark_detected = self.run_safety_checker(image, device, prompt_embeds.dtype) # Offload all models self.maybe_free_model_hooks() if not return_dict: return (image, nsfw_detected, watermark_detected) return IFPipelineOutput(images=image, nsfw_detected=nsfw_detected, watermark_detected=watermark_detected)
diffusers/src/diffusers/pipelines/deepfloyd_if/pipeline_if.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/deepfloyd_if/pipeline_if.py", "repo_id": "diffusers", "token_count": 16612 }
129
from dataclasses import dataclass from typing import List, Optional, Union import numpy as np import PIL.Image from ....utils import ( BaseOutput, ) @dataclass # Copied from diffusers.pipelines.stable_diffusion.pipeline_output.StableDiffusionPipelineOutput with Stable->Alt class AltDiffusionPipelineOutput(BaseOutput): """ Output class for Alt Diffusion pipelines. Args: images (`List[PIL.Image.Image]` or `np.ndarray`) List of denoised PIL images of length `batch_size` or NumPy array of shape `(batch_size, height, width, num_channels)`. nsfw_content_detected (`List[bool]`) List indicating whether the corresponding generated image contains "not-safe-for-work" (nsfw) content or `None` if safety checking could not be performed. """ images: Union[List[PIL.Image.Image], np.ndarray] nsfw_content_detected: Optional[List[bool]]
diffusers/src/diffusers/pipelines/deprecated/alt_diffusion/pipeline_output.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/deprecated/alt_diffusion/pipeline_output.py", "repo_id": "diffusers", "token_count": 344 }
130
# Copyright 2022 The Music Spectrogram Diffusion Authors. # Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import math from typing import Any, Callable, List, Optional, Tuple, Union import numpy as np import torch from ....models import T5FilmDecoder from ....schedulers import DDPMScheduler from ....utils import is_onnx_available, logging from ....utils.torch_utils import randn_tensor if is_onnx_available(): from ...onnx_utils import OnnxRuntimeModel from ...pipeline_utils import AudioPipelineOutput, DiffusionPipeline from .continuous_encoder import SpectrogramContEncoder from .notes_encoder import SpectrogramNotesEncoder logger = logging.get_logger(__name__) # pylint: disable=invalid-name TARGET_FEATURE_LENGTH = 256 class SpectrogramDiffusionPipeline(DiffusionPipeline): r""" Pipeline for unconditional audio generation. This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods implemented for all pipelines (downloading, saving, running on a particular device, etc.). Args: notes_encoder ([`SpectrogramNotesEncoder`]): continuous_encoder ([`SpectrogramContEncoder`]): decoder ([`T5FilmDecoder`]): A [`T5FilmDecoder`] to denoise the encoded audio latents. scheduler ([`DDPMScheduler`]): A scheduler to be used in combination with `decoder` to denoise the encoded audio latents. melgan ([`OnnxRuntimeModel`]): """ _optional_components = ["melgan"] def __init__( self, notes_encoder: SpectrogramNotesEncoder, continuous_encoder: SpectrogramContEncoder, decoder: T5FilmDecoder, scheduler: DDPMScheduler, melgan: OnnxRuntimeModel if is_onnx_available() else Any, ) -> None: super().__init__() # From MELGAN self.min_value = math.log(1e-5) # Matches MelGAN training. self.max_value = 4.0 # Largest value for most examples self.n_dims = 128 self.register_modules( notes_encoder=notes_encoder, continuous_encoder=continuous_encoder, decoder=decoder, scheduler=scheduler, melgan=melgan, ) def scale_features(self, features, output_range=(-1.0, 1.0), clip=False): """Linearly scale features to network outputs range.""" min_out, max_out = output_range if clip: features = torch.clip(features, self.min_value, self.max_value) # Scale to [0, 1]. zero_one = (features - self.min_value) / (self.max_value - self.min_value) # Scale to [min_out, max_out]. return zero_one * (max_out - min_out) + min_out def scale_to_features(self, outputs, input_range=(-1.0, 1.0), clip=False): """Invert by linearly scaling network outputs to features range.""" min_out, max_out = input_range outputs = torch.clip(outputs, min_out, max_out) if clip else outputs # Scale to [0, 1]. zero_one = (outputs - min_out) / (max_out - min_out) # Scale to [self.min_value, self.max_value]. return zero_one * (self.max_value - self.min_value) + self.min_value def encode(self, input_tokens, continuous_inputs, continuous_mask): tokens_mask = input_tokens > 0 tokens_encoded, tokens_mask = self.notes_encoder( encoder_input_tokens=input_tokens, encoder_inputs_mask=tokens_mask ) continuous_encoded, continuous_mask = self.continuous_encoder( encoder_inputs=continuous_inputs, encoder_inputs_mask=continuous_mask ) return [(tokens_encoded, tokens_mask), (continuous_encoded, continuous_mask)] def decode(self, encodings_and_masks, input_tokens, noise_time): timesteps = noise_time if not torch.is_tensor(timesteps): timesteps = torch.tensor([timesteps], dtype=torch.long, device=input_tokens.device) elif torch.is_tensor(timesteps) and len(timesteps.shape) == 0: timesteps = timesteps[None].to(input_tokens.device) # broadcast to batch dimension in a way that's compatible with ONNX/Core ML timesteps = timesteps * torch.ones(input_tokens.shape[0], dtype=timesteps.dtype, device=timesteps.device) logits = self.decoder( encodings_and_masks=encodings_and_masks, decoder_input_tokens=input_tokens, decoder_noise_time=timesteps ) return logits @torch.no_grad() def __call__( self, input_tokens: List[List[int]], generator: Optional[torch.Generator] = None, num_inference_steps: int = 100, return_dict: bool = True, output_type: str = "np", callback: Optional[Callable[[int, int, torch.FloatTensor], None]] = None, callback_steps: int = 1, ) -> Union[AudioPipelineOutput, Tuple]: if (callback_steps is None) or ( callback_steps is not None and (not isinstance(callback_steps, int) or callback_steps <= 0) ): raise ValueError( f"`callback_steps` has to be a positive integer but is {callback_steps} of type" f" {type(callback_steps)}." ) r""" The call function to the pipeline for generation. Args: input_tokens (`List[List[int]]`): generator (`torch.Generator` or `List[torch.Generator]`, *optional*): A [`torch.Generator`](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality audio at the expense of slower inference. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.AudioPipelineOutput`] instead of a plain tuple. output_type (`str`, *optional*, defaults to `"np"`): The output format of the generated audio. callback (`Callable`, *optional*): A function that calls every `callback_steps` steps during inference. The function is called with the following arguments: `callback(step: int, timestep: int, latents: torch.FloatTensor)`. callback_steps (`int`, *optional*, defaults to 1): The frequency at which the `callback` function is called. If not specified, the callback is called at every step. Example: ```py >>> from diffusers import SpectrogramDiffusionPipeline, MidiProcessor >>> pipe = SpectrogramDiffusionPipeline.from_pretrained("google/music-spectrogram-diffusion") >>> pipe = pipe.to("cuda") >>> processor = MidiProcessor() >>> # Download MIDI from: wget http://www.piano-midi.de/midis/beethoven/beethoven_hammerklavier_2.mid >>> output = pipe(processor("beethoven_hammerklavier_2.mid")) >>> audio = output.audios[0] ``` Returns: [`pipelines.AudioPipelineOutput`] or `tuple`: If `return_dict` is `True`, [`pipelines.AudioPipelineOutput`] is returned, otherwise a `tuple` is returned where the first element is a list with the generated audio. """ pred_mel = np.zeros([1, TARGET_FEATURE_LENGTH, self.n_dims], dtype=np.float32) full_pred_mel = np.zeros([1, 0, self.n_dims], np.float32) ones = torch.ones((1, TARGET_FEATURE_LENGTH), dtype=bool, device=self.device) for i, encoder_input_tokens in enumerate(input_tokens): if i == 0: encoder_continuous_inputs = torch.from_numpy(pred_mel[:1].copy()).to( device=self.device, dtype=self.decoder.dtype ) # The first chunk has no previous context. encoder_continuous_mask = torch.zeros((1, TARGET_FEATURE_LENGTH), dtype=bool, device=self.device) else: # The full song pipeline does not feed in a context feature, so the mask # will be all 0s after the feature converter. Because we know we're # feeding in a full context chunk from the previous prediction, set it # to all 1s. encoder_continuous_mask = ones encoder_continuous_inputs = self.scale_features( encoder_continuous_inputs, output_range=[-1.0, 1.0], clip=True ) encodings_and_masks = self.encode( input_tokens=torch.IntTensor([encoder_input_tokens]).to(device=self.device), continuous_inputs=encoder_continuous_inputs, continuous_mask=encoder_continuous_mask, ) # Sample encoder_continuous_inputs shaped gaussian noise to begin loop x = randn_tensor( shape=encoder_continuous_inputs.shape, generator=generator, device=self.device, dtype=self.decoder.dtype, ) # set step values self.scheduler.set_timesteps(num_inference_steps) # Denoising diffusion loop for j, t in enumerate(self.progress_bar(self.scheduler.timesteps)): output = self.decode( encodings_and_masks=encodings_and_masks, input_tokens=x, noise_time=t / self.scheduler.config.num_train_timesteps, # rescale to [0, 1) ) # Compute previous output: x_t -> x_t-1 x = self.scheduler.step(output, t, x, generator=generator).prev_sample mel = self.scale_to_features(x, input_range=[-1.0, 1.0]) encoder_continuous_inputs = mel[:1] pred_mel = mel.cpu().float().numpy() full_pred_mel = np.concatenate([full_pred_mel, pred_mel[:1]], axis=1) # call the callback, if provided if callback is not None and i % callback_steps == 0: callback(i, full_pred_mel) logger.info("Generated segment", i) if output_type == "np" and not is_onnx_available(): raise ValueError( "Cannot return output in 'np' format if ONNX is not available. Make sure to have ONNX installed or set 'output_type' to 'mel'." ) elif output_type == "np" and self.melgan is None: raise ValueError( "Cannot return output in 'np' format if melgan component is not defined. Make sure to define `self.melgan` or set 'output_type' to 'mel'." ) if output_type == "np": output = self.melgan(input_features=full_pred_mel.astype(np.float32)) else: output = full_pred_mel if not return_dict: return (output,) return AudioPipelineOutput(audios=output)
diffusers/src/diffusers/pipelines/deprecated/spectrogram_diffusion/pipeline_spectrogram_diffusion.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/deprecated/spectrogram_diffusion/pipeline_spectrogram_diffusion.py", "repo_id": "diffusers", "token_count": 4996 }
131
from typing import TYPE_CHECKING from ....utils import ( DIFFUSERS_SLOW_IMPORT, OptionalDependencyNotAvailable, _LazyModule, is_torch_available, is_transformers_available, ) _dummy_objects = {} _import_structure = {} try: if not (is_transformers_available() and is_torch_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ....utils.dummy_torch_and_transformers_objects import ( LearnedClassifierFreeSamplingEmbeddings, VQDiffusionPipeline, ) _dummy_objects.update( { "LearnedClassifierFreeSamplingEmbeddings": LearnedClassifierFreeSamplingEmbeddings, "VQDiffusionPipeline": VQDiffusionPipeline, } ) else: _import_structure["pipeline_vq_diffusion"] = ["LearnedClassifierFreeSamplingEmbeddings", "VQDiffusionPipeline"] if TYPE_CHECKING or DIFFUSERS_SLOW_IMPORT: try: if not (is_transformers_available() and is_torch_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ....utils.dummy_torch_and_transformers_objects import ( LearnedClassifierFreeSamplingEmbeddings, VQDiffusionPipeline, ) else: from .pipeline_vq_diffusion import LearnedClassifierFreeSamplingEmbeddings, VQDiffusionPipeline else: import sys sys.modules[__name__] = _LazyModule( __name__, globals()["__file__"], _import_structure, module_spec=__spec__, ) for name, value in _dummy_objects.items(): setattr(sys.modules[__name__], name, value)
diffusers/src/diffusers/pipelines/deprecated/vq_diffusion/__init__.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/deprecated/vq_diffusion/__init__.py", "repo_id": "diffusers", "token_count": 682 }
132
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from typing import Callable, Dict, List, Optional, Union import PIL.Image import torch from transformers import CLIPImageProcessor, CLIPTextModelWithProjection, CLIPTokenizer, CLIPVisionModelWithProjection from ...models import PriorTransformer, UNet2DConditionModel, VQModel from ...schedulers import DDPMScheduler, UnCLIPScheduler from ...utils import deprecate, logging, replace_example_docstring from ..pipeline_utils import DiffusionPipeline from .pipeline_kandinsky2_2 import KandinskyV22Pipeline from .pipeline_kandinsky2_2_img2img import KandinskyV22Img2ImgPipeline from .pipeline_kandinsky2_2_inpainting import KandinskyV22InpaintPipeline from .pipeline_kandinsky2_2_prior import KandinskyV22PriorPipeline logger = logging.get_logger(__name__) # pylint: disable=invalid-name TEXT2IMAGE_EXAMPLE_DOC_STRING = """ Examples: ```py from diffusers import AutoPipelineForText2Image import torch pipe = AutoPipelineForText2Image.from_pretrained( "kandinsky-community/kandinsky-2-2-decoder", torch_dtype=torch.float16 ) pipe.enable_model_cpu_offload() prompt = "A lion in galaxies, spirals, nebulae, stars, smoke, iridescent, intricate detail, octane render, 8k" image = pipe(prompt=prompt, num_inference_steps=25).images[0] ``` """ IMAGE2IMAGE_EXAMPLE_DOC_STRING = """ Examples: ```py from diffusers import AutoPipelineForImage2Image import torch import requests from io import BytesIO from PIL import Image import os pipe = AutoPipelineForImage2Image.from_pretrained( "kandinsky-community/kandinsky-2-2-decoder", torch_dtype=torch.float16 ) pipe.enable_model_cpu_offload() prompt = "A fantasy landscape, Cinematic lighting" negative_prompt = "low quality, bad quality" url = "https://raw.githubusercontent.com/CompVis/stable-diffusion/main/assets/stable-samples/img2img/sketch-mountains-input.jpg" response = requests.get(url) image = Image.open(BytesIO(response.content)).convert("RGB") image.thumbnail((768, 768)) image = pipe(prompt=prompt, image=original_image, num_inference_steps=25).images[0] ``` """ INPAINT_EXAMPLE_DOC_STRING = """ Examples: ```py from diffusers import AutoPipelineForInpainting from diffusers.utils import load_image import torch import numpy as np pipe = AutoPipelineForInpainting.from_pretrained( "kandinsky-community/kandinsky-2-2-decoder-inpaint", torch_dtype=torch.float16 ) pipe.enable_model_cpu_offload() prompt = "A fantasy landscape, Cinematic lighting" negative_prompt = "low quality, bad quality" original_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main" "/kandinsky/cat.png" ) mask = np.zeros((768, 768), dtype=np.float32) # Let's mask out an area above the cat's head mask[:250, 250:-250] = 1 image = pipe(prompt=prompt, image=original_image, mask_image=mask, num_inference_steps=25).images[0] ``` """ class KandinskyV22CombinedPipeline(DiffusionPipeline): """ Combined Pipeline for text-to-image generation using Kandinsky This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods the library implements for all the pipelines (such as downloading or saving, running on a particular device, etc.) Args: scheduler (Union[`DDIMScheduler`,`DDPMScheduler`]): A scheduler to be used in combination with `unet` to generate image latents. unet ([`UNet2DConditionModel`]): Conditional U-Net architecture to denoise the image embedding. movq ([`VQModel`]): MoVQ Decoder to generate the image from the latents. prior_prior ([`PriorTransformer`]): The canonical unCLIP prior to approximate the image embedding from the text embedding. prior_image_encoder ([`CLIPVisionModelWithProjection`]): Frozen image-encoder. prior_text_encoder ([`CLIPTextModelWithProjection`]): Frozen text-encoder. prior_tokenizer (`CLIPTokenizer`): Tokenizer of class [CLIPTokenizer](https://huggingface.co/docs/transformers/v4.21.0/en/model_doc/clip#transformers.CLIPTokenizer). prior_scheduler ([`UnCLIPScheduler`]): A scheduler to be used in combination with `prior` to generate image embedding. prior_image_processor ([`CLIPImageProcessor`]): A image_processor to be used to preprocess image from clip. """ model_cpu_offload_seq = "prior_text_encoder->prior_image_encoder->unet->movq" _load_connected_pipes = True def __init__( self, unet: UNet2DConditionModel, scheduler: DDPMScheduler, movq: VQModel, prior_prior: PriorTransformer, prior_image_encoder: CLIPVisionModelWithProjection, prior_text_encoder: CLIPTextModelWithProjection, prior_tokenizer: CLIPTokenizer, prior_scheduler: UnCLIPScheduler, prior_image_processor: CLIPImageProcessor, ): super().__init__() self.register_modules( unet=unet, scheduler=scheduler, movq=movq, prior_prior=prior_prior, prior_image_encoder=prior_image_encoder, prior_text_encoder=prior_text_encoder, prior_tokenizer=prior_tokenizer, prior_scheduler=prior_scheduler, prior_image_processor=prior_image_processor, ) self.prior_pipe = KandinskyV22PriorPipeline( prior=prior_prior, image_encoder=prior_image_encoder, text_encoder=prior_text_encoder, tokenizer=prior_tokenizer, scheduler=prior_scheduler, image_processor=prior_image_processor, ) self.decoder_pipe = KandinskyV22Pipeline( unet=unet, scheduler=scheduler, movq=movq, ) def enable_xformers_memory_efficient_attention(self, attention_op: Optional[Callable] = None): self.decoder_pipe.enable_xformers_memory_efficient_attention(attention_op) def enable_sequential_cpu_offload(self, gpu_id: Optional[int] = None, device: Union[torch.device, str] = "cuda"): r""" Offloads all models to CPU using accelerate, significantly reducing memory usage. When called, unet, text_encoder, vae and safety checker have their state dicts saved to CPU and then are moved to a `torch.device('meta') and loaded to GPU only when their specific submodule has its `forward` method called. Note that offloading happens on a submodule basis. Memory savings are higher than with `enable_model_cpu_offload`, but performance is lower. """ self.prior_pipe.enable_sequential_cpu_offload(gpu_id=gpu_id, device=device) self.decoder_pipe.enable_sequential_cpu_offload(gpu_id=gpu_id, device=device) def progress_bar(self, iterable=None, total=None): self.prior_pipe.progress_bar(iterable=iterable, total=total) self.decoder_pipe.progress_bar(iterable=iterable, total=total) self.decoder_pipe.enable_model_cpu_offload() def set_progress_bar_config(self, **kwargs): self.prior_pipe.set_progress_bar_config(**kwargs) self.decoder_pipe.set_progress_bar_config(**kwargs) @torch.no_grad() @replace_example_docstring(TEXT2IMAGE_EXAMPLE_DOC_STRING) def __call__( self, prompt: Union[str, List[str]], negative_prompt: Optional[Union[str, List[str]]] = None, num_inference_steps: int = 100, guidance_scale: float = 4.0, num_images_per_prompt: int = 1, height: int = 512, width: int = 512, prior_guidance_scale: float = 4.0, prior_num_inference_steps: int = 25, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, latents: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", callback: Optional[Callable[[int, int, torch.FloatTensor], None]] = None, callback_steps: int = 1, return_dict: bool = True, prior_callback_on_step_end: Optional[Callable[[int, int, Dict], None]] = None, prior_callback_on_step_end_tensor_inputs: List[str] = ["latents"], callback_on_step_end: Optional[Callable[[int, int, Dict], None]] = None, callback_on_step_end_tensor_inputs: List[str] = ["latents"], ): """ Function invoked when calling the pipeline for generation. Args: prompt (`str` or `List[str]`): The prompt or prompts to guide the image generation. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. height (`int`, *optional*, defaults to 512): The height in pixels of the generated image. width (`int`, *optional*, defaults to 512): The width in pixels of the generated image. prior_guidance_scale (`float`, *optional*, defaults to 4.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. prior_num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. guidance_scale (`float`, *optional*, defaults to 4.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): One or a list of [torch generator(s)](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. latents (`torch.FloatTensor`, *optional*): Pre-generated noisy latents, sampled from a Gaussian distribution, to be used as inputs for image generation. Can be used to tweak the same generation with different prompts. If not provided, a latents tensor will ge generated by sampling using the supplied random `generator`. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between: `"pil"` (`PIL.Image.Image`), `"np"` (`np.array`) or `"pt"` (`torch.Tensor`). return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.ImagePipelineOutput`] instead of a plain tuple. prior_callback_on_step_end (`Callable`, *optional*): A function that calls at the end of each denoising steps during the inference of the prior pipeline. The function is called with the following arguments: `prior_callback_on_step_end(self: DiffusionPipeline, step: int, timestep: int, callback_kwargs: Dict)`. prior_callback_on_step_end_tensor_inputs (`List`, *optional*): The list of tensor inputs for the `prior_callback_on_step_end` function. The tensors specified in the list will be passed as `callback_kwargs` argument. You will only be able to include variables listed in the `._callback_tensor_inputs` attribute of your prior pipeline class. callback_on_step_end (`Callable`, *optional*): A function that calls at the end of each denoising steps during the inference of the decoder pipeline. The function is called with the following arguments: `callback_on_step_end(self: DiffusionPipeline, step: int, timestep: int, callback_kwargs: Dict)`. `callback_kwargs` will include a list of all tensors as specified by `callback_on_step_end_tensor_inputs`. callback_on_step_end_tensor_inputs (`List`, *optional*): The list of tensor inputs for the `callback_on_step_end` function. The tensors specified in the list will be passed as `callback_kwargs` argument. You will only be able to include variables listed in the `._callback_tensor_inputs` attribute of your pipeline class. Examples: Returns: [`~pipelines.ImagePipelineOutput`] or `tuple` """ prior_outputs = self.prior_pipe( prompt=prompt, negative_prompt=negative_prompt, num_images_per_prompt=num_images_per_prompt, num_inference_steps=prior_num_inference_steps, generator=generator, latents=latents, guidance_scale=prior_guidance_scale, output_type="pt", return_dict=False, callback_on_step_end=prior_callback_on_step_end, callback_on_step_end_tensor_inputs=prior_callback_on_step_end_tensor_inputs, ) image_embeds = prior_outputs[0] negative_image_embeds = prior_outputs[1] prompt = [prompt] if not isinstance(prompt, (list, tuple)) else prompt if len(prompt) < image_embeds.shape[0] and image_embeds.shape[0] % len(prompt) == 0: prompt = (image_embeds.shape[0] // len(prompt)) * prompt outputs = self.decoder_pipe( image_embeds=image_embeds, negative_image_embeds=negative_image_embeds, width=width, height=height, num_inference_steps=num_inference_steps, generator=generator, guidance_scale=guidance_scale, output_type=output_type, callback=callback, callback_steps=callback_steps, return_dict=return_dict, callback_on_step_end=callback_on_step_end, callback_on_step_end_tensor_inputs=callback_on_step_end_tensor_inputs, ) self.maybe_free_model_hooks() return outputs class KandinskyV22Img2ImgCombinedPipeline(DiffusionPipeline): """ Combined Pipeline for image-to-image generation using Kandinsky This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods the library implements for all the pipelines (such as downloading or saving, running on a particular device, etc.) Args: scheduler (Union[`DDIMScheduler`,`DDPMScheduler`]): A scheduler to be used in combination with `unet` to generate image latents. unet ([`UNet2DConditionModel`]): Conditional U-Net architecture to denoise the image embedding. movq ([`VQModel`]): MoVQ Decoder to generate the image from the latents. prior_prior ([`PriorTransformer`]): The canonical unCLIP prior to approximate the image embedding from the text embedding. prior_image_encoder ([`CLIPVisionModelWithProjection`]): Frozen image-encoder. prior_text_encoder ([`CLIPTextModelWithProjection`]): Frozen text-encoder. prior_tokenizer (`CLIPTokenizer`): Tokenizer of class [CLIPTokenizer](https://huggingface.co/docs/transformers/v4.21.0/en/model_doc/clip#transformers.CLIPTokenizer). prior_scheduler ([`UnCLIPScheduler`]): A scheduler to be used in combination with `prior` to generate image embedding. prior_image_processor ([`CLIPImageProcessor`]): A image_processor to be used to preprocess image from clip. """ model_cpu_offload_seq = "prior_text_encoder->prior_image_encoder->unet->movq" _load_connected_pipes = True def __init__( self, unet: UNet2DConditionModel, scheduler: DDPMScheduler, movq: VQModel, prior_prior: PriorTransformer, prior_image_encoder: CLIPVisionModelWithProjection, prior_text_encoder: CLIPTextModelWithProjection, prior_tokenizer: CLIPTokenizer, prior_scheduler: UnCLIPScheduler, prior_image_processor: CLIPImageProcessor, ): super().__init__() self.register_modules( unet=unet, scheduler=scheduler, movq=movq, prior_prior=prior_prior, prior_image_encoder=prior_image_encoder, prior_text_encoder=prior_text_encoder, prior_tokenizer=prior_tokenizer, prior_scheduler=prior_scheduler, prior_image_processor=prior_image_processor, ) self.prior_pipe = KandinskyV22PriorPipeline( prior=prior_prior, image_encoder=prior_image_encoder, text_encoder=prior_text_encoder, tokenizer=prior_tokenizer, scheduler=prior_scheduler, image_processor=prior_image_processor, ) self.decoder_pipe = KandinskyV22Img2ImgPipeline( unet=unet, scheduler=scheduler, movq=movq, ) def enable_xformers_memory_efficient_attention(self, attention_op: Optional[Callable] = None): self.decoder_pipe.enable_xformers_memory_efficient_attention(attention_op) def enable_model_cpu_offload(self, gpu_id: Optional[int] = None, device: Union[torch.device, str] = "cuda"): r""" Offloads all models to CPU using accelerate, reducing memory usage with a low impact on performance. Compared to `enable_sequential_cpu_offload`, this method moves one whole model at a time to the GPU when its `forward` method is called, and the model remains in GPU until the next model runs. Memory savings are lower than with `enable_sequential_cpu_offload`, but performance is much better due to the iterative execution of the `unet`. """ self.prior_pipe.enable_model_cpu_offload(gpu_id=gpu_id, device=device) self.decoder_pipe.enable_model_cpu_offload(gpu_id=gpu_id, device=device) def enable_sequential_cpu_offload(self, gpu_id: Optional[int] = None, device: Union[torch.device, str] = "cuda"): r""" Offloads all models to CPU using accelerate, significantly reducing memory usage. When called, unet, text_encoder, vae and safety checker have their state dicts saved to CPU and then are moved to a `torch.device('meta') and loaded to GPU only when their specific submodule has its `forward` method called. Note that offloading happens on a submodule basis. Memory savings are higher than with `enable_model_cpu_offload`, but performance is lower. """ self.prior_pipe.enable_sequential_cpu_offload(gpu_id=gpu_id, device=device) self.decoder_pipe.enable_sequential_cpu_offload(gpu_id=gpu_id, device=device) def progress_bar(self, iterable=None, total=None): self.prior_pipe.progress_bar(iterable=iterable, total=total) self.decoder_pipe.progress_bar(iterable=iterable, total=total) self.decoder_pipe.enable_model_cpu_offload() def set_progress_bar_config(self, **kwargs): self.prior_pipe.set_progress_bar_config(**kwargs) self.decoder_pipe.set_progress_bar_config(**kwargs) @torch.no_grad() @replace_example_docstring(IMAGE2IMAGE_EXAMPLE_DOC_STRING) def __call__( self, prompt: Union[str, List[str]], image: Union[torch.FloatTensor, PIL.Image.Image, List[torch.FloatTensor], List[PIL.Image.Image]], negative_prompt: Optional[Union[str, List[str]]] = None, num_inference_steps: int = 100, guidance_scale: float = 4.0, strength: float = 0.3, num_images_per_prompt: int = 1, height: int = 512, width: int = 512, prior_guidance_scale: float = 4.0, prior_num_inference_steps: int = 25, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, latents: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", callback: Optional[Callable[[int, int, torch.FloatTensor], None]] = None, callback_steps: int = 1, return_dict: bool = True, prior_callback_on_step_end: Optional[Callable[[int, int, Dict], None]] = None, prior_callback_on_step_end_tensor_inputs: List[str] = ["latents"], callback_on_step_end: Optional[Callable[[int, int, Dict], None]] = None, callback_on_step_end_tensor_inputs: List[str] = ["latents"], ): """ Function invoked when calling the pipeline for generation. Args: prompt (`str` or `List[str]`): The prompt or prompts to guide the image generation. image (`torch.FloatTensor`, `PIL.Image.Image`, `np.ndarray`, `List[torch.FloatTensor]`, `List[PIL.Image.Image]`, or `List[np.ndarray]`): `Image`, or tensor representing an image batch, that will be used as the starting point for the process. Can also accept image latents as `image`, if passing latents directly, it will not be encoded again. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. guidance_scale (`float`, *optional*, defaults to 4.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. strength (`float`, *optional*, defaults to 0.3): Conceptually, indicates how much to transform the reference `image`. Must be between 0 and 1. `image` will be used as a starting point, adding more noise to it the larger the `strength`. The number of denoising steps depends on the amount of noise initially added. When `strength` is 1, added noise will be maximum and the denoising process will run for the full number of iterations specified in `num_inference_steps`. A value of 1, therefore, essentially ignores `image`. num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. height (`int`, *optional*, defaults to 512): The height in pixels of the generated image. width (`int`, *optional*, defaults to 512): The width in pixels of the generated image. prior_guidance_scale (`float`, *optional*, defaults to 4.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. prior_num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): One or a list of [torch generator(s)](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. latents (`torch.FloatTensor`, *optional*): Pre-generated noisy latents, sampled from a Gaussian distribution, to be used as inputs for image generation. Can be used to tweak the same generation with different prompts. If not provided, a latents tensor will ge generated by sampling using the supplied random `generator`. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between: `"pil"` (`PIL.Image.Image`), `"np"` (`np.array`) or `"pt"` (`torch.Tensor`). callback (`Callable`, *optional*): A function that calls every `callback_steps` steps during inference. The function is called with the following arguments: `callback(step: int, timestep: int, latents: torch.FloatTensor)`. callback_steps (`int`, *optional*, defaults to 1): The frequency at which the `callback` function is called. If not specified, the callback is called at every step. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.ImagePipelineOutput`] instead of a plain tuple. Examples: Returns: [`~pipelines.ImagePipelineOutput`] or `tuple` """ prior_outputs = self.prior_pipe( prompt=prompt, negative_prompt=negative_prompt, num_images_per_prompt=num_images_per_prompt, num_inference_steps=prior_num_inference_steps, generator=generator, latents=latents, guidance_scale=prior_guidance_scale, output_type="pt", return_dict=False, callback_on_step_end=prior_callback_on_step_end, callback_on_step_end_tensor_inputs=prior_callback_on_step_end_tensor_inputs, ) image_embeds = prior_outputs[0] negative_image_embeds = prior_outputs[1] prompt = [prompt] if not isinstance(prompt, (list, tuple)) else prompt image = [image] if isinstance(prompt, PIL.Image.Image) else image if len(prompt) < image_embeds.shape[0] and image_embeds.shape[0] % len(prompt) == 0: prompt = (image_embeds.shape[0] // len(prompt)) * prompt if ( isinstance(image, (list, tuple)) and len(image) < image_embeds.shape[0] and image_embeds.shape[0] % len(image) == 0 ): image = (image_embeds.shape[0] // len(image)) * image outputs = self.decoder_pipe( image=image, image_embeds=image_embeds, negative_image_embeds=negative_image_embeds, width=width, height=height, strength=strength, num_inference_steps=num_inference_steps, generator=generator, guidance_scale=guidance_scale, output_type=output_type, callback=callback, callback_steps=callback_steps, return_dict=return_dict, callback_on_step_end=callback_on_step_end, callback_on_step_end_tensor_inputs=callback_on_step_end_tensor_inputs, ) self.maybe_free_model_hooks() return outputs class KandinskyV22InpaintCombinedPipeline(DiffusionPipeline): """ Combined Pipeline for inpainting generation using Kandinsky This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods the library implements for all the pipelines (such as downloading or saving, running on a particular device, etc.) Args: scheduler (Union[`DDIMScheduler`,`DDPMScheduler`]): A scheduler to be used in combination with `unet` to generate image latents. unet ([`UNet2DConditionModel`]): Conditional U-Net architecture to denoise the image embedding. movq ([`VQModel`]): MoVQ Decoder to generate the image from the latents. prior_prior ([`PriorTransformer`]): The canonical unCLIP prior to approximate the image embedding from the text embedding. prior_image_encoder ([`CLIPVisionModelWithProjection`]): Frozen image-encoder. prior_text_encoder ([`CLIPTextModelWithProjection`]): Frozen text-encoder. prior_tokenizer (`CLIPTokenizer`): Tokenizer of class [CLIPTokenizer](https://huggingface.co/docs/transformers/v4.21.0/en/model_doc/clip#transformers.CLIPTokenizer). prior_scheduler ([`UnCLIPScheduler`]): A scheduler to be used in combination with `prior` to generate image embedding. prior_image_processor ([`CLIPImageProcessor`]): A image_processor to be used to preprocess image from clip. """ model_cpu_offload_seq = "prior_text_encoder->prior_image_encoder->unet->movq" _load_connected_pipes = True def __init__( self, unet: UNet2DConditionModel, scheduler: DDPMScheduler, movq: VQModel, prior_prior: PriorTransformer, prior_image_encoder: CLIPVisionModelWithProjection, prior_text_encoder: CLIPTextModelWithProjection, prior_tokenizer: CLIPTokenizer, prior_scheduler: UnCLIPScheduler, prior_image_processor: CLIPImageProcessor, ): super().__init__() self.register_modules( unet=unet, scheduler=scheduler, movq=movq, prior_prior=prior_prior, prior_image_encoder=prior_image_encoder, prior_text_encoder=prior_text_encoder, prior_tokenizer=prior_tokenizer, prior_scheduler=prior_scheduler, prior_image_processor=prior_image_processor, ) self.prior_pipe = KandinskyV22PriorPipeline( prior=prior_prior, image_encoder=prior_image_encoder, text_encoder=prior_text_encoder, tokenizer=prior_tokenizer, scheduler=prior_scheduler, image_processor=prior_image_processor, ) self.decoder_pipe = KandinskyV22InpaintPipeline( unet=unet, scheduler=scheduler, movq=movq, ) def enable_xformers_memory_efficient_attention(self, attention_op: Optional[Callable] = None): self.decoder_pipe.enable_xformers_memory_efficient_attention(attention_op) def enable_sequential_cpu_offload(self, gpu_id: Optional[int] = None, device: Union[torch.device, str] = "cuda"): r""" Offloads all models to CPU using accelerate, significantly reducing memory usage. When called, unet, text_encoder, vae and safety checker have their state dicts saved to CPU and then are moved to a `torch.device('meta') and loaded to GPU only when their specific submodule has its `forward` method called. Note that offloading happens on a submodule basis. Memory savings are higher than with `enable_model_cpu_offload`, but performance is lower. """ self.prior_pipe.enable_sequential_cpu_offload(gpu_id=gpu_id, device=device) self.decoder_pipe.enable_sequential_cpu_offload(gpu_id=gpu_id, device=device) def progress_bar(self, iterable=None, total=None): self.prior_pipe.progress_bar(iterable=iterable, total=total) self.decoder_pipe.progress_bar(iterable=iterable, total=total) self.decoder_pipe.enable_model_cpu_offload() def set_progress_bar_config(self, **kwargs): self.prior_pipe.set_progress_bar_config(**kwargs) self.decoder_pipe.set_progress_bar_config(**kwargs) @torch.no_grad() @replace_example_docstring(INPAINT_EXAMPLE_DOC_STRING) def __call__( self, prompt: Union[str, List[str]], image: Union[torch.FloatTensor, PIL.Image.Image, List[torch.FloatTensor], List[PIL.Image.Image]], mask_image: Union[torch.FloatTensor, PIL.Image.Image, List[torch.FloatTensor], List[PIL.Image.Image]], negative_prompt: Optional[Union[str, List[str]]] = None, num_inference_steps: int = 100, guidance_scale: float = 4.0, num_images_per_prompt: int = 1, height: int = 512, width: int = 512, prior_guidance_scale: float = 4.0, prior_num_inference_steps: int = 25, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, latents: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", return_dict: bool = True, prior_callback_on_step_end: Optional[Callable[[int, int, Dict], None]] = None, prior_callback_on_step_end_tensor_inputs: List[str] = ["latents"], callback_on_step_end: Optional[Callable[[int, int, Dict], None]] = None, callback_on_step_end_tensor_inputs: List[str] = ["latents"], **kwargs, ): """ Function invoked when calling the pipeline for generation. Args: prompt (`str` or `List[str]`): The prompt or prompts to guide the image generation. image (`torch.FloatTensor`, `PIL.Image.Image`, `np.ndarray`, `List[torch.FloatTensor]`, `List[PIL.Image.Image]`, or `List[np.ndarray]`): `Image`, or tensor representing an image batch, that will be used as the starting point for the process. Can also accept image latents as `image`, if passing latents directly, it will not be encoded again. mask_image (`np.array`): Tensor representing an image batch, to mask `image`. White pixels in the mask will be repainted, while black pixels will be preserved. If `mask_image` is a PIL image, it will be converted to a single channel (luminance) before use. If it's a tensor, it should contain one color channel (L) instead of 3, so the expected shape would be `(B, H, W, 1)`. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. guidance_scale (`float`, *optional*, defaults to 4.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. height (`int`, *optional*, defaults to 512): The height in pixels of the generated image. width (`int`, *optional*, defaults to 512): The width in pixels of the generated image. prior_guidance_scale (`float`, *optional*, defaults to 4.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. prior_num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): One or a list of [torch generator(s)](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. latents (`torch.FloatTensor`, *optional*): Pre-generated noisy latents, sampled from a Gaussian distribution, to be used as inputs for image generation. Can be used to tweak the same generation with different prompts. If not provided, a latents tensor will ge generated by sampling using the supplied random `generator`. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between: `"pil"` (`PIL.Image.Image`), `"np"` (`np.array`) or `"pt"` (`torch.Tensor`). return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.ImagePipelineOutput`] instead of a plain tuple. prior_callback_on_step_end (`Callable`, *optional*): A function that calls at the end of each denoising steps during the inference. The function is called with the following arguments: `prior_callback_on_step_end(self: DiffusionPipeline, step: int, timestep: int, callback_kwargs: Dict)`. prior_callback_on_step_end_tensor_inputs (`List`, *optional*): The list of tensor inputs for the `prior_callback_on_step_end` function. The tensors specified in the list will be passed as `callback_kwargs` argument. You will only be able to include variables listed in the `._callback_tensor_inputs` attribute of your pipeline class. callback_on_step_end (`Callable`, *optional*): A function that calls at the end of each denoising steps during the inference. The function is called with the following arguments: `callback_on_step_end(self: DiffusionPipeline, step: int, timestep: int, callback_kwargs: Dict)`. `callback_kwargs` will include a list of all tensors as specified by `callback_on_step_end_tensor_inputs`. callback_on_step_end_tensor_inputs (`List`, *optional*): The list of tensor inputs for the `callback_on_step_end` function. The tensors specified in the list will be passed as `callback_kwargs` argument. You will only be able to include variables listed in the `._callback_tensor_inputs` attribute of your pipeline class. Examples: Returns: [`~pipelines.ImagePipelineOutput`] or `tuple` """ prior_kwargs = {} if kwargs.get("prior_callback", None) is not None: prior_kwargs["callback"] = kwargs.pop("prior_callback") deprecate( "prior_callback", "1.0.0", "Passing `prior_callback` as an input argument to `__call__` is deprecated, consider use `prior_callback_on_step_end`", ) if kwargs.get("prior_callback_steps", None) is not None: deprecate( "prior_callback_steps", "1.0.0", "Passing `prior_callback_steps` as an input argument to `__call__` is deprecated, consider use `prior_callback_on_step_end`", ) prior_kwargs["callback_steps"] = kwargs.pop("prior_callback_steps") prior_outputs = self.prior_pipe( prompt=prompt, negative_prompt=negative_prompt, num_images_per_prompt=num_images_per_prompt, num_inference_steps=prior_num_inference_steps, generator=generator, latents=latents, guidance_scale=prior_guidance_scale, output_type="pt", return_dict=False, callback_on_step_end=prior_callback_on_step_end, callback_on_step_end_tensor_inputs=prior_callback_on_step_end_tensor_inputs, **prior_kwargs, ) image_embeds = prior_outputs[0] negative_image_embeds = prior_outputs[1] prompt = [prompt] if not isinstance(prompt, (list, tuple)) else prompt image = [image] if isinstance(prompt, PIL.Image.Image) else image mask_image = [mask_image] if isinstance(mask_image, PIL.Image.Image) else mask_image if len(prompt) < image_embeds.shape[0] and image_embeds.shape[0] % len(prompt) == 0: prompt = (image_embeds.shape[0] // len(prompt)) * prompt if ( isinstance(image, (list, tuple)) and len(image) < image_embeds.shape[0] and image_embeds.shape[0] % len(image) == 0 ): image = (image_embeds.shape[0] // len(image)) * image if ( isinstance(mask_image, (list, tuple)) and len(mask_image) < image_embeds.shape[0] and image_embeds.shape[0] % len(mask_image) == 0 ): mask_image = (image_embeds.shape[0] // len(mask_image)) * mask_image outputs = self.decoder_pipe( image=image, mask_image=mask_image, image_embeds=image_embeds, negative_image_embeds=negative_image_embeds, width=width, height=height, num_inference_steps=num_inference_steps, generator=generator, guidance_scale=guidance_scale, output_type=output_type, return_dict=return_dict, callback_on_step_end=callback_on_step_end, callback_on_step_end_tensor_inputs=callback_on_step_end_tensor_inputs, **kwargs, ) self.maybe_free_model_hooks() return outputs
diffusers/src/diffusers/pipelines/kandinsky2_2/pipeline_kandinsky2_2_combined.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/kandinsky2_2/pipeline_kandinsky2_2_combined.py", "repo_id": "diffusers", "token_count": 18830 }
133
import inspect from typing import List, Optional, Tuple, Union import numpy as np import PIL.Image import torch import torch.utils.checkpoint from ...models import UNet2DModel, VQModel from ...schedulers import ( DDIMScheduler, DPMSolverMultistepScheduler, EulerAncestralDiscreteScheduler, EulerDiscreteScheduler, LMSDiscreteScheduler, PNDMScheduler, ) from ...utils import PIL_INTERPOLATION from ...utils.torch_utils import randn_tensor from ..pipeline_utils import DiffusionPipeline, ImagePipelineOutput def preprocess(image): w, h = image.size w, h = (x - x % 32 for x in (w, h)) # resize to integer multiple of 32 image = image.resize((w, h), resample=PIL_INTERPOLATION["lanczos"]) image = np.array(image).astype(np.float32) / 255.0 image = image[None].transpose(0, 3, 1, 2) image = torch.from_numpy(image) return 2.0 * image - 1.0 class LDMSuperResolutionPipeline(DiffusionPipeline): r""" A pipeline for image super-resolution using latent diffusion. This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods implemented for all pipelines (downloading, saving, running on a particular device, etc.). Parameters: vqvae ([`VQModel`]): Vector-quantized (VQ) model to encode and decode images to and from latent representations. unet ([`UNet2DModel`]): A `UNet2DModel` to denoise the encoded image. scheduler ([`SchedulerMixin`]): A scheduler to be used in combination with `unet` to denoise the encoded image latens. Can be one of [`DDIMScheduler`], [`LMSDiscreteScheduler`], [`EulerDiscreteScheduler`], [`EulerAncestralDiscreteScheduler`], [`DPMSolverMultistepScheduler`], or [`PNDMScheduler`]. """ def __init__( self, vqvae: VQModel, unet: UNet2DModel, scheduler: Union[ DDIMScheduler, PNDMScheduler, LMSDiscreteScheduler, EulerDiscreteScheduler, EulerAncestralDiscreteScheduler, DPMSolverMultistepScheduler, ], ): super().__init__() self.register_modules(vqvae=vqvae, unet=unet, scheduler=scheduler) @torch.no_grad() def __call__( self, image: Union[torch.Tensor, PIL.Image.Image] = None, batch_size: Optional[int] = 1, num_inference_steps: Optional[int] = 100, eta: Optional[float] = 0.0, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, output_type: Optional[str] = "pil", return_dict: bool = True, ) -> Union[Tuple, ImagePipelineOutput]: r""" The call function to the pipeline for generation. Args: image (`torch.Tensor` or `PIL.Image.Image`): `Image` or tensor representing an image batch to be used as the starting point for the process. batch_size (`int`, *optional*, defaults to 1): Number of images to generate. num_inference_steps (`int`, *optional*, defaults to 100): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. eta (`float`, *optional*, defaults to 0.0): Corresponds to parameter eta (η) from the [DDIM](https://arxiv.org/abs/2010.02502) paper. Only applies to the [`~schedulers.DDIMScheduler`], and is ignored in other schedulers. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): A [`torch.Generator`](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generated image. Choose between `PIL.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`ImagePipelineOutput`] instead of a plain tuple. Example: ```py >>> import requests >>> from PIL import Image >>> from io import BytesIO >>> from diffusers import LDMSuperResolutionPipeline >>> import torch >>> # load model and scheduler >>> pipeline = LDMSuperResolutionPipeline.from_pretrained("CompVis/ldm-super-resolution-4x-openimages") >>> pipeline = pipeline.to("cuda") >>> # let's download an image >>> url = ( ... "https://user-images.githubusercontent.com/38061659/199705896-b48e17b8-b231-47cd-a270-4ffa5a93fa3e.png" ... ) >>> response = requests.get(url) >>> low_res_img = Image.open(BytesIO(response.content)).convert("RGB") >>> low_res_img = low_res_img.resize((128, 128)) >>> # run pipeline in inference (sample random noise and denoise) >>> upscaled_image = pipeline(low_res_img, num_inference_steps=100, eta=1).images[0] >>> # save image >>> upscaled_image.save("ldm_generated_image.png") ``` Returns: [`~pipelines.ImagePipelineOutput`] or `tuple`: If `return_dict` is `True`, [`~pipelines.ImagePipelineOutput`] is returned, otherwise a `tuple` is returned where the first element is a list with the generated images """ if isinstance(image, PIL.Image.Image): batch_size = 1 elif isinstance(image, torch.Tensor): batch_size = image.shape[0] else: raise ValueError(f"`image` has to be of type `PIL.Image.Image` or `torch.Tensor` but is {type(image)}") if isinstance(image, PIL.Image.Image): image = preprocess(image) height, width = image.shape[-2:] # in_channels should be 6: 3 for latents, 3 for low resolution image latents_shape = (batch_size, self.unet.config.in_channels // 2, height, width) latents_dtype = next(self.unet.parameters()).dtype latents = randn_tensor(latents_shape, generator=generator, device=self.device, dtype=latents_dtype) image = image.to(device=self.device, dtype=latents_dtype) # set timesteps and move to the correct device self.scheduler.set_timesteps(num_inference_steps, device=self.device) timesteps_tensor = self.scheduler.timesteps # scale the initial noise by the standard deviation required by the scheduler latents = latents * self.scheduler.init_noise_sigma # prepare extra kwargs for the scheduler step, since not all schedulers have the same signature. # eta (η) is only used with the DDIMScheduler, it will be ignored for other schedulers. # eta corresponds to η in DDIM paper: https://arxiv.org/abs/2010.02502 # and should be between [0, 1] accepts_eta = "eta" in set(inspect.signature(self.scheduler.step).parameters.keys()) extra_kwargs = {} if accepts_eta: extra_kwargs["eta"] = eta for t in self.progress_bar(timesteps_tensor): # concat latents and low resolution image in the channel dimension. latents_input = torch.cat([latents, image], dim=1) latents_input = self.scheduler.scale_model_input(latents_input, t) # predict the noise residual noise_pred = self.unet(latents_input, t).sample # compute the previous noisy sample x_t -> x_t-1 latents = self.scheduler.step(noise_pred, t, latents, **extra_kwargs).prev_sample # decode the image latents with the VQVAE image = self.vqvae.decode(latents).sample image = torch.clamp(image, -1.0, 1.0) image = image / 2 + 0.5 image = image.cpu().permute(0, 2, 3, 1).numpy() if output_type == "pil": image = self.numpy_to_pil(image) if not return_dict: return (image,) return ImagePipelineOutput(images=image)
diffusers/src/diffusers/pipelines/latent_diffusion/pipeline_latent_diffusion_superresolution.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/latent_diffusion/pipeline_latent_diffusion_superresolution.py", "repo_id": "diffusers", "token_count": 3451 }
134
from typing import TYPE_CHECKING from ...utils import ( DIFFUSERS_SLOW_IMPORT, OptionalDependencyNotAvailable, _LazyModule, get_objects_from_module, is_torch_available, is_transformers_available, ) _dummy_objects = {} _import_structure = {} try: if not (is_transformers_available() and is_torch_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ...utils import dummy_torch_and_transformers_objects # noqa F403 _dummy_objects.update(get_objects_from_module(dummy_torch_and_transformers_objects)) else: _import_structure["pipeline_pixart_alpha"] = ["PixArtAlphaPipeline"] if TYPE_CHECKING or DIFFUSERS_SLOW_IMPORT: try: if not (is_transformers_available() and is_torch_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ...utils.dummy_torch_and_transformers_objects import * else: from .pipeline_pixart_alpha import PixArtAlphaPipeline else: import sys sys.modules[__name__] = _LazyModule( __name__, globals()["__file__"], _import_structure, module_spec=__spec__, ) for name, value in _dummy_objects.items(): setattr(sys.modules[__name__], name, value)
diffusers/src/diffusers/pipelines/pixart_alpha/__init__.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/pixart_alpha/__init__.py", "repo_id": "diffusers", "token_count": 519 }
135
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import warnings from typing import Callable, List, Optional, Union import numpy as np import PIL.Image import torch import torch.nn.functional as F from transformers import CLIPTextModel, CLIPTokenizer from ...image_processor import PipelineImageInput, VaeImageProcessor from ...loaders import FromSingleFileMixin from ...models import AutoencoderKL, UNet2DConditionModel from ...schedulers import EulerDiscreteScheduler from ...utils import deprecate, logging from ...utils.torch_utils import randn_tensor from ..pipeline_utils import DiffusionPipeline, ImagePipelineOutput, StableDiffusionMixin logger = logging.get_logger(__name__) # pylint: disable=invalid-name # Copied from diffusers.pipelines.stable_diffusion.pipeline_stable_diffusion_upscale.preprocess def preprocess(image): warnings.warn( "The preprocess method is deprecated and will be removed in a future version. Please" " use VaeImageProcessor.preprocess instead", FutureWarning, ) if isinstance(image, torch.Tensor): return image elif isinstance(image, PIL.Image.Image): image = [image] if isinstance(image[0], PIL.Image.Image): w, h = image[0].size w, h = (x - x % 64 for x in (w, h)) # resize to integer multiple of 64 image = [np.array(i.resize((w, h)))[None, :] for i in image] image = np.concatenate(image, axis=0) image = np.array(image).astype(np.float32) / 255.0 image = image.transpose(0, 3, 1, 2) image = 2.0 * image - 1.0 image = torch.from_numpy(image) elif isinstance(image[0], torch.Tensor): image = torch.cat(image, dim=0) return image class StableDiffusionLatentUpscalePipeline(DiffusionPipeline, StableDiffusionMixin, FromSingleFileMixin): r""" Pipeline for upscaling Stable Diffusion output image resolution by a factor of 2. This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods implemented for all pipelines (downloading, saving, running on a particular device, etc.). The pipeline also inherits the following loading methods: - [`~loaders.FromSingleFileMixin.from_single_file`] for loading `.ckpt` files Args: vae ([`AutoencoderKL`]): Variational Auto-Encoder (VAE) model to encode and decode images to and from latent representations. text_encoder ([`~transformers.CLIPTextModel`]): Frozen text-encoder ([clip-vit-large-patch14](https://huggingface.co/openai/clip-vit-large-patch14)). tokenizer ([`~transformers.CLIPTokenizer`]): A `CLIPTokenizer` to tokenize text. unet ([`UNet2DConditionModel`]): A `UNet2DConditionModel` to denoise the encoded image latents. scheduler ([`SchedulerMixin`]): A [`EulerDiscreteScheduler`] to be used in combination with `unet` to denoise the encoded image latents. """ model_cpu_offload_seq = "text_encoder->unet->vae" def __init__( self, vae: AutoencoderKL, text_encoder: CLIPTextModel, tokenizer: CLIPTokenizer, unet: UNet2DConditionModel, scheduler: EulerDiscreteScheduler, ): super().__init__() self.register_modules( vae=vae, text_encoder=text_encoder, tokenizer=tokenizer, unet=unet, scheduler=scheduler, ) self.vae_scale_factor = 2 ** (len(self.vae.config.block_out_channels) - 1) self.image_processor = VaeImageProcessor(vae_scale_factor=self.vae_scale_factor, resample="bicubic") def _encode_prompt(self, prompt, device, do_classifier_free_guidance, negative_prompt): r""" Encodes the prompt into text encoder hidden states. Args: prompt (`str` or `list(int)`): prompt to be encoded device: (`torch.device`): torch device do_classifier_free_guidance (`bool`): whether to use classifier free guidance or not negative_prompt (`str` or `List[str]`): The prompt or prompts not to guide the image generation. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). """ batch_size = len(prompt) if isinstance(prompt, list) else 1 text_inputs = self.tokenizer( prompt, padding="max_length", max_length=self.tokenizer.model_max_length, truncation=True, return_length=True, return_tensors="pt", ) text_input_ids = text_inputs.input_ids untruncated_ids = self.tokenizer(prompt, padding="longest", return_tensors="pt").input_ids if untruncated_ids.shape[-1] >= text_input_ids.shape[-1] and not torch.equal(text_input_ids, untruncated_ids): removed_text = self.tokenizer.batch_decode(untruncated_ids[:, self.tokenizer.model_max_length - 1 : -1]) logger.warning( "The following part of your input was truncated because CLIP can only handle sequences up to" f" {self.tokenizer.model_max_length} tokens: {removed_text}" ) text_encoder_out = self.text_encoder( text_input_ids.to(device), output_hidden_states=True, ) text_embeddings = text_encoder_out.hidden_states[-1] text_pooler_out = text_encoder_out.pooler_output # get unconditional embeddings for classifier free guidance if do_classifier_free_guidance: uncond_tokens: List[str] if negative_prompt is None: uncond_tokens = [""] * batch_size elif type(prompt) is not type(negative_prompt): raise TypeError( f"`negative_prompt` should be the same type to `prompt`, but got {type(negative_prompt)} !=" f" {type(prompt)}." ) elif isinstance(negative_prompt, str): uncond_tokens = [negative_prompt] elif batch_size != len(negative_prompt): raise ValueError( f"`negative_prompt`: {negative_prompt} has batch size {len(negative_prompt)}, but `prompt`:" f" {prompt} has batch size {batch_size}. Please make sure that passed `negative_prompt` matches" " the batch size of `prompt`." ) else: uncond_tokens = negative_prompt max_length = text_input_ids.shape[-1] uncond_input = self.tokenizer( uncond_tokens, padding="max_length", max_length=max_length, truncation=True, return_length=True, return_tensors="pt", ) uncond_encoder_out = self.text_encoder( uncond_input.input_ids.to(device), output_hidden_states=True, ) uncond_embeddings = uncond_encoder_out.hidden_states[-1] uncond_pooler_out = uncond_encoder_out.pooler_output # For classifier free guidance, we need to do two forward passes. # Here we concatenate the unconditional and text embeddings into a single batch # to avoid doing two forward passes text_embeddings = torch.cat([uncond_embeddings, text_embeddings]) text_pooler_out = torch.cat([uncond_pooler_out, text_pooler_out]) return text_embeddings, text_pooler_out # Copied from diffusers.pipelines.stable_diffusion.pipeline_stable_diffusion.StableDiffusionPipeline.decode_latents def decode_latents(self, latents): deprecation_message = "The decode_latents method is deprecated and will be removed in 1.0.0. Please use VaeImageProcessor.postprocess(...) instead" deprecate("decode_latents", "1.0.0", deprecation_message, standard_warn=False) latents = 1 / self.vae.config.scaling_factor * latents image = self.vae.decode(latents, return_dict=False)[0] image = (image / 2 + 0.5).clamp(0, 1) # we always cast to float32 as this does not cause significant overhead and is compatible with bfloat16 image = image.cpu().permute(0, 2, 3, 1).float().numpy() return image def check_inputs(self, prompt, image, callback_steps): if not isinstance(prompt, str) and not isinstance(prompt, list): raise ValueError(f"`prompt` has to be of type `str` or `list` but is {type(prompt)}") if ( not isinstance(image, torch.Tensor) and not isinstance(image, PIL.Image.Image) and not isinstance(image, list) ): raise ValueError( f"`image` has to be of type `torch.Tensor`, `PIL.Image.Image` or `list` but is {type(image)}" ) # verify batch size of prompt and image are same if image is a list or tensor if isinstance(image, list) or isinstance(image, torch.Tensor): if isinstance(prompt, str): batch_size = 1 else: batch_size = len(prompt) if isinstance(image, list): image_batch_size = len(image) else: image_batch_size = image.shape[0] if image.ndim == 4 else 1 if batch_size != image_batch_size: raise ValueError( f"`prompt` has batch size {batch_size} and `image` has batch size {image_batch_size}." " Please make sure that passed `prompt` matches the batch size of `image`." ) if (callback_steps is None) or ( callback_steps is not None and (not isinstance(callback_steps, int) or callback_steps <= 0) ): raise ValueError( f"`callback_steps` has to be a positive integer but is {callback_steps} of type" f" {type(callback_steps)}." ) # Copied from diffusers.pipelines.stable_diffusion.pipeline_stable_diffusion_upscale.StableDiffusionUpscalePipeline.prepare_latents def prepare_latents(self, batch_size, num_channels_latents, height, width, dtype, device, generator, latents=None): shape = (batch_size, num_channels_latents, height, width) if latents is None: latents = randn_tensor(shape, generator=generator, device=device, dtype=dtype) else: if latents.shape != shape: raise ValueError(f"Unexpected latents shape, got {latents.shape}, expected {shape}") latents = latents.to(device) # scale the initial noise by the standard deviation required by the scheduler latents = latents * self.scheduler.init_noise_sigma return latents @torch.no_grad() def __call__( self, prompt: Union[str, List[str]], image: PipelineImageInput = None, num_inference_steps: int = 75, guidance_scale: float = 9.0, negative_prompt: Optional[Union[str, List[str]]] = None, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, latents: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", return_dict: bool = True, callback: Optional[Callable[[int, int, torch.FloatTensor], None]] = None, callback_steps: int = 1, ): r""" The call function to the pipeline for generation. Args: prompt (`str` or `List[str]`): The prompt or prompts to guide image upscaling. image (`torch.FloatTensor`, `PIL.Image.Image`, `np.ndarray`, `List[torch.FloatTensor]`, `List[PIL.Image.Image]`, or `List[np.ndarray]`): `Image` or tensor representing an image batch to be upscaled. If it's a tensor, it can be either a latent output from a Stable Diffusion model or an image tensor in the range `[-1, 1]`. It is considered a `latent` if `image.shape[1]` is `4`; otherwise, it is considered to be an image representation and encoded using this pipeline's `vae` encoder. num_inference_steps (`int`, *optional*, defaults to 50): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. guidance_scale (`float`, *optional*, defaults to 7.5): A higher guidance scale value encourages the model to generate images closely linked to the text `prompt` at the expense of lower image quality. Guidance scale is enabled when `guidance_scale > 1`. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts to guide what to not include in image generation. If not defined, you need to pass `negative_prompt_embeds` instead. Ignored when not using guidance (`guidance_scale < 1`). eta (`float`, *optional*, defaults to 0.0): Corresponds to parameter eta (η) from the [DDIM](https://arxiv.org/abs/2010.02502) paper. Only applies to the [`~schedulers.DDIMScheduler`], and is ignored in other schedulers. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): A [`torch.Generator`](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. latents (`torch.FloatTensor`, *optional*): Pre-generated noisy latents sampled from a Gaussian distribution, to be used as inputs for image generation. Can be used to tweak the same generation with different prompts. If not provided, a latents tensor is generated by sampling using the supplied random `generator`. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generated image. Choose between `PIL.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] instead of a plain tuple. callback (`Callable`, *optional*): A function that calls every `callback_steps` steps during inference. The function is called with the following arguments: `callback(step: int, timestep: int, latents: torch.FloatTensor)`. callback_steps (`int`, *optional*, defaults to 1): The frequency at which the `callback` function is called. If not specified, the callback is called at every step. Examples: ```py >>> from diffusers import StableDiffusionLatentUpscalePipeline, StableDiffusionPipeline >>> import torch >>> pipeline = StableDiffusionPipeline.from_pretrained( ... "CompVis/stable-diffusion-v1-4", torch_dtype=torch.float16 ... ) >>> pipeline.to("cuda") >>> model_id = "stabilityai/sd-x2-latent-upscaler" >>> upscaler = StableDiffusionLatentUpscalePipeline.from_pretrained(model_id, torch_dtype=torch.float16) >>> upscaler.to("cuda") >>> prompt = "a photo of an astronaut high resolution, unreal engine, ultra realistic" >>> generator = torch.manual_seed(33) >>> low_res_latents = pipeline(prompt, generator=generator, output_type="latent").images >>> with torch.no_grad(): ... image = pipeline.decode_latents(low_res_latents) >>> image = pipeline.numpy_to_pil(image)[0] >>> image.save("../images/a1.png") >>> upscaled_image = upscaler( ... prompt=prompt, ... image=low_res_latents, ... num_inference_steps=20, ... guidance_scale=0, ... generator=generator, ... ).images[0] >>> upscaled_image.save("../images/a2.png") ``` Returns: [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] or `tuple`: If `return_dict` is `True`, [`~pipelines.stable_diffusion.StableDiffusionPipelineOutput`] is returned, otherwise a `tuple` is returned where the first element is a list with the generated images. """ # 1. Check inputs self.check_inputs(prompt, image, callback_steps) # 2. Define call parameters batch_size = 1 if isinstance(prompt, str) else len(prompt) device = self._execution_device # here `guidance_scale` is defined analog to the guidance weight `w` of equation (2) # of the Imagen paper: https://arxiv.org/pdf/2205.11487.pdf . `guidance_scale = 1` # corresponds to doing no classifier free guidance. do_classifier_free_guidance = guidance_scale > 1.0 if guidance_scale == 0: prompt = [""] * batch_size # 3. Encode input prompt text_embeddings, text_pooler_out = self._encode_prompt( prompt, device, do_classifier_free_guidance, negative_prompt ) # 4. Preprocess image image = self.image_processor.preprocess(image) image = image.to(dtype=text_embeddings.dtype, device=device) if image.shape[1] == 3: # encode image if not in latent-space yet image = self.vae.encode(image).latent_dist.sample() * self.vae.config.scaling_factor # 5. set timesteps self.scheduler.set_timesteps(num_inference_steps, device=device) timesteps = self.scheduler.timesteps batch_multiplier = 2 if do_classifier_free_guidance else 1 image = image[None, :] if image.ndim == 3 else image image = torch.cat([image] * batch_multiplier) # 5. Add noise to image (set to be 0): # (see below notes from the author): # "the This step theoretically can make the model work better on out-of-distribution inputs, but mostly just seems to make it match the input less, so it's turned off by default." noise_level = torch.tensor([0.0], dtype=torch.float32, device=device) noise_level = torch.cat([noise_level] * image.shape[0]) inv_noise_level = (noise_level**2 + 1) ** (-0.5) image_cond = F.interpolate(image, scale_factor=2, mode="nearest") * inv_noise_level[:, None, None, None] image_cond = image_cond.to(text_embeddings.dtype) noise_level_embed = torch.cat( [ torch.ones(text_pooler_out.shape[0], 64, dtype=text_pooler_out.dtype, device=device), torch.zeros(text_pooler_out.shape[0], 64, dtype=text_pooler_out.dtype, device=device), ], dim=1, ) timestep_condition = torch.cat([noise_level_embed, text_pooler_out], dim=1) # 6. Prepare latent variables height, width = image.shape[2:] num_channels_latents = self.vae.config.latent_channels latents = self.prepare_latents( batch_size, num_channels_latents, height * 2, # 2x upscale width * 2, text_embeddings.dtype, device, generator, latents, ) # 7. Check that sizes of image and latents match num_channels_image = image.shape[1] if num_channels_latents + num_channels_image != self.unet.config.in_channels: raise ValueError( f"Incorrect configuration settings! The config of `pipeline.unet`: {self.unet.config} expects" f" {self.unet.config.in_channels} but received `num_channels_latents`: {num_channels_latents} +" f" `num_channels_image`: {num_channels_image} " f" = {num_channels_latents+num_channels_image}. Please verify the config of" " `pipeline.unet` or your `image` input." ) # 9. Denoising loop num_warmup_steps = 0 with self.progress_bar(total=num_inference_steps) as progress_bar: for i, t in enumerate(timesteps): sigma = self.scheduler.sigmas[i] # expand the latents if we are doing classifier free guidance latent_model_input = torch.cat([latents] * 2) if do_classifier_free_guidance else latents scaled_model_input = self.scheduler.scale_model_input(latent_model_input, t) scaled_model_input = torch.cat([scaled_model_input, image_cond], dim=1) # preconditioning parameter based on Karras et al. (2022) (table 1) timestep = torch.log(sigma) * 0.25 noise_pred = self.unet( scaled_model_input, timestep, encoder_hidden_states=text_embeddings, timestep_cond=timestep_condition, ).sample # in original repo, the output contains a variance channel that's not used noise_pred = noise_pred[:, :-1] # apply preconditioning, based on table 1 in Karras et al. (2022) inv_sigma = 1 / (sigma**2 + 1) noise_pred = inv_sigma * latent_model_input + self.scheduler.scale_model_input(sigma, t) * noise_pred # perform guidance if do_classifier_free_guidance: noise_pred_uncond, noise_pred_text = noise_pred.chunk(2) noise_pred = noise_pred_uncond + guidance_scale * (noise_pred_text - noise_pred_uncond) # compute the previous noisy sample x_t -> x_t-1 latents = self.scheduler.step(noise_pred, t, latents).prev_sample # call the callback, if provided if i == len(timesteps) - 1 or ((i + 1) > num_warmup_steps and (i + 1) % self.scheduler.order == 0): progress_bar.update() if callback is not None and i % callback_steps == 0: step_idx = i // getattr(self.scheduler, "order", 1) callback(step_idx, t, latents) if not output_type == "latent": image = self.vae.decode(latents / self.vae.config.scaling_factor, return_dict=False)[0] else: image = latents image = self.image_processor.postprocess(image, output_type=output_type) self.maybe_free_model_hooks() if not return_dict: return (image,) return ImagePipelineOutput(images=image)
diffusers/src/diffusers/pipelines/stable_diffusion/pipeline_stable_diffusion_latent_upscale.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/stable_diffusion/pipeline_stable_diffusion_latent_upscale.py", "repo_id": "diffusers", "token_count": 10182 }
136
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import importlib import inspect from typing import List, Optional, Tuple, Union import torch from k_diffusion.external import CompVisDenoiser, CompVisVDenoiser from k_diffusion.sampling import BrownianTreeNoiseSampler, get_sigmas_karras from transformers import ( CLIPTextModel, CLIPTextModelWithProjection, CLIPTokenizer, ) from ...image_processor import VaeImageProcessor from ...loaders import ( FromSingleFileMixin, IPAdapterMixin, StableDiffusionXLLoraLoaderMixin, TextualInversionLoaderMixin, ) from ...models import AutoencoderKL, UNet2DConditionModel from ...models.attention_processor import ( AttnProcessor2_0, FusedAttnProcessor2_0, LoRAAttnProcessor2_0, LoRAXFormersAttnProcessor, XFormersAttnProcessor, ) from ...models.lora import adjust_lora_scale_text_encoder from ...schedulers import KarrasDiffusionSchedulers, LMSDiscreteScheduler from ...utils import ( USE_PEFT_BACKEND, logging, replace_example_docstring, scale_lora_layers, unscale_lora_layers, ) from ...utils.torch_utils import randn_tensor from ..pipeline_utils import DiffusionPipeline, StableDiffusionMixin from ..stable_diffusion_xl.pipeline_output import StableDiffusionXLPipelineOutput logger = logging.get_logger(__name__) # pylint: disable=invalid-name EXAMPLE_DOC_STRING = """ Examples: ```py >>> import torch >>> from diffusers import StableDiffusionXLKDiffusionPipeline >>> pipe = StableDiffusionXLKDiffusionPipeline.from_pretrained( ... "stabilityai/stable-diffusion-xl-base-1.0", torch_dtype=torch.float16 ... ) >>> pipe = pipe.to("cuda") >>> pipe.set_scheduler("sample_dpmpp_2m_sde") >>> prompt = "a photo of an astronaut riding a horse on mars" >>> image = pipe(prompt).images[0] ``` """ # Copied from diffusers.pipelines.stable_diffusion_k_diffusion.pipeline_stable_diffusion_k_diffusion.ModelWrapper class ModelWrapper: def __init__(self, model, alphas_cumprod): self.model = model self.alphas_cumprod = alphas_cumprod def apply_model(self, *args, **kwargs): if len(args) == 3: encoder_hidden_states = args[-1] args = args[:2] if kwargs.get("cond", None) is not None: encoder_hidden_states = kwargs.pop("cond") return self.model(*args, encoder_hidden_states=encoder_hidden_states, **kwargs).sample class StableDiffusionXLKDiffusionPipeline( DiffusionPipeline, StableDiffusionMixin, FromSingleFileMixin, StableDiffusionXLLoraLoaderMixin, TextualInversionLoaderMixin, IPAdapterMixin, ): r""" Pipeline for text-to-image generation using Stable Diffusion XL and k-diffusion. This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods the library implements for all the pipelines (such as downloading or saving, running on a particular device, etc.) The pipeline also inherits the following loading methods: - [`~loaders.TextualInversionLoaderMixin.load_textual_inversion`] for loading textual inversion embeddings - [`~loaders.FromSingleFileMixin.from_single_file`] for loading `.ckpt` files - [`~loaders.StableDiffusionXLLoraLoaderMixin.load_lora_weights`] for loading LoRA weights - [`~loaders.StableDiffusionXLLoraLoaderMixin.save_lora_weights`] for saving LoRA weights - [`~loaders.IPAdapterMixin.load_ip_adapter`] for loading IP Adapters Args: vae ([`AutoencoderKL`]): Variational Auto-Encoder (VAE) Model to encode and decode images to and from latent representations. text_encoder ([`CLIPTextModel`]): Frozen text-encoder. Stable Diffusion XL uses the text portion of [CLIP](https://huggingface.co/docs/transformers/model_doc/clip#transformers.CLIPTextModel), specifically the [clip-vit-large-patch14](https://huggingface.co/openai/clip-vit-large-patch14) variant. text_encoder_2 ([` CLIPTextModelWithProjection`]): Second frozen text-encoder. Stable Diffusion XL uses the text and pool portion of [CLIP](https://huggingface.co/docs/transformers/model_doc/clip#transformers.CLIPTextModelWithProjection), specifically the [laion/CLIP-ViT-bigG-14-laion2B-39B-b160k](https://huggingface.co/laion/CLIP-ViT-bigG-14-laion2B-39B-b160k) variant. tokenizer (`CLIPTokenizer`): Tokenizer of class [CLIPTokenizer](https://huggingface.co/docs/transformers/v4.21.0/en/model_doc/clip#transformers.CLIPTokenizer). tokenizer_2 (`CLIPTokenizer`): Second Tokenizer of class [CLIPTokenizer](https://huggingface.co/docs/transformers/v4.21.0/en/model_doc/clip#transformers.CLIPTokenizer). unet ([`UNet2DConditionModel`]): Conditional U-Net architecture to denoise the encoded image latents. scheduler ([`SchedulerMixin`]): A scheduler to be used in combination with `unet` to denoise the encoded image latents. Can be one of [`DDIMScheduler`], [`LMSDiscreteScheduler`], or [`PNDMScheduler`]. force_zeros_for_empty_prompt (`bool`, *optional*, defaults to `"True"`): Whether the negative prompt embeddings shall be forced to always be set to 0. Also see the config of `stabilityai/stable-diffusion-xl-base-1-0`. """ model_cpu_offload_seq = "text_encoder->text_encoder_2->unet->vae" _optional_components = [ "tokenizer", "tokenizer_2", "text_encoder", "text_encoder_2", "feature_extractor", ] def __init__( self, vae: AutoencoderKL, text_encoder: CLIPTextModel, text_encoder_2: CLIPTextModelWithProjection, tokenizer: CLIPTokenizer, tokenizer_2: CLIPTokenizer, unet: UNet2DConditionModel, scheduler: KarrasDiffusionSchedulers, force_zeros_for_empty_prompt: bool = True, ): super().__init__() # get correct sigmas from LMS scheduler = LMSDiscreteScheduler.from_config(scheduler.config) self.register_modules( vae=vae, text_encoder=text_encoder, text_encoder_2=text_encoder_2, tokenizer=tokenizer, tokenizer_2=tokenizer_2, unet=unet, scheduler=scheduler, ) self.register_to_config(force_zeros_for_empty_prompt=force_zeros_for_empty_prompt) self.vae_scale_factor = 2 ** (len(self.vae.config.block_out_channels) - 1) self.image_processor = VaeImageProcessor(vae_scale_factor=self.vae_scale_factor) self.default_sample_size = self.unet.config.sample_size model = ModelWrapper(unet, scheduler.alphas_cumprod) if scheduler.config.prediction_type == "v_prediction": self.k_diffusion_model = CompVisVDenoiser(model) else: self.k_diffusion_model = CompVisDenoiser(model) # Copied from diffusers.pipelines.stable_diffusion_k_diffusion.pipeline_stable_diffusion_k_diffusion.StableDiffusionKDiffusionPipeline.set_scheduler def set_scheduler(self, scheduler_type: str): library = importlib.import_module("k_diffusion") sampling = getattr(library, "sampling") try: self.sampler = getattr(sampling, scheduler_type) except Exception: valid_samplers = [] for s in dir(sampling): if "sample_" in s: valid_samplers.append(s) raise ValueError(f"Invalid scheduler type {scheduler_type}. Please choose one of {valid_samplers}.") # Copied from diffusers.pipelines.stable_diffusion_xl.pipeline_stable_diffusion_xl.StableDiffusionXLPipeline.encode_prompt def encode_prompt( self, prompt: str, prompt_2: Optional[str] = None, device: Optional[torch.device] = None, num_images_per_prompt: int = 1, do_classifier_free_guidance: bool = True, negative_prompt: Optional[str] = None, negative_prompt_2: Optional[str] = None, prompt_embeds: Optional[torch.FloatTensor] = None, negative_prompt_embeds: Optional[torch.FloatTensor] = None, pooled_prompt_embeds: Optional[torch.FloatTensor] = None, negative_pooled_prompt_embeds: Optional[torch.FloatTensor] = None, lora_scale: Optional[float] = None, clip_skip: Optional[int] = None, ): r""" Encodes the prompt into text encoder hidden states. Args: prompt (`str` or `List[str]`, *optional*): prompt to be encoded prompt_2 (`str` or `List[str]`, *optional*): The prompt or prompts to be sent to the `tokenizer_2` and `text_encoder_2`. If not defined, `prompt` is used in both text-encoders device: (`torch.device`): torch device num_images_per_prompt (`int`): number of images that should be generated per prompt do_classifier_free_guidance (`bool`): whether to use classifier free guidance or not negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. If not defined, one has to pass `negative_prompt_embeds` instead. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). negative_prompt_2 (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation to be sent to `tokenizer_2` and `text_encoder_2`. If not defined, `negative_prompt` is used in both text-encoders prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, text embeddings will be generated from `prompt` input argument. negative_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, negative_prompt_embeds will be generated from `negative_prompt` input argument. pooled_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated pooled text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, pooled text embeddings will be generated from `prompt` input argument. negative_pooled_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative pooled text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, pooled negative_prompt_embeds will be generated from `negative_prompt` input argument. lora_scale (`float`, *optional*): A lora scale that will be applied to all LoRA layers of the text encoder if LoRA layers are loaded. clip_skip (`int`, *optional*): Number of layers to be skipped from CLIP while computing the prompt embeddings. A value of 1 means that the output of the pre-final layer will be used for computing the prompt embeddings. """ device = device or self._execution_device # set lora scale so that monkey patched LoRA # function of text encoder can correctly access it if lora_scale is not None and isinstance(self, StableDiffusionXLLoraLoaderMixin): self._lora_scale = lora_scale # dynamically adjust the LoRA scale if self.text_encoder is not None: if not USE_PEFT_BACKEND: adjust_lora_scale_text_encoder(self.text_encoder, lora_scale) else: scale_lora_layers(self.text_encoder, lora_scale) if self.text_encoder_2 is not None: if not USE_PEFT_BACKEND: adjust_lora_scale_text_encoder(self.text_encoder_2, lora_scale) else: scale_lora_layers(self.text_encoder_2, lora_scale) prompt = [prompt] if isinstance(prompt, str) else prompt if prompt is not None: batch_size = len(prompt) else: batch_size = prompt_embeds.shape[0] # Define tokenizers and text encoders tokenizers = [self.tokenizer, self.tokenizer_2] if self.tokenizer is not None else [self.tokenizer_2] text_encoders = ( [self.text_encoder, self.text_encoder_2] if self.text_encoder is not None else [self.text_encoder_2] ) if prompt_embeds is None: prompt_2 = prompt_2 or prompt prompt_2 = [prompt_2] if isinstance(prompt_2, str) else prompt_2 # textual inversion: process multi-vector tokens if necessary prompt_embeds_list = [] prompts = [prompt, prompt_2] for prompt, tokenizer, text_encoder in zip(prompts, tokenizers, text_encoders): if isinstance(self, TextualInversionLoaderMixin): prompt = self.maybe_convert_prompt(prompt, tokenizer) text_inputs = tokenizer( prompt, padding="max_length", max_length=tokenizer.model_max_length, truncation=True, return_tensors="pt", ) text_input_ids = text_inputs.input_ids untruncated_ids = tokenizer(prompt, padding="longest", return_tensors="pt").input_ids if untruncated_ids.shape[-1] >= text_input_ids.shape[-1] and not torch.equal( text_input_ids, untruncated_ids ): removed_text = tokenizer.batch_decode(untruncated_ids[:, tokenizer.model_max_length - 1 : -1]) logger.warning( "The following part of your input was truncated because CLIP can only handle sequences up to" f" {tokenizer.model_max_length} tokens: {removed_text}" ) prompt_embeds = text_encoder(text_input_ids.to(device), output_hidden_states=True) # We are only ALWAYS interested in the pooled output of the final text encoder pooled_prompt_embeds = prompt_embeds[0] if clip_skip is None: prompt_embeds = prompt_embeds.hidden_states[-2] else: # "2" because SDXL always indexes from the penultimate layer. prompt_embeds = prompt_embeds.hidden_states[-(clip_skip + 2)] prompt_embeds_list.append(prompt_embeds) prompt_embeds = torch.concat(prompt_embeds_list, dim=-1) # get unconditional embeddings for classifier free guidance zero_out_negative_prompt = negative_prompt is None and self.config.force_zeros_for_empty_prompt if do_classifier_free_guidance and negative_prompt_embeds is None and zero_out_negative_prompt: negative_prompt_embeds = torch.zeros_like(prompt_embeds) negative_pooled_prompt_embeds = torch.zeros_like(pooled_prompt_embeds) elif do_classifier_free_guidance and negative_prompt_embeds is None: negative_prompt = negative_prompt or "" negative_prompt_2 = negative_prompt_2 or negative_prompt # normalize str to list negative_prompt = batch_size * [negative_prompt] if isinstance(negative_prompt, str) else negative_prompt negative_prompt_2 = ( batch_size * [negative_prompt_2] if isinstance(negative_prompt_2, str) else negative_prompt_2 ) uncond_tokens: List[str] if prompt is not None and type(prompt) is not type(negative_prompt): raise TypeError( f"`negative_prompt` should be the same type to `prompt`, but got {type(negative_prompt)} !=" f" {type(prompt)}." ) elif batch_size != len(negative_prompt): raise ValueError( f"`negative_prompt`: {negative_prompt} has batch size {len(negative_prompt)}, but `prompt`:" f" {prompt} has batch size {batch_size}. Please make sure that passed `negative_prompt` matches" " the batch size of `prompt`." ) else: uncond_tokens = [negative_prompt, negative_prompt_2] negative_prompt_embeds_list = [] for negative_prompt, tokenizer, text_encoder in zip(uncond_tokens, tokenizers, text_encoders): if isinstance(self, TextualInversionLoaderMixin): negative_prompt = self.maybe_convert_prompt(negative_prompt, tokenizer) max_length = prompt_embeds.shape[1] uncond_input = tokenizer( negative_prompt, padding="max_length", max_length=max_length, truncation=True, return_tensors="pt", ) negative_prompt_embeds = text_encoder( uncond_input.input_ids.to(device), output_hidden_states=True, ) # We are only ALWAYS interested in the pooled output of the final text encoder negative_pooled_prompt_embeds = negative_prompt_embeds[0] negative_prompt_embeds = negative_prompt_embeds.hidden_states[-2] negative_prompt_embeds_list.append(negative_prompt_embeds) negative_prompt_embeds = torch.concat(negative_prompt_embeds_list, dim=-1) if self.text_encoder_2 is not None: prompt_embeds = prompt_embeds.to(dtype=self.text_encoder_2.dtype, device=device) else: prompt_embeds = prompt_embeds.to(dtype=self.unet.dtype, device=device) bs_embed, seq_len, _ = prompt_embeds.shape # duplicate text embeddings for each generation per prompt, using mps friendly method prompt_embeds = prompt_embeds.repeat(1, num_images_per_prompt, 1) prompt_embeds = prompt_embeds.view(bs_embed * num_images_per_prompt, seq_len, -1) if do_classifier_free_guidance: # duplicate unconditional embeddings for each generation per prompt, using mps friendly method seq_len = negative_prompt_embeds.shape[1] if self.text_encoder_2 is not None: negative_prompt_embeds = negative_prompt_embeds.to(dtype=self.text_encoder_2.dtype, device=device) else: negative_prompt_embeds = negative_prompt_embeds.to(dtype=self.unet.dtype, device=device) negative_prompt_embeds = negative_prompt_embeds.repeat(1, num_images_per_prompt, 1) negative_prompt_embeds = negative_prompt_embeds.view(batch_size * num_images_per_prompt, seq_len, -1) pooled_prompt_embeds = pooled_prompt_embeds.repeat(1, num_images_per_prompt).view( bs_embed * num_images_per_prompt, -1 ) if do_classifier_free_guidance: negative_pooled_prompt_embeds = negative_pooled_prompt_embeds.repeat(1, num_images_per_prompt).view( bs_embed * num_images_per_prompt, -1 ) if self.text_encoder is not None: if isinstance(self, StableDiffusionXLLoraLoaderMixin) and USE_PEFT_BACKEND: # Retrieve the original scale by scaling back the LoRA layers unscale_lora_layers(self.text_encoder, lora_scale) if self.text_encoder_2 is not None: if isinstance(self, StableDiffusionXLLoraLoaderMixin) and USE_PEFT_BACKEND: # Retrieve the original scale by scaling back the LoRA layers unscale_lora_layers(self.text_encoder_2, lora_scale) return prompt_embeds, negative_prompt_embeds, pooled_prompt_embeds, negative_pooled_prompt_embeds def check_inputs( self, prompt, prompt_2, height, width, negative_prompt=None, negative_prompt_2=None, prompt_embeds=None, negative_prompt_embeds=None, pooled_prompt_embeds=None, negative_pooled_prompt_embeds=None, ): if height % 8 != 0 or width % 8 != 0: raise ValueError(f"`height` and `width` have to be divisible by 8 but are {height} and {width}.") if prompt is not None and prompt_embeds is not None: raise ValueError( f"Cannot forward both `prompt`: {prompt} and `prompt_embeds`: {prompt_embeds}. Please make sure to" " only forward one of the two." ) elif prompt_2 is not None and prompt_embeds is not None: raise ValueError( f"Cannot forward both `prompt_2`: {prompt_2} and `prompt_embeds`: {prompt_embeds}. Please make sure to" " only forward one of the two." ) elif prompt is None and prompt_embeds is None: raise ValueError( "Provide either `prompt` or `prompt_embeds`. Cannot leave both `prompt` and `prompt_embeds` undefined." ) elif prompt is not None and (not isinstance(prompt, str) and not isinstance(prompt, list)): raise ValueError(f"`prompt` has to be of type `str` or `list` but is {type(prompt)}") elif prompt_2 is not None and (not isinstance(prompt_2, str) and not isinstance(prompt_2, list)): raise ValueError(f"`prompt_2` has to be of type `str` or `list` but is {type(prompt_2)}") if negative_prompt is not None and negative_prompt_embeds is not None: raise ValueError( f"Cannot forward both `negative_prompt`: {negative_prompt} and `negative_prompt_embeds`:" f" {negative_prompt_embeds}. Please make sure to only forward one of the two." ) elif negative_prompt_2 is not None and negative_prompt_embeds is not None: raise ValueError( f"Cannot forward both `negative_prompt_2`: {negative_prompt_2} and `negative_prompt_embeds`:" f" {negative_prompt_embeds}. Please make sure to only forward one of the two." ) if prompt_embeds is not None and negative_prompt_embeds is not None: if prompt_embeds.shape != negative_prompt_embeds.shape: raise ValueError( "`prompt_embeds` and `negative_prompt_embeds` must have the same shape when passed directly, but" f" got: `prompt_embeds` {prompt_embeds.shape} != `negative_prompt_embeds`" f" {negative_prompt_embeds.shape}." ) if prompt_embeds is not None and pooled_prompt_embeds is None: raise ValueError( "If `prompt_embeds` are provided, `pooled_prompt_embeds` also have to be passed. Make sure to generate `pooled_prompt_embeds` from the same text encoder that was used to generate `prompt_embeds`." ) if negative_prompt_embeds is not None and negative_pooled_prompt_embeds is None: raise ValueError( "If `negative_prompt_embeds` are provided, `negative_pooled_prompt_embeds` also have to be passed. Make sure to generate `negative_pooled_prompt_embeds` from the same text encoder that was used to generate `negative_prompt_embeds`." ) def prepare_latents(self, batch_size, num_channels_latents, height, width, dtype, device, generator, latents=None): shape = (batch_size, num_channels_latents, height // self.vae_scale_factor, width // self.vae_scale_factor) if isinstance(generator, list) and len(generator) != batch_size: raise ValueError( f"You have passed a list of generators of length {len(generator)}, but requested an effective batch" f" size of {batch_size}. Make sure the batch size matches the length of the generators." ) if latents is None: latents = randn_tensor(shape, generator=generator, device=device, dtype=dtype) else: latents = latents.to(device) return latents # Copied from diffusers.pipelines.stable_diffusion_xl.pipeline_stable_diffusion_xl.StableDiffusionXLPipeline._get_add_time_ids def _get_add_time_ids( self, original_size, crops_coords_top_left, target_size, dtype, text_encoder_projection_dim=None ): add_time_ids = list(original_size + crops_coords_top_left + target_size) passed_add_embed_dim = ( self.unet.config.addition_time_embed_dim * len(add_time_ids) + text_encoder_projection_dim ) expected_add_embed_dim = self.unet.add_embedding.linear_1.in_features if expected_add_embed_dim != passed_add_embed_dim: raise ValueError( f"Model expects an added time embedding vector of length {expected_add_embed_dim}, but a vector of {passed_add_embed_dim} was created. The model has an incorrect config. Please check `unet.config.time_embedding_type` and `text_encoder_2.config.projection_dim`." ) add_time_ids = torch.tensor([add_time_ids], dtype=dtype) return add_time_ids # Copied from diffusers.pipelines.stable_diffusion_xl.pipeline_stable_diffusion_xl.StableDiffusionXLPipeline.upcast_vae def upcast_vae(self): dtype = self.vae.dtype self.vae.to(dtype=torch.float32) use_torch_2_0_or_xformers = isinstance( self.vae.decoder.mid_block.attentions[0].processor, ( AttnProcessor2_0, XFormersAttnProcessor, LoRAXFormersAttnProcessor, LoRAAttnProcessor2_0, FusedAttnProcessor2_0, ), ) # if xformers or torch_2_0 is used attention block does not need # to be in float32 which can save lots of memory if use_torch_2_0_or_xformers: self.vae.post_quant_conv.to(dtype) self.vae.decoder.conv_in.to(dtype) self.vae.decoder.mid_block.to(dtype) @property def guidance_scale(self): return self._guidance_scale @property def clip_skip(self): return self._clip_skip # here `guidance_scale` is defined analog to the guidance weight `w` of equation (2) # of the Imagen paper: https://arxiv.org/pdf/2205.11487.pdf . `guidance_scale = 1` # corresponds to doing no classifier free guidance. @property def do_classifier_free_guidance(self): return self._guidance_scale > 1 and self.unet.config.time_cond_proj_dim is None @torch.no_grad() @replace_example_docstring(EXAMPLE_DOC_STRING) def __call__( self, prompt: Union[str, List[str]] = None, prompt_2: Optional[Union[str, List[str]]] = None, height: Optional[int] = None, width: Optional[int] = None, num_inference_steps: int = 50, guidance_scale: float = 5.0, negative_prompt: Optional[Union[str, List[str]]] = None, negative_prompt_2: Optional[Union[str, List[str]]] = None, num_images_per_prompt: Optional[int] = 1, generator: Optional[Union[torch.Generator, List[torch.Generator]]] = None, latents: Optional[torch.FloatTensor] = None, prompt_embeds: Optional[torch.FloatTensor] = None, negative_prompt_embeds: Optional[torch.FloatTensor] = None, pooled_prompt_embeds: Optional[torch.FloatTensor] = None, negative_pooled_prompt_embeds: Optional[torch.FloatTensor] = None, output_type: Optional[str] = "pil", return_dict: bool = True, original_size: Optional[Tuple[int, int]] = None, crops_coords_top_left: Tuple[int, int] = (0, 0), target_size: Optional[Tuple[int, int]] = None, negative_original_size: Optional[Tuple[int, int]] = None, negative_crops_coords_top_left: Tuple[int, int] = (0, 0), negative_target_size: Optional[Tuple[int, int]] = None, use_karras_sigmas: Optional[bool] = False, noise_sampler_seed: Optional[int] = None, clip_skip: Optional[int] = None, ): r""" Function invoked when calling the pipeline for generation. Args: prompt (`str` or `List[str]`, *optional*): The prompt or prompts to guide the image generation. If not defined, one has to pass `prompt_embeds`. instead. prompt_2 (`str` or `List[str]`, *optional*): The prompt or prompts to be sent to the `tokenizer_2` and `text_encoder_2`. If not defined, `prompt` is used in both text-encoders height (`int`, *optional*, defaults to self.unet.config.sample_size * self.vae_scale_factor): The height in pixels of the generated image. This is set to 1024 by default for the best results. Anything below 512 pixels won't work well for [stabilityai/stable-diffusion-xl-base-1.0](https://huggingface.co/stabilityai/stable-diffusion-xl-base-1.0) and checkpoints that are not specifically fine-tuned on low resolutions. width (`int`, *optional*, defaults to self.unet.config.sample_size * self.vae_scale_factor): The width in pixels of the generated image. This is set to 1024 by default for the best results. Anything below 512 pixels won't work well for [stabilityai/stable-diffusion-xl-base-1.0](https://huggingface.co/stabilityai/stable-diffusion-xl-base-1.0) and checkpoints that are not specifically fine-tuned on low resolutions. num_inference_steps (`int`, *optional*, defaults to 50): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. guidance_scale (`float`, *optional*, defaults to 5.0): Guidance scale as defined in [Classifier-Free Diffusion Guidance](https://arxiv.org/abs/2207.12598). `guidance_scale` is defined as `w` of equation 2. of [Imagen Paper](https://arxiv.org/pdf/2205.11487.pdf). Guidance scale is enabled by setting `guidance_scale > 1`. Higher guidance scale encourages to generate images that are closely linked to the text `prompt`, usually at the expense of lower image quality. negative_prompt (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation. If not defined, one has to pass `negative_prompt_embeds` instead. Ignored when not using guidance (i.e., ignored if `guidance_scale` is less than `1`). negative_prompt_2 (`str` or `List[str]`, *optional*): The prompt or prompts not to guide the image generation to be sent to `tokenizer_2` and `text_encoder_2`. If not defined, `negative_prompt` is used in both text-encoders num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. generator (`torch.Generator` or `List[torch.Generator]`, *optional*): One or a list of [torch generator(s)](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. latents (`torch.FloatTensor`, *optional*): Pre-generated noisy latents, sampled from a Gaussian distribution, to be used as inputs for image generation. Can be used to tweak the same generation with different prompts. If not provided, a latents tensor will ge generated by sampling using the supplied random `generator`. prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, text embeddings will be generated from `prompt` input argument. negative_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, negative_prompt_embeds will be generated from `negative_prompt` input argument. pooled_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated pooled text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, pooled text embeddings will be generated from `prompt` input argument. negative_pooled_prompt_embeds (`torch.FloatTensor`, *optional*): Pre-generated negative pooled text embeddings. Can be used to easily tweak text inputs, *e.g.* prompt weighting. If not provided, pooled negative_prompt_embeds will be generated from `negative_prompt` input argument. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between [PIL](https://pillow.readthedocs.io/en/stable/): `PIL.Image.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.stable_diffusion_xl.StableDiffusionXLPipelineOutput`] instead of a plain tuple. original_size (`Tuple[int]`, *optional*, defaults to (1024, 1024)): If `original_size` is not the same as `target_size` the image will appear to be down- or upsampled. `original_size` defaults to `(height, width)` if not specified. Part of SDXL's micro-conditioning as explained in section 2.2 of [https://huggingface.co/papers/2307.01952](https://huggingface.co/papers/2307.01952). crops_coords_top_left (`Tuple[int]`, *optional*, defaults to (0, 0)): `crops_coords_top_left` can be used to generate an image that appears to be "cropped" from the position `crops_coords_top_left` downwards. Favorable, well-centered images are usually achieved by setting `crops_coords_top_left` to (0, 0). Part of SDXL's micro-conditioning as explained in section 2.2 of [https://huggingface.co/papers/2307.01952](https://huggingface.co/papers/2307.01952). target_size (`Tuple[int]`, *optional*, defaults to (1024, 1024)): For most cases, `target_size` should be set to the desired height and width of the generated image. If not specified it will default to `(height, width)`. Part of SDXL's micro-conditioning as explained in section 2.2 of [https://huggingface.co/papers/2307.01952](https://huggingface.co/papers/2307.01952). negative_original_size (`Tuple[int]`, *optional*, defaults to (1024, 1024)): To negatively condition the generation process based on a specific image resolution. Part of SDXL's micro-conditioning as explained in section 2.2 of [https://huggingface.co/papers/2307.01952](https://huggingface.co/papers/2307.01952). For more information, refer to this issue thread: https://github.com/huggingface/diffusers/issues/4208. negative_crops_coords_top_left (`Tuple[int]`, *optional*, defaults to (0, 0)): To negatively condition the generation process based on a specific crop coordinates. Part of SDXL's micro-conditioning as explained in section 2.2 of [https://huggingface.co/papers/2307.01952](https://huggingface.co/papers/2307.01952). For more information, refer to this issue thread: https://github.com/huggingface/diffusers/issues/4208. negative_target_size (`Tuple[int]`, *optional*, defaults to (1024, 1024)): To negatively condition the generation process based on a target image resolution. It should be as same as the `target_size` for most cases. Part of SDXL's micro-conditioning as explained in section 2.2 of [https://huggingface.co/papers/2307.01952](https://huggingface.co/papers/2307.01952). For more information, refer to this issue thread: https://github.com/huggingface/diffusers/issues/4208. Examples: Returns: [`~pipelines.stable_diffusion_xl.StableDiffusionXLPipelineOutput`] or `tuple`: [`~pipelines.stable_diffusion_xl.StableDiffusionXLPipelineOutput`] if `return_dict` is True, otherwise a `tuple`. When returning a tuple, the first element is a list with the generated images. """ # 0. Default height and width to unet height = height or self.default_sample_size * self.vae_scale_factor width = width or self.default_sample_size * self.vae_scale_factor original_size = original_size or (height, width) target_size = target_size or (height, width) # 1. Check inputs. Raise error if not correct self.check_inputs( prompt, prompt_2, height, width, negative_prompt, negative_prompt_2, prompt_embeds, negative_prompt_embeds, pooled_prompt_embeds, negative_pooled_prompt_embeds, ) if guidance_scale <= 1.0: raise ValueError("has to use guidance_scale") self._guidance_scale = guidance_scale self._clip_skip = clip_skip # 2. Define call parameters if prompt is not None and isinstance(prompt, str): batch_size = 1 elif prompt is not None and isinstance(prompt, list): batch_size = len(prompt) else: batch_size = prompt_embeds.shape[0] device = self._execution_device # 3. Encode input prompt lora_scale = None ( prompt_embeds, negative_prompt_embeds, pooled_prompt_embeds, negative_pooled_prompt_embeds, ) = self.encode_prompt( prompt=prompt, prompt_2=prompt_2, device=device, num_images_per_prompt=num_images_per_prompt, do_classifier_free_guidance=self.do_classifier_free_guidance, negative_prompt=negative_prompt, negative_prompt_2=negative_prompt_2, prompt_embeds=prompt_embeds, negative_prompt_embeds=negative_prompt_embeds, pooled_prompt_embeds=pooled_prompt_embeds, negative_pooled_prompt_embeds=negative_pooled_prompt_embeds, lora_scale=lora_scale, clip_skip=self.clip_skip, ) # 4. Prepare timesteps self.scheduler.set_timesteps(num_inference_steps, device=prompt_embeds.device) # 5. Prepare sigmas if use_karras_sigmas: sigma_min: float = self.k_diffusion_model.sigmas[0].item() sigma_max: float = self.k_diffusion_model.sigmas[-1].item() sigmas = get_sigmas_karras(n=num_inference_steps, sigma_min=sigma_min, sigma_max=sigma_max) else: sigmas = self.scheduler.sigmas sigmas = sigmas.to(dtype=prompt_embeds.dtype, device=device) # 6. Prepare latent variables num_channels_latents = self.unet.config.in_channels latents = self.prepare_latents( batch_size * num_images_per_prompt, num_channels_latents, height, width, prompt_embeds.dtype, device, generator, latents, ) latents = latents * sigmas[0] self.k_diffusion_model.sigmas = self.k_diffusion_model.sigmas.to(latents.device) self.k_diffusion_model.log_sigmas = self.k_diffusion_model.log_sigmas.to(latents.device) # 7. Prepare added time ids & embeddings add_text_embeds = pooled_prompt_embeds if self.text_encoder_2 is None: text_encoder_projection_dim = int(pooled_prompt_embeds.shape[-1]) else: text_encoder_projection_dim = self.text_encoder_2.config.projection_dim add_time_ids = self._get_add_time_ids( original_size, crops_coords_top_left, target_size, dtype=prompt_embeds.dtype, text_encoder_projection_dim=text_encoder_projection_dim, ) if negative_original_size is not None and negative_target_size is not None: negative_add_time_ids = self._get_add_time_ids( negative_original_size, negative_crops_coords_top_left, negative_target_size, dtype=prompt_embeds.dtype, text_encoder_projection_dim=text_encoder_projection_dim, ) else: negative_add_time_ids = add_time_ids if self.do_classifier_free_guidance: prompt_embeds = torch.cat([negative_prompt_embeds, prompt_embeds], dim=0) add_text_embeds = torch.cat([negative_pooled_prompt_embeds, add_text_embeds], dim=0) add_time_ids = torch.cat([negative_add_time_ids, add_time_ids], dim=0) prompt_embeds = prompt_embeds.to(device) add_text_embeds = add_text_embeds.to(device) add_time_ids = add_time_ids.to(device).repeat(batch_size * num_images_per_prompt, 1) added_cond_kwargs = {"text_embeds": add_text_embeds, "time_ids": add_time_ids} # 8. Optionally get Guidance Scale Embedding timestep_cond = None if self.unet.config.time_cond_proj_dim is not None: guidance_scale_tensor = torch.tensor(self.guidance_scale - 1).repeat(batch_size * num_images_per_prompt) timestep_cond = self.get_guidance_scale_embedding( guidance_scale_tensor, embedding_dim=self.unet.config.time_cond_proj_dim ).to(device=device, dtype=latents.dtype) # 9. Define model function def model_fn(x, t): latent_model_input = torch.cat([x] * 2) t = torch.cat([t] * 2) noise_pred = self.k_diffusion_model( latent_model_input, t, cond=prompt_embeds, timestep_cond=timestep_cond, added_cond_kwargs=added_cond_kwargs, ) noise_pred_uncond, noise_pred_text = noise_pred.chunk(2) noise_pred = noise_pred_uncond + guidance_scale * (noise_pred_text - noise_pred_uncond) return noise_pred # 10. Run k-diffusion solver sampler_kwargs = {} if "noise_sampler" in inspect.signature(self.sampler).parameters: min_sigma, max_sigma = sigmas[sigmas > 0].min(), sigmas.max() noise_sampler = BrownianTreeNoiseSampler(latents, min_sigma, max_sigma, noise_sampler_seed) sampler_kwargs["noise_sampler"] = noise_sampler if "generator" in inspect.signature(self.sampler).parameters: sampler_kwargs["generator"] = generator latents = self.sampler(model_fn, latents, sigmas, **sampler_kwargs) if not output_type == "latent": # make sure the VAE is in float32 mode, as it overflows in float16 needs_upcasting = self.vae.dtype == torch.float16 and self.vae.config.force_upcast if needs_upcasting: self.upcast_vae() latents = latents.to(next(iter(self.vae.post_quant_conv.parameters())).dtype) image = self.vae.decode(latents / self.vae.config.scaling_factor, return_dict=False)[0] # cast back to fp16 if needed if needs_upcasting: self.vae.to(dtype=torch.float16) else: image = latents if not output_type == "latent": image = self.image_processor.postprocess(image, output_type=output_type) # Offload all models self.maybe_free_model_hooks() if not return_dict: return (image,) return StableDiffusionXLPipelineOutput(images=image)
diffusers/src/diffusers/pipelines/stable_diffusion_k_diffusion/pipeline_stable_diffusion_xl_k_diffusion.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/stable_diffusion_k_diffusion/pipeline_stable_diffusion_xl_k_diffusion.py", "repo_id": "diffusers", "token_count": 20117 }
137
# Copyright 2024 Kakao Brain and The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import inspect from typing import List, Optional, Union import PIL.Image import torch from torch.nn import functional as F from transformers import ( CLIPImageProcessor, CLIPTextModelWithProjection, CLIPTokenizer, CLIPVisionModelWithProjection, ) from ...models import UNet2DConditionModel, UNet2DModel from ...schedulers import UnCLIPScheduler from ...utils import logging from ...utils.torch_utils import randn_tensor from ..pipeline_utils import DiffusionPipeline, ImagePipelineOutput from .text_proj import UnCLIPTextProjModel logger = logging.get_logger(__name__) # pylint: disable=invalid-name class UnCLIPImageVariationPipeline(DiffusionPipeline): """ Pipeline to generate image variations from an input image using UnCLIP. This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods implemented for all pipelines (downloading, saving, running on a particular device, etc.). Args: text_encoder ([`~transformers.CLIPTextModelWithProjection`]): Frozen text-encoder. tokenizer ([`~transformers.CLIPTokenizer`]): A `CLIPTokenizer` to tokenize text. feature_extractor ([`~transformers.CLIPImageProcessor`]): Model that extracts features from generated images to be used as inputs for the `image_encoder`. image_encoder ([`~transformers.CLIPVisionModelWithProjection`]): Frozen CLIP image-encoder ([clip-vit-large-patch14](https://huggingface.co/openai/clip-vit-large-patch14)). text_proj ([`UnCLIPTextProjModel`]): Utility class to prepare and combine the embeddings before they are passed to the decoder. decoder ([`UNet2DConditionModel`]): The decoder to invert the image embedding into an image. super_res_first ([`UNet2DModel`]): Super resolution UNet. Used in all but the last step of the super resolution diffusion process. super_res_last ([`UNet2DModel`]): Super resolution UNet. Used in the last step of the super resolution diffusion process. decoder_scheduler ([`UnCLIPScheduler`]): Scheduler used in the decoder denoising process (a modified [`DDPMScheduler`]). super_res_scheduler ([`UnCLIPScheduler`]): Scheduler used in the super resolution denoising process (a modified [`DDPMScheduler`]). """ decoder: UNet2DConditionModel text_proj: UnCLIPTextProjModel text_encoder: CLIPTextModelWithProjection tokenizer: CLIPTokenizer feature_extractor: CLIPImageProcessor image_encoder: CLIPVisionModelWithProjection super_res_first: UNet2DModel super_res_last: UNet2DModel decoder_scheduler: UnCLIPScheduler super_res_scheduler: UnCLIPScheduler model_cpu_offload_seq = "text_encoder->image_encoder->text_proj->decoder->super_res_first->super_res_last" def __init__( self, decoder: UNet2DConditionModel, text_encoder: CLIPTextModelWithProjection, tokenizer: CLIPTokenizer, text_proj: UnCLIPTextProjModel, feature_extractor: CLIPImageProcessor, image_encoder: CLIPVisionModelWithProjection, super_res_first: UNet2DModel, super_res_last: UNet2DModel, decoder_scheduler: UnCLIPScheduler, super_res_scheduler: UnCLIPScheduler, ): super().__init__() self.register_modules( decoder=decoder, text_encoder=text_encoder, tokenizer=tokenizer, text_proj=text_proj, feature_extractor=feature_extractor, image_encoder=image_encoder, super_res_first=super_res_first, super_res_last=super_res_last, decoder_scheduler=decoder_scheduler, super_res_scheduler=super_res_scheduler, ) # Copied from diffusers.pipelines.unclip.pipeline_unclip.UnCLIPPipeline.prepare_latents def prepare_latents(self, shape, dtype, device, generator, latents, scheduler): if latents is None: latents = randn_tensor(shape, generator=generator, device=device, dtype=dtype) else: if latents.shape != shape: raise ValueError(f"Unexpected latents shape, got {latents.shape}, expected {shape}") latents = latents.to(device) latents = latents * scheduler.init_noise_sigma return latents def _encode_prompt(self, prompt, device, num_images_per_prompt, do_classifier_free_guidance): batch_size = len(prompt) if isinstance(prompt, list) else 1 # get prompt text embeddings text_inputs = self.tokenizer( prompt, padding="max_length", max_length=self.tokenizer.model_max_length, return_tensors="pt", ) text_input_ids = text_inputs.input_ids text_mask = text_inputs.attention_mask.bool().to(device) text_encoder_output = self.text_encoder(text_input_ids.to(device)) prompt_embeds = text_encoder_output.text_embeds text_encoder_hidden_states = text_encoder_output.last_hidden_state prompt_embeds = prompt_embeds.repeat_interleave(num_images_per_prompt, dim=0) text_encoder_hidden_states = text_encoder_hidden_states.repeat_interleave(num_images_per_prompt, dim=0) text_mask = text_mask.repeat_interleave(num_images_per_prompt, dim=0) if do_classifier_free_guidance: uncond_tokens = [""] * batch_size max_length = text_input_ids.shape[-1] uncond_input = self.tokenizer( uncond_tokens, padding="max_length", max_length=max_length, truncation=True, return_tensors="pt", ) uncond_text_mask = uncond_input.attention_mask.bool().to(device) negative_prompt_embeds_text_encoder_output = self.text_encoder(uncond_input.input_ids.to(device)) negative_prompt_embeds = negative_prompt_embeds_text_encoder_output.text_embeds uncond_text_encoder_hidden_states = negative_prompt_embeds_text_encoder_output.last_hidden_state # duplicate unconditional embeddings for each generation per prompt, using mps friendly method seq_len = negative_prompt_embeds.shape[1] negative_prompt_embeds = negative_prompt_embeds.repeat(1, num_images_per_prompt) negative_prompt_embeds = negative_prompt_embeds.view(batch_size * num_images_per_prompt, seq_len) seq_len = uncond_text_encoder_hidden_states.shape[1] uncond_text_encoder_hidden_states = uncond_text_encoder_hidden_states.repeat(1, num_images_per_prompt, 1) uncond_text_encoder_hidden_states = uncond_text_encoder_hidden_states.view( batch_size * num_images_per_prompt, seq_len, -1 ) uncond_text_mask = uncond_text_mask.repeat_interleave(num_images_per_prompt, dim=0) # done duplicates # For classifier free guidance, we need to do two forward passes. # Here we concatenate the unconditional and text embeddings into a single batch # to avoid doing two forward passes prompt_embeds = torch.cat([negative_prompt_embeds, prompt_embeds]) text_encoder_hidden_states = torch.cat([uncond_text_encoder_hidden_states, text_encoder_hidden_states]) text_mask = torch.cat([uncond_text_mask, text_mask]) return prompt_embeds, text_encoder_hidden_states, text_mask def _encode_image(self, image, device, num_images_per_prompt, image_embeddings: Optional[torch.Tensor] = None): dtype = next(self.image_encoder.parameters()).dtype if image_embeddings is None: if not isinstance(image, torch.Tensor): image = self.feature_extractor(images=image, return_tensors="pt").pixel_values image = image.to(device=device, dtype=dtype) image_embeddings = self.image_encoder(image).image_embeds image_embeddings = image_embeddings.repeat_interleave(num_images_per_prompt, dim=0) return image_embeddings @torch.no_grad() def __call__( self, image: Optional[Union[PIL.Image.Image, List[PIL.Image.Image], torch.FloatTensor]] = None, num_images_per_prompt: int = 1, decoder_num_inference_steps: int = 25, super_res_num_inference_steps: int = 7, generator: Optional[torch.Generator] = None, decoder_latents: Optional[torch.FloatTensor] = None, super_res_latents: Optional[torch.FloatTensor] = None, image_embeddings: Optional[torch.Tensor] = None, decoder_guidance_scale: float = 8.0, output_type: Optional[str] = "pil", return_dict: bool = True, ): """ The call function to the pipeline for generation. Args: image (`PIL.Image.Image` or `List[PIL.Image.Image]` or `torch.FloatTensor`): `Image` or tensor representing an image batch to be used as the starting point. If you provide a tensor, it needs to be compatible with the [`CLIPImageProcessor`] [configuration](https://huggingface.co/fusing/karlo-image-variations-diffusers/blob/main/feature_extractor/preprocessor_config.json). Can be left as `None` only when `image_embeddings` are passed. num_images_per_prompt (`int`, *optional*, defaults to 1): The number of images to generate per prompt. decoder_num_inference_steps (`int`, *optional*, defaults to 25): The number of denoising steps for the decoder. More denoising steps usually lead to a higher quality image at the expense of slower inference. super_res_num_inference_steps (`int`, *optional*, defaults to 7): The number of denoising steps for super resolution. More denoising steps usually lead to a higher quality image at the expense of slower inference. generator (`torch.Generator`, *optional*): A [`torch.Generator`](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. decoder_latents (`torch.FloatTensor` of shape (batch size, channels, height, width), *optional*): Pre-generated noisy latents to be used as inputs for the decoder. super_res_latents (`torch.FloatTensor` of shape (batch size, channels, super res height, super res width), *optional*): Pre-generated noisy latents to be used as inputs for the decoder. decoder_guidance_scale (`float`, *optional*, defaults to 4.0): A higher guidance scale value encourages the model to generate images closely linked to the text `prompt` at the expense of lower image quality. Guidance scale is enabled when `guidance_scale > 1`. image_embeddings (`torch.Tensor`, *optional*): Pre-defined image embeddings that can be derived from the image encoder. Pre-defined image embeddings can be passed for tasks like image interpolations. `image` can be left as `None`. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generated image. Choose between `PIL.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.ImagePipelineOutput`] instead of a plain tuple. Returns: [`~pipelines.ImagePipelineOutput`] or `tuple`: If `return_dict` is `True`, [`~pipelines.ImagePipelineOutput`] is returned, otherwise a `tuple` is returned where the first element is a list with the generated images. """ if image is not None: if isinstance(image, PIL.Image.Image): batch_size = 1 elif isinstance(image, list): batch_size = len(image) else: batch_size = image.shape[0] else: batch_size = image_embeddings.shape[0] prompt = [""] * batch_size device = self._execution_device batch_size = batch_size * num_images_per_prompt do_classifier_free_guidance = decoder_guidance_scale > 1.0 prompt_embeds, text_encoder_hidden_states, text_mask = self._encode_prompt( prompt, device, num_images_per_prompt, do_classifier_free_guidance ) image_embeddings = self._encode_image(image, device, num_images_per_prompt, image_embeddings) # decoder text_encoder_hidden_states, additive_clip_time_embeddings = self.text_proj( image_embeddings=image_embeddings, prompt_embeds=prompt_embeds, text_encoder_hidden_states=text_encoder_hidden_states, do_classifier_free_guidance=do_classifier_free_guidance, ) if device.type == "mps": # HACK: MPS: There is a panic when padding bool tensors, # so cast to int tensor for the pad and back to bool afterwards text_mask = text_mask.type(torch.int) decoder_text_mask = F.pad(text_mask, (self.text_proj.clip_extra_context_tokens, 0), value=1) decoder_text_mask = decoder_text_mask.type(torch.bool) else: decoder_text_mask = F.pad(text_mask, (self.text_proj.clip_extra_context_tokens, 0), value=True) self.decoder_scheduler.set_timesteps(decoder_num_inference_steps, device=device) decoder_timesteps_tensor = self.decoder_scheduler.timesteps num_channels_latents = self.decoder.config.in_channels height = self.decoder.config.sample_size width = self.decoder.config.sample_size if decoder_latents is None: decoder_latents = self.prepare_latents( (batch_size, num_channels_latents, height, width), text_encoder_hidden_states.dtype, device, generator, decoder_latents, self.decoder_scheduler, ) for i, t in enumerate(self.progress_bar(decoder_timesteps_tensor)): # expand the latents if we are doing classifier free guidance latent_model_input = torch.cat([decoder_latents] * 2) if do_classifier_free_guidance else decoder_latents noise_pred = self.decoder( sample=latent_model_input, timestep=t, encoder_hidden_states=text_encoder_hidden_states, class_labels=additive_clip_time_embeddings, attention_mask=decoder_text_mask, ).sample if do_classifier_free_guidance: noise_pred_uncond, noise_pred_text = noise_pred.chunk(2) noise_pred_uncond, _ = noise_pred_uncond.split(latent_model_input.shape[1], dim=1) noise_pred_text, predicted_variance = noise_pred_text.split(latent_model_input.shape[1], dim=1) noise_pred = noise_pred_uncond + decoder_guidance_scale * (noise_pred_text - noise_pred_uncond) noise_pred = torch.cat([noise_pred, predicted_variance], dim=1) if i + 1 == decoder_timesteps_tensor.shape[0]: prev_timestep = None else: prev_timestep = decoder_timesteps_tensor[i + 1] # compute the previous noisy sample x_t -> x_t-1 decoder_latents = self.decoder_scheduler.step( noise_pred, t, decoder_latents, prev_timestep=prev_timestep, generator=generator ).prev_sample decoder_latents = decoder_latents.clamp(-1, 1) image_small = decoder_latents # done decoder # super res self.super_res_scheduler.set_timesteps(super_res_num_inference_steps, device=device) super_res_timesteps_tensor = self.super_res_scheduler.timesteps channels = self.super_res_first.config.in_channels // 2 height = self.super_res_first.config.sample_size width = self.super_res_first.config.sample_size if super_res_latents is None: super_res_latents = self.prepare_latents( (batch_size, channels, height, width), image_small.dtype, device, generator, super_res_latents, self.super_res_scheduler, ) if device.type == "mps": # MPS does not support many interpolations image_upscaled = F.interpolate(image_small, size=[height, width]) else: interpolate_antialias = {} if "antialias" in inspect.signature(F.interpolate).parameters: interpolate_antialias["antialias"] = True image_upscaled = F.interpolate( image_small, size=[height, width], mode="bicubic", align_corners=False, **interpolate_antialias ) for i, t in enumerate(self.progress_bar(super_res_timesteps_tensor)): # no classifier free guidance if i == super_res_timesteps_tensor.shape[0] - 1: unet = self.super_res_last else: unet = self.super_res_first latent_model_input = torch.cat([super_res_latents, image_upscaled], dim=1) noise_pred = unet( sample=latent_model_input, timestep=t, ).sample if i + 1 == super_res_timesteps_tensor.shape[0]: prev_timestep = None else: prev_timestep = super_res_timesteps_tensor[i + 1] # compute the previous noisy sample x_t -> x_t-1 super_res_latents = self.super_res_scheduler.step( noise_pred, t, super_res_latents, prev_timestep=prev_timestep, generator=generator ).prev_sample image = super_res_latents # done super res self.maybe_free_model_hooks() # post processing image = image * 0.5 + 0.5 image = image.clamp(0, 1) image = image.cpu().permute(0, 2, 3, 1).float().numpy() if output_type == "pil": image = self.numpy_to_pil(image) if not return_dict: return (image,) return ImagePipelineOutput(images=image)
diffusers/src/diffusers/pipelines/unclip/pipeline_unclip_image_variation.py/0
{ "file_path": "diffusers/src/diffusers/pipelines/unclip/pipeline_unclip_image_variation.py", "repo_id": "diffusers", "token_count": 8369 }
138
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from typing import TYPE_CHECKING from ..utils import ( DIFFUSERS_SLOW_IMPORT, OptionalDependencyNotAvailable, _LazyModule, get_objects_from_module, is_flax_available, is_scipy_available, is_torch_available, is_torchsde_available, ) _dummy_modules = {} _import_structure = {} try: if not is_torch_available(): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils import dummy_pt_objects # noqa F403 _dummy_modules.update(get_objects_from_module(dummy_pt_objects)) else: _import_structure["deprecated"] = ["KarrasVeScheduler", "ScoreSdeVpScheduler"] _import_structure["scheduling_amused"] = ["AmusedScheduler"] _import_structure["scheduling_consistency_decoder"] = ["ConsistencyDecoderScheduler"] _import_structure["scheduling_consistency_models"] = ["CMStochasticIterativeScheduler"] _import_structure["scheduling_ddim"] = ["DDIMScheduler"] _import_structure["scheduling_ddim_inverse"] = ["DDIMInverseScheduler"] _import_structure["scheduling_ddim_parallel"] = ["DDIMParallelScheduler"] _import_structure["scheduling_ddpm"] = ["DDPMScheduler"] _import_structure["scheduling_ddpm_parallel"] = ["DDPMParallelScheduler"] _import_structure["scheduling_ddpm_wuerstchen"] = ["DDPMWuerstchenScheduler"] _import_structure["scheduling_deis_multistep"] = ["DEISMultistepScheduler"] _import_structure["scheduling_dpmsolver_multistep"] = ["DPMSolverMultistepScheduler"] _import_structure["scheduling_dpmsolver_multistep_inverse"] = ["DPMSolverMultistepInverseScheduler"] _import_structure["scheduling_dpmsolver_singlestep"] = ["DPMSolverSinglestepScheduler"] _import_structure["scheduling_edm_dpmsolver_multistep"] = ["EDMDPMSolverMultistepScheduler"] _import_structure["scheduling_edm_euler"] = ["EDMEulerScheduler"] _import_structure["scheduling_euler_ancestral_discrete"] = ["EulerAncestralDiscreteScheduler"] _import_structure["scheduling_euler_discrete"] = ["EulerDiscreteScheduler"] _import_structure["scheduling_heun_discrete"] = ["HeunDiscreteScheduler"] _import_structure["scheduling_ipndm"] = ["IPNDMScheduler"] _import_structure["scheduling_k_dpm_2_ancestral_discrete"] = ["KDPM2AncestralDiscreteScheduler"] _import_structure["scheduling_k_dpm_2_discrete"] = ["KDPM2DiscreteScheduler"] _import_structure["scheduling_lcm"] = ["LCMScheduler"] _import_structure["scheduling_pndm"] = ["PNDMScheduler"] _import_structure["scheduling_repaint"] = ["RePaintScheduler"] _import_structure["scheduling_sasolver"] = ["SASolverScheduler"] _import_structure["scheduling_sde_ve"] = ["ScoreSdeVeScheduler"] _import_structure["scheduling_tcd"] = ["TCDScheduler"] _import_structure["scheduling_unclip"] = ["UnCLIPScheduler"] _import_structure["scheduling_unipc_multistep"] = ["UniPCMultistepScheduler"] _import_structure["scheduling_utils"] = ["KarrasDiffusionSchedulers", "SchedulerMixin"] _import_structure["scheduling_vq_diffusion"] = ["VQDiffusionScheduler"] try: if not is_flax_available(): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils import dummy_flax_objects # noqa F403 _dummy_modules.update(get_objects_from_module(dummy_flax_objects)) else: _import_structure["scheduling_ddim_flax"] = ["FlaxDDIMScheduler"] _import_structure["scheduling_ddpm_flax"] = ["FlaxDDPMScheduler"] _import_structure["scheduling_dpmsolver_multistep_flax"] = ["FlaxDPMSolverMultistepScheduler"] _import_structure["scheduling_euler_discrete_flax"] = ["FlaxEulerDiscreteScheduler"] _import_structure["scheduling_karras_ve_flax"] = ["FlaxKarrasVeScheduler"] _import_structure["scheduling_lms_discrete_flax"] = ["FlaxLMSDiscreteScheduler"] _import_structure["scheduling_pndm_flax"] = ["FlaxPNDMScheduler"] _import_structure["scheduling_sde_ve_flax"] = ["FlaxScoreSdeVeScheduler"] _import_structure["scheduling_utils_flax"] = [ "FlaxKarrasDiffusionSchedulers", "FlaxSchedulerMixin", "FlaxSchedulerOutput", "broadcast_to_shape_from_left", ] try: if not (is_torch_available() and is_scipy_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils import dummy_torch_and_scipy_objects # noqa F403 _dummy_modules.update(get_objects_from_module(dummy_torch_and_scipy_objects)) else: _import_structure["scheduling_lms_discrete"] = ["LMSDiscreteScheduler"] try: if not (is_torch_available() and is_torchsde_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils import dummy_torch_and_torchsde_objects # noqa F403 _dummy_modules.update(get_objects_from_module(dummy_torch_and_torchsde_objects)) else: _import_structure["scheduling_dpmsolver_sde"] = ["DPMSolverSDEScheduler"] if TYPE_CHECKING or DIFFUSERS_SLOW_IMPORT: from ..utils import ( OptionalDependencyNotAvailable, is_flax_available, is_scipy_available, is_torch_available, is_torchsde_available, ) try: if not is_torch_available(): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils.dummy_pt_objects import * # noqa F403 else: from .deprecated import KarrasVeScheduler, ScoreSdeVpScheduler from .scheduling_amused import AmusedScheduler from .scheduling_consistency_decoder import ConsistencyDecoderScheduler from .scheduling_consistency_models import CMStochasticIterativeScheduler from .scheduling_ddim import DDIMScheduler from .scheduling_ddim_inverse import DDIMInverseScheduler from .scheduling_ddim_parallel import DDIMParallelScheduler from .scheduling_ddpm import DDPMScheduler from .scheduling_ddpm_parallel import DDPMParallelScheduler from .scheduling_ddpm_wuerstchen import DDPMWuerstchenScheduler from .scheduling_deis_multistep import DEISMultistepScheduler from .scheduling_dpmsolver_multistep import DPMSolverMultistepScheduler from .scheduling_dpmsolver_multistep_inverse import DPMSolverMultistepInverseScheduler from .scheduling_dpmsolver_singlestep import DPMSolverSinglestepScheduler from .scheduling_edm_dpmsolver_multistep import EDMDPMSolverMultistepScheduler from .scheduling_edm_euler import EDMEulerScheduler from .scheduling_euler_ancestral_discrete import EulerAncestralDiscreteScheduler from .scheduling_euler_discrete import EulerDiscreteScheduler from .scheduling_heun_discrete import HeunDiscreteScheduler from .scheduling_ipndm import IPNDMScheduler from .scheduling_k_dpm_2_ancestral_discrete import KDPM2AncestralDiscreteScheduler from .scheduling_k_dpm_2_discrete import KDPM2DiscreteScheduler from .scheduling_lcm import LCMScheduler from .scheduling_pndm import PNDMScheduler from .scheduling_repaint import RePaintScheduler from .scheduling_sasolver import SASolverScheduler from .scheduling_sde_ve import ScoreSdeVeScheduler from .scheduling_tcd import TCDScheduler from .scheduling_unclip import UnCLIPScheduler from .scheduling_unipc_multistep import UniPCMultistepScheduler from .scheduling_utils import KarrasDiffusionSchedulers, SchedulerMixin from .scheduling_vq_diffusion import VQDiffusionScheduler try: if not is_flax_available(): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils.dummy_flax_objects import * # noqa F403 else: from .scheduling_ddim_flax import FlaxDDIMScheduler from .scheduling_ddpm_flax import FlaxDDPMScheduler from .scheduling_dpmsolver_multistep_flax import FlaxDPMSolverMultistepScheduler from .scheduling_euler_discrete_flax import FlaxEulerDiscreteScheduler from .scheduling_karras_ve_flax import FlaxKarrasVeScheduler from .scheduling_lms_discrete_flax import FlaxLMSDiscreteScheduler from .scheduling_pndm_flax import FlaxPNDMScheduler from .scheduling_sde_ve_flax import FlaxScoreSdeVeScheduler from .scheduling_utils_flax import ( FlaxKarrasDiffusionSchedulers, FlaxSchedulerMixin, FlaxSchedulerOutput, broadcast_to_shape_from_left, ) try: if not (is_torch_available() and is_scipy_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils.dummy_torch_and_scipy_objects import * # noqa F403 else: from .scheduling_lms_discrete import LMSDiscreteScheduler try: if not (is_torch_available() and is_torchsde_available()): raise OptionalDependencyNotAvailable() except OptionalDependencyNotAvailable: from ..utils.dummy_torch_and_torchsde_objects import * # noqa F403 else: from .scheduling_dpmsolver_sde import DPMSolverSDEScheduler else: import sys sys.modules[__name__] = _LazyModule(__name__, globals()["__file__"], _import_structure, module_spec=__spec__) for name, value in _dummy_modules.items(): setattr(sys.modules[__name__], name, value)
diffusers/src/diffusers/schedulers/__init__.py/0
{ "file_path": "diffusers/src/diffusers/schedulers/__init__.py", "repo_id": "diffusers", "token_count": 4011 }
139
# Copyright 2024 Katherine Crowson and The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import math import warnings from dataclasses import dataclass from typing import List, Optional, Tuple, Union import numpy as np import torch from scipy import integrate from ..configuration_utils import ConfigMixin, register_to_config from ..utils import BaseOutput from .scheduling_utils import KarrasDiffusionSchedulers, SchedulerMixin @dataclass # Copied from diffusers.schedulers.scheduling_ddpm.DDPMSchedulerOutput with DDPM->LMSDiscrete class LMSDiscreteSchedulerOutput(BaseOutput): """ Output class for the scheduler's `step` function output. Args: prev_sample (`torch.FloatTensor` of shape `(batch_size, num_channels, height, width)` for images): Computed sample `(x_{t-1})` of previous timestep. `prev_sample` should be used as next model input in the denoising loop. pred_original_sample (`torch.FloatTensor` of shape `(batch_size, num_channels, height, width)` for images): The predicted denoised sample `(x_{0})` based on the model output from the current timestep. `pred_original_sample` can be used to preview progress or for guidance. """ prev_sample: torch.FloatTensor pred_original_sample: Optional[torch.FloatTensor] = None # Copied from diffusers.schedulers.scheduling_ddpm.betas_for_alpha_bar def betas_for_alpha_bar( num_diffusion_timesteps, max_beta=0.999, alpha_transform_type="cosine", ): """ Create a beta schedule that discretizes the given alpha_t_bar function, which defines the cumulative product of (1-beta) over time from t = [0,1]. Contains a function alpha_bar that takes an argument t and transforms it to the cumulative product of (1-beta) up to that part of the diffusion process. Args: num_diffusion_timesteps (`int`): the number of betas to produce. max_beta (`float`): the maximum beta to use; use values lower than 1 to prevent singularities. alpha_transform_type (`str`, *optional*, default to `cosine`): the type of noise schedule for alpha_bar. Choose from `cosine` or `exp` Returns: betas (`np.ndarray`): the betas used by the scheduler to step the model outputs """ if alpha_transform_type == "cosine": def alpha_bar_fn(t): return math.cos((t + 0.008) / 1.008 * math.pi / 2) ** 2 elif alpha_transform_type == "exp": def alpha_bar_fn(t): return math.exp(t * -12.0) else: raise ValueError(f"Unsupported alpha_transform_type: {alpha_transform_type}") betas = [] for i in range(num_diffusion_timesteps): t1 = i / num_diffusion_timesteps t2 = (i + 1) / num_diffusion_timesteps betas.append(min(1 - alpha_bar_fn(t2) / alpha_bar_fn(t1), max_beta)) return torch.tensor(betas, dtype=torch.float32) class LMSDiscreteScheduler(SchedulerMixin, ConfigMixin): """ A linear multistep scheduler for discrete beta schedules. This model inherits from [`SchedulerMixin`] and [`ConfigMixin`]. Check the superclass documentation for the generic methods the library implements for all schedulers such as loading and saving. Args: num_train_timesteps (`int`, defaults to 1000): The number of diffusion steps to train the model. beta_start (`float`, defaults to 0.0001): The starting `beta` value of inference. beta_end (`float`, defaults to 0.02): The final `beta` value. beta_schedule (`str`, defaults to `"linear"`): The beta schedule, a mapping from a beta range to a sequence of betas for stepping the model. Choose from `linear` or `scaled_linear`. trained_betas (`np.ndarray`, *optional*): Pass an array of betas directly to the constructor to bypass `beta_start` and `beta_end`. use_karras_sigmas (`bool`, *optional*, defaults to `False`): Whether to use Karras sigmas for step sizes in the noise schedule during the sampling process. If `True`, the sigmas are determined according to a sequence of noise levels {σi}. prediction_type (`str`, defaults to `epsilon`, *optional*): Prediction type of the scheduler function; can be `epsilon` (predicts the noise of the diffusion process), `sample` (directly predicts the noisy sample`) or `v_prediction` (see section 2.4 of [Imagen Video](https://imagen.research.google/video/paper.pdf) paper). timestep_spacing (`str`, defaults to `"linspace"`): The way the timesteps should be scaled. Refer to Table 2 of the [Common Diffusion Noise Schedules and Sample Steps are Flawed](https://huggingface.co/papers/2305.08891) for more information. steps_offset (`int`, defaults to 0): An offset added to the inference steps, as required by some model families. """ _compatibles = [e.name for e in KarrasDiffusionSchedulers] order = 1 @register_to_config def __init__( self, num_train_timesteps: int = 1000, beta_start: float = 0.0001, beta_end: float = 0.02, beta_schedule: str = "linear", trained_betas: Optional[Union[np.ndarray, List[float]]] = None, use_karras_sigmas: Optional[bool] = False, prediction_type: str = "epsilon", timestep_spacing: str = "linspace", steps_offset: int = 0, ): if trained_betas is not None: self.betas = torch.tensor(trained_betas, dtype=torch.float32) elif beta_schedule == "linear": self.betas = torch.linspace(beta_start, beta_end, num_train_timesteps, dtype=torch.float32) elif beta_schedule == "scaled_linear": # this schedule is very specific to the latent diffusion model. self.betas = torch.linspace(beta_start**0.5, beta_end**0.5, num_train_timesteps, dtype=torch.float32) ** 2 elif beta_schedule == "squaredcos_cap_v2": # Glide cosine schedule self.betas = betas_for_alpha_bar(num_train_timesteps) else: raise NotImplementedError(f"{beta_schedule} does is not implemented for {self.__class__}") self.alphas = 1.0 - self.betas self.alphas_cumprod = torch.cumprod(self.alphas, dim=0) sigmas = np.array(((1 - self.alphas_cumprod) / self.alphas_cumprod) ** 0.5) sigmas = np.concatenate([sigmas[::-1], [0.0]]).astype(np.float32) self.sigmas = torch.from_numpy(sigmas) # setable values self.num_inference_steps = None self.use_karras_sigmas = use_karras_sigmas self.set_timesteps(num_train_timesteps, None) self.derivatives = [] self.is_scale_input_called = False self._step_index = None self._begin_index = None self.sigmas = self.sigmas.to("cpu") # to avoid too much CPU/GPU communication @property def init_noise_sigma(self): # standard deviation of the initial noise distribution if self.config.timestep_spacing in ["linspace", "trailing"]: return self.sigmas.max() return (self.sigmas.max() ** 2 + 1) ** 0.5 @property def step_index(self): """ The index counter for current timestep. It will increase 1 after each scheduler step. """ return self._step_index @property def begin_index(self): """ The index for the first timestep. It should be set from pipeline with `set_begin_index` method. """ return self._begin_index # Copied from diffusers.schedulers.scheduling_dpmsolver_multistep.DPMSolverMultistepScheduler.set_begin_index def set_begin_index(self, begin_index: int = 0): """ Sets the begin index for the scheduler. This function should be run from pipeline before the inference. Args: begin_index (`int`): The begin index for the scheduler. """ self._begin_index = begin_index def scale_model_input( self, sample: torch.FloatTensor, timestep: Union[float, torch.FloatTensor] ) -> torch.FloatTensor: """ Ensures interchangeability with schedulers that need to scale the denoising model input depending on the current timestep. Args: sample (`torch.FloatTensor`): The input sample. timestep (`float` or `torch.FloatTensor`): The current timestep in the diffusion chain. Returns: `torch.FloatTensor`: A scaled input sample. """ if self.step_index is None: self._init_step_index(timestep) sigma = self.sigmas[self.step_index] sample = sample / ((sigma**2 + 1) ** 0.5) self.is_scale_input_called = True return sample def get_lms_coefficient(self, order, t, current_order): """ Compute the linear multistep coefficient. Args: order (): t (): current_order (): """ def lms_derivative(tau): prod = 1.0 for k in range(order): if current_order == k: continue prod *= (tau - self.sigmas[t - k]) / (self.sigmas[t - current_order] - self.sigmas[t - k]) return prod integrated_coeff = integrate.quad(lms_derivative, self.sigmas[t], self.sigmas[t + 1], epsrel=1e-4)[0] return integrated_coeff def set_timesteps(self, num_inference_steps: int, device: Union[str, torch.device] = None): """ Sets the discrete timesteps used for the diffusion chain (to be run before inference). Args: num_inference_steps (`int`): The number of diffusion steps used when generating samples with a pre-trained model. device (`str` or `torch.device`, *optional*): The device to which the timesteps should be moved to. If `None`, the timesteps are not moved. """ self.num_inference_steps = num_inference_steps # "linspace", "leading", "trailing" corresponds to annotation of Table 2. of https://arxiv.org/abs/2305.08891 if self.config.timestep_spacing == "linspace": timesteps = np.linspace(0, self.config.num_train_timesteps - 1, num_inference_steps, dtype=np.float32)[ ::-1 ].copy() elif self.config.timestep_spacing == "leading": step_ratio = self.config.num_train_timesteps // self.num_inference_steps # creates integer timesteps by multiplying by ratio # casting to int to avoid issues when num_inference_step is power of 3 timesteps = (np.arange(0, num_inference_steps) * step_ratio).round()[::-1].copy().astype(np.float32) timesteps += self.config.steps_offset elif self.config.timestep_spacing == "trailing": step_ratio = self.config.num_train_timesteps / self.num_inference_steps # creates integer timesteps by multiplying by ratio # casting to int to avoid issues when num_inference_step is power of 3 timesteps = (np.arange(self.config.num_train_timesteps, 0, -step_ratio)).round().copy().astype(np.float32) timesteps -= 1 else: raise ValueError( f"{self.config.timestep_spacing} is not supported. Please make sure to choose one of 'linspace', 'leading' or 'trailing'." ) sigmas = np.array(((1 - self.alphas_cumprod) / self.alphas_cumprod) ** 0.5) log_sigmas = np.log(sigmas) sigmas = np.interp(timesteps, np.arange(0, len(sigmas)), sigmas) if self.config.use_karras_sigmas: sigmas = self._convert_to_karras(in_sigmas=sigmas) timesteps = np.array([self._sigma_to_t(sigma, log_sigmas) for sigma in sigmas]) sigmas = np.concatenate([sigmas, [0.0]]).astype(np.float32) self.sigmas = torch.from_numpy(sigmas).to(device=device) self.timesteps = torch.from_numpy(timesteps).to(device=device) self._step_index = None self._begin_index = None self.sigmas = self.sigmas.to("cpu") # to avoid too much CPU/GPU communication self.derivatives = [] # Copied from diffusers.schedulers.scheduling_euler_discrete.EulerDiscreteScheduler.index_for_timestep def index_for_timestep(self, timestep, schedule_timesteps=None): if schedule_timesteps is None: schedule_timesteps = self.timesteps indices = (schedule_timesteps == timestep).nonzero() # The sigma index that is taken for the **very** first `step` # is always the second index (or the last index if there is only 1) # This way we can ensure we don't accidentally skip a sigma in # case we start in the middle of the denoising schedule (e.g. for image-to-image) pos = 1 if len(indices) > 1 else 0 return indices[pos].item() # Copied from diffusers.schedulers.scheduling_euler_discrete.EulerDiscreteScheduler._init_step_index def _init_step_index(self, timestep): if self.begin_index is None: if isinstance(timestep, torch.Tensor): timestep = timestep.to(self.timesteps.device) self._step_index = self.index_for_timestep(timestep) else: self._step_index = self._begin_index # copied from diffusers.schedulers.scheduling_euler_discrete._sigma_to_t def _sigma_to_t(self, sigma, log_sigmas): # get log sigma log_sigma = np.log(np.maximum(sigma, 1e-10)) # get distribution dists = log_sigma - log_sigmas[:, np.newaxis] # get sigmas range low_idx = np.cumsum((dists >= 0), axis=0).argmax(axis=0).clip(max=log_sigmas.shape[0] - 2) high_idx = low_idx + 1 low = log_sigmas[low_idx] high = log_sigmas[high_idx] # interpolate sigmas w = (low - log_sigma) / (low - high) w = np.clip(w, 0, 1) # transform interpolation to time range t = (1 - w) * low_idx + w * high_idx t = t.reshape(sigma.shape) return t # copied from diffusers.schedulers.scheduling_euler_discrete._convert_to_karras def _convert_to_karras(self, in_sigmas: torch.FloatTensor) -> torch.FloatTensor: """Constructs the noise schedule of Karras et al. (2022).""" sigma_min: float = in_sigmas[-1].item() sigma_max: float = in_sigmas[0].item() rho = 7.0 # 7.0 is the value used in the paper ramp = np.linspace(0, 1, self.num_inference_steps) min_inv_rho = sigma_min ** (1 / rho) max_inv_rho = sigma_max ** (1 / rho) sigmas = (max_inv_rho + ramp * (min_inv_rho - max_inv_rho)) ** rho return sigmas def step( self, model_output: torch.FloatTensor, timestep: Union[float, torch.FloatTensor], sample: torch.FloatTensor, order: int = 4, return_dict: bool = True, ) -> Union[LMSDiscreteSchedulerOutput, Tuple]: """ Predict the sample from the previous timestep by reversing the SDE. This function propagates the diffusion process from the learned model outputs (most often the predicted noise). Args: model_output (`torch.FloatTensor`): The direct output from learned diffusion model. timestep (`float` or `torch.FloatTensor`): The current discrete timestep in the diffusion chain. sample (`torch.FloatTensor`): A current instance of a sample created by the diffusion process. order (`int`, defaults to 4): The order of the linear multistep method. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~schedulers.scheduling_utils.SchedulerOutput`] or tuple. Returns: [`~schedulers.scheduling_utils.SchedulerOutput`] or `tuple`: If return_dict is `True`, [`~schedulers.scheduling_utils.SchedulerOutput`] is returned, otherwise a tuple is returned where the first element is the sample tensor. """ if not self.is_scale_input_called: warnings.warn( "The `scale_model_input` function should be called before `step` to ensure correct denoising. " "See `StableDiffusionPipeline` for a usage example." ) if self.step_index is None: self._init_step_index(timestep) sigma = self.sigmas[self.step_index] # 1. compute predicted original sample (x_0) from sigma-scaled predicted noise if self.config.prediction_type == "epsilon": pred_original_sample = sample - sigma * model_output elif self.config.prediction_type == "v_prediction": # * c_out + input * c_skip pred_original_sample = model_output * (-sigma / (sigma**2 + 1) ** 0.5) + (sample / (sigma**2 + 1)) elif self.config.prediction_type == "sample": pred_original_sample = model_output else: raise ValueError( f"prediction_type given as {self.config.prediction_type} must be one of `epsilon`, or `v_prediction`" ) # 2. Convert to an ODE derivative derivative = (sample - pred_original_sample) / sigma self.derivatives.append(derivative) if len(self.derivatives) > order: self.derivatives.pop(0) # 3. Compute linear multistep coefficients order = min(self.step_index + 1, order) lms_coeffs = [self.get_lms_coefficient(order, self.step_index, curr_order) for curr_order in range(order)] # 4. Compute previous sample based on the derivatives path prev_sample = sample + sum( coeff * derivative for coeff, derivative in zip(lms_coeffs, reversed(self.derivatives)) ) # upon completion increase step index by one self._step_index += 1 if not return_dict: return (prev_sample,) return LMSDiscreteSchedulerOutput(prev_sample=prev_sample, pred_original_sample=pred_original_sample) # Copied from diffusers.schedulers.scheduling_euler_discrete.EulerDiscreteScheduler.add_noise def add_noise( self, original_samples: torch.FloatTensor, noise: torch.FloatTensor, timesteps: torch.FloatTensor, ) -> torch.FloatTensor: # Make sure sigmas and timesteps have the same device and dtype as original_samples sigmas = self.sigmas.to(device=original_samples.device, dtype=original_samples.dtype) if original_samples.device.type == "mps" and torch.is_floating_point(timesteps): # mps does not support float64 schedule_timesteps = self.timesteps.to(original_samples.device, dtype=torch.float32) timesteps = timesteps.to(original_samples.device, dtype=torch.float32) else: schedule_timesteps = self.timesteps.to(original_samples.device) timesteps = timesteps.to(original_samples.device) # self.begin_index is None when scheduler is used for training, or pipeline does not implement set_begin_index if self.begin_index is None: step_indices = [self.index_for_timestep(t, schedule_timesteps) for t in timesteps] elif self.step_index is not None: # add_noise is called after first denoising step (for inpainting) step_indices = [self.step_index] * timesteps.shape[0] else: # add noise is called before first denoising step to create initial latent(img2img) step_indices = [self.begin_index] * timesteps.shape[0] sigma = sigmas[step_indices].flatten() while len(sigma.shape) < len(original_samples.shape): sigma = sigma.unsqueeze(-1) noisy_samples = original_samples + noise * sigma return noisy_samples def __len__(self): return self.config.num_train_timesteps
diffusers/src/diffusers/schedulers/scheduling_lms_discrete.py/0
{ "file_path": "diffusers/src/diffusers/schedulers/scheduling_lms_discrete.py", "repo_id": "diffusers", "token_count": 8814 }
140
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Accelerate utilities: Utilities related to accelerate """ from packaging import version from .import_utils import is_accelerate_available if is_accelerate_available(): import accelerate def apply_forward_hook(method): """ Decorator that applies a registered CpuOffload hook to an arbitrary function rather than `forward`. This is useful for cases where a PyTorch module provides functions other than `forward` that should trigger a move to the appropriate acceleration device. This is the case for `encode` and `decode` in [`AutoencoderKL`]. This decorator looks inside the internal `_hf_hook` property to find a registered offload hook. :param method: The method to decorate. This method should be a method of a PyTorch module. """ if not is_accelerate_available(): return method accelerate_version = version.parse(accelerate.__version__).base_version if version.parse(accelerate_version) < version.parse("0.17.0"): return method def wrapper(self, *args, **kwargs): if hasattr(self, "_hf_hook") and hasattr(self._hf_hook, "pre_forward"): self._hf_hook.pre_forward(self) return method(self, *args, **kwargs) return wrapper
diffusers/src/diffusers/utils/accelerate_utils.py/0
{ "file_path": "diffusers/src/diffusers/utils/accelerate_utils.py", "repo_id": "diffusers", "token_count": 558 }
141
# coding=utf-8 # Copyright 2024 The HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Utilities to dynamically load objects from the Hub.""" import importlib import inspect import json import os import re import shutil import sys from pathlib import Path from typing import Dict, Optional, Union from urllib import request from huggingface_hub import cached_download, hf_hub_download, model_info from huggingface_hub.utils import validate_hf_hub_args from packaging import version from .. import __version__ from . import DIFFUSERS_DYNAMIC_MODULE_NAME, HF_MODULES_CACHE, logging COMMUNITY_PIPELINES_URL = ( "https://raw.githubusercontent.com/huggingface/diffusers/{revision}/examples/community/{pipeline}.py" ) logger = logging.get_logger(__name__) # pylint: disable=invalid-name def get_diffusers_versions(): url = "https://pypi.org/pypi/diffusers/json" releases = json.loads(request.urlopen(url).read())["releases"].keys() return sorted(releases, key=lambda x: version.Version(x)) def init_hf_modules(): """ Creates the cache directory for modules with an init, and adds it to the Python path. """ # This function has already been executed if HF_MODULES_CACHE already is in the Python path. if HF_MODULES_CACHE in sys.path: return sys.path.append(HF_MODULES_CACHE) os.makedirs(HF_MODULES_CACHE, exist_ok=True) init_path = Path(HF_MODULES_CACHE) / "__init__.py" if not init_path.exists(): init_path.touch() def create_dynamic_module(name: Union[str, os.PathLike]): """ Creates a dynamic module in the cache directory for modules. """ init_hf_modules() dynamic_module_path = Path(HF_MODULES_CACHE) / name # If the parent module does not exist yet, recursively create it. if not dynamic_module_path.parent.exists(): create_dynamic_module(dynamic_module_path.parent) os.makedirs(dynamic_module_path, exist_ok=True) init_path = dynamic_module_path / "__init__.py" if not init_path.exists(): init_path.touch() def get_relative_imports(module_file): """ Get the list of modules that are relatively imported in a module file. Args: module_file (`str` or `os.PathLike`): The module file to inspect. """ with open(module_file, "r", encoding="utf-8") as f: content = f.read() # Imports of the form `import .xxx` relative_imports = re.findall(r"^\s*import\s+\.(\S+)\s*$", content, flags=re.MULTILINE) # Imports of the form `from .xxx import yyy` relative_imports += re.findall(r"^\s*from\s+\.(\S+)\s+import", content, flags=re.MULTILINE) # Unique-ify return list(set(relative_imports)) def get_relative_import_files(module_file): """ Get the list of all files that are needed for a given module. Note that this function recurses through the relative imports (if a imports b and b imports c, it will return module files for b and c). Args: module_file (`str` or `os.PathLike`): The module file to inspect. """ no_change = False files_to_check = [module_file] all_relative_imports = [] # Let's recurse through all relative imports while not no_change: new_imports = [] for f in files_to_check: new_imports.extend(get_relative_imports(f)) module_path = Path(module_file).parent new_import_files = [str(module_path / m) for m in new_imports] new_import_files = [f for f in new_import_files if f not in all_relative_imports] files_to_check = [f"{f}.py" for f in new_import_files] no_change = len(new_import_files) == 0 all_relative_imports.extend(files_to_check) return all_relative_imports def check_imports(filename): """ Check if the current Python environment contains all the libraries that are imported in a file. """ with open(filename, "r", encoding="utf-8") as f: content = f.read() # Imports of the form `import xxx` imports = re.findall(r"^\s*import\s+(\S+)\s*$", content, flags=re.MULTILINE) # Imports of the form `from xxx import yyy` imports += re.findall(r"^\s*from\s+(\S+)\s+import", content, flags=re.MULTILINE) # Only keep the top-level module imports = [imp.split(".")[0] for imp in imports if not imp.startswith(".")] # Unique-ify and test we got them all imports = list(set(imports)) missing_packages = [] for imp in imports: try: importlib.import_module(imp) except ImportError: missing_packages.append(imp) if len(missing_packages) > 0: raise ImportError( "This modeling file requires the following packages that were not found in your environment: " f"{', '.join(missing_packages)}. Run `pip install {' '.join(missing_packages)}`" ) return get_relative_imports(filename) def get_class_in_module(class_name, module_path): """ Import a module on the cache directory for modules and extract a class from it. """ module_path = module_path.replace(os.path.sep, ".") module = importlib.import_module(module_path) if class_name is None: return find_pipeline_class(module) return getattr(module, class_name) def find_pipeline_class(loaded_module): """ Retrieve pipeline class that inherits from `DiffusionPipeline`. Note that there has to be exactly one class inheriting from `DiffusionPipeline`. """ from ..pipelines import DiffusionPipeline cls_members = dict(inspect.getmembers(loaded_module, inspect.isclass)) pipeline_class = None for cls_name, cls in cls_members.items(): if ( cls_name != DiffusionPipeline.__name__ and issubclass(cls, DiffusionPipeline) and cls.__module__.split(".")[0] != "diffusers" ): if pipeline_class is not None: raise ValueError( f"Multiple classes that inherit from {DiffusionPipeline.__name__} have been found:" f" {pipeline_class.__name__}, and {cls_name}. Please make sure to define only one in" f" {loaded_module}." ) pipeline_class = cls return pipeline_class @validate_hf_hub_args def get_cached_module_file( pretrained_model_name_or_path: Union[str, os.PathLike], module_file: str, cache_dir: Optional[Union[str, os.PathLike]] = None, force_download: bool = False, resume_download: bool = False, proxies: Optional[Dict[str, str]] = None, token: Optional[Union[bool, str]] = None, revision: Optional[str] = None, local_files_only: bool = False, ): """ Prepares Downloads a module from a local folder or a distant repo and returns its path inside the cached Transformers module. Args: pretrained_model_name_or_path (`str` or `os.PathLike`): This can be either: - a string, the *model id* of a pretrained model configuration hosted inside a model repo on huggingface.co. Valid model ids can be located at the root-level, like `bert-base-uncased`, or namespaced under a user or organization name, like `dbmdz/bert-base-german-cased`. - a path to a *directory* containing a configuration file saved using the [`~PreTrainedTokenizer.save_pretrained`] method, e.g., `./my_model_directory/`. module_file (`str`): The name of the module file containing the class to look for. cache_dir (`str` or `os.PathLike`, *optional*): Path to a directory in which a downloaded pretrained model configuration should be cached if the standard cache should not be used. force_download (`bool`, *optional*, defaults to `False`): Whether or not to force to (re-)download the configuration files and override the cached versions if they exist. resume_download (`bool`, *optional*, defaults to `False`): Whether or not to delete incompletely received file. Attempts to resume the download if such a file exists. proxies (`Dict[str, str]`, *optional*): A dictionary of proxy servers to use by protocol or endpoint, e.g., `{'http': 'foo.bar:3128', 'http://hostname': 'foo.bar:4012'}.` The proxies are used on each request. token (`str` or *bool*, *optional*): The token to use as HTTP bearer authorization for remote files. If `True`, will use the token generated when running `transformers-cli login` (stored in `~/.huggingface`). revision (`str`, *optional*, defaults to `"main"`): The specific model version to use. It can be a branch name, a tag name, or a commit id, since we use a git-based system for storing models and other artifacts on huggingface.co, so `revision` can be any identifier allowed by git. local_files_only (`bool`, *optional*, defaults to `False`): If `True`, will only try to load the tokenizer configuration from local files. <Tip> You may pass a token in `token` if you are not logged in (`huggingface-cli login`) and want to use private or [gated models](https://huggingface.co/docs/hub/models-gated#gated-models). </Tip> Returns: `str`: The path to the module inside the cache. """ # Download and cache module_file from the repo `pretrained_model_name_or_path` of grab it if it's a local file. pretrained_model_name_or_path = str(pretrained_model_name_or_path) module_file_or_url = os.path.join(pretrained_model_name_or_path, module_file) if os.path.isfile(module_file_or_url): resolved_module_file = module_file_or_url submodule = "local" elif pretrained_model_name_or_path.count("/") == 0: available_versions = get_diffusers_versions() # cut ".dev0" latest_version = "v" + ".".join(__version__.split(".")[:3]) # retrieve github version that matches if revision is None: revision = latest_version if latest_version[1:] in available_versions else "main" logger.info(f"Defaulting to latest_version: {revision}.") elif revision in available_versions: revision = f"v{revision}" elif revision == "main": revision = revision else: raise ValueError( f"`custom_revision`: {revision} does not exist. Please make sure to choose one of" f" {', '.join(available_versions + ['main'])}." ) # community pipeline on GitHub github_url = COMMUNITY_PIPELINES_URL.format(revision=revision, pipeline=pretrained_model_name_or_path) try: resolved_module_file = cached_download( github_url, cache_dir=cache_dir, force_download=force_download, proxies=proxies, resume_download=resume_download, local_files_only=local_files_only, token=False, ) submodule = "git" module_file = pretrained_model_name_or_path + ".py" except EnvironmentError: logger.error(f"Could not locate the {module_file} inside {pretrained_model_name_or_path}.") raise else: try: # Load from URL or cache if already cached resolved_module_file = hf_hub_download( pretrained_model_name_or_path, module_file, cache_dir=cache_dir, force_download=force_download, proxies=proxies, resume_download=resume_download, local_files_only=local_files_only, token=token, ) submodule = os.path.join("local", "--".join(pretrained_model_name_or_path.split("/"))) except EnvironmentError: logger.error(f"Could not locate the {module_file} inside {pretrained_model_name_or_path}.") raise # Check we have all the requirements in our environment modules_needed = check_imports(resolved_module_file) # Now we move the module inside our cached dynamic modules. full_submodule = DIFFUSERS_DYNAMIC_MODULE_NAME + os.path.sep + submodule create_dynamic_module(full_submodule) submodule_path = Path(HF_MODULES_CACHE) / full_submodule if submodule == "local" or submodule == "git": # We always copy local files (we could hash the file to see if there was a change, and give them the name of # that hash, to only copy when there is a modification but it seems overkill for now). # The only reason we do the copy is to avoid putting too many folders in sys.path. shutil.copy(resolved_module_file, submodule_path / module_file) for module_needed in modules_needed: if len(module_needed.split(".")) == 2: module_needed = "/".join(module_needed.split(".")) module_folder = module_needed.split("/")[0] if not os.path.exists(submodule_path / module_folder): os.makedirs(submodule_path / module_folder) module_needed = f"{module_needed}.py" shutil.copy(os.path.join(pretrained_model_name_or_path, module_needed), submodule_path / module_needed) else: # Get the commit hash # TODO: we will get this info in the etag soon, so retrieve it from there and not here. commit_hash = model_info(pretrained_model_name_or_path, revision=revision, token=token).sha # The module file will end up being placed in a subfolder with the git hash of the repo. This way we get the # benefit of versioning. submodule_path = submodule_path / commit_hash full_submodule = full_submodule + os.path.sep + commit_hash create_dynamic_module(full_submodule) if not (submodule_path / module_file).exists(): if len(module_file.split("/")) == 2: module_folder = module_file.split("/")[0] if not os.path.exists(submodule_path / module_folder): os.makedirs(submodule_path / module_folder) shutil.copy(resolved_module_file, submodule_path / module_file) # Make sure we also have every file with relative for module_needed in modules_needed: if len(module_needed.split(".")) == 2: module_needed = "/".join(module_needed.split(".")) if not (submodule_path / module_needed).exists(): get_cached_module_file( pretrained_model_name_or_path, f"{module_needed}.py", cache_dir=cache_dir, force_download=force_download, resume_download=resume_download, proxies=proxies, token=token, revision=revision, local_files_only=local_files_only, ) return os.path.join(full_submodule, module_file) @validate_hf_hub_args def get_class_from_dynamic_module( pretrained_model_name_or_path: Union[str, os.PathLike], module_file: str, class_name: Optional[str] = None, cache_dir: Optional[Union[str, os.PathLike]] = None, force_download: bool = False, resume_download: bool = False, proxies: Optional[Dict[str, str]] = None, token: Optional[Union[bool, str]] = None, revision: Optional[str] = None, local_files_only: bool = False, **kwargs, ): """ Extracts a class from a module file, present in the local folder or repository of a model. <Tip warning={true}> Calling this function will execute the code in the module file found locally or downloaded from the Hub. It should therefore only be called on trusted repos. </Tip> Args: pretrained_model_name_or_path (`str` or `os.PathLike`): This can be either: - a string, the *model id* of a pretrained model configuration hosted inside a model repo on huggingface.co. Valid model ids can be located at the root-level, like `bert-base-uncased`, or namespaced under a user or organization name, like `dbmdz/bert-base-german-cased`. - a path to a *directory* containing a configuration file saved using the [`~PreTrainedTokenizer.save_pretrained`] method, e.g., `./my_model_directory/`. module_file (`str`): The name of the module file containing the class to look for. class_name (`str`): The name of the class to import in the module. cache_dir (`str` or `os.PathLike`, *optional*): Path to a directory in which a downloaded pretrained model configuration should be cached if the standard cache should not be used. force_download (`bool`, *optional*, defaults to `False`): Whether or not to force to (re-)download the configuration files and override the cached versions if they exist. resume_download (`bool`, *optional*, defaults to `False`): Whether or not to delete incompletely received file. Attempts to resume the download if such a file exists. proxies (`Dict[str, str]`, *optional*): A dictionary of proxy servers to use by protocol or endpoint, e.g., `{'http': 'foo.bar:3128', 'http://hostname': 'foo.bar:4012'}.` The proxies are used on each request. token (`str` or `bool`, *optional*): The token to use as HTTP bearer authorization for remote files. If `True`, will use the token generated when running `transformers-cli login` (stored in `~/.huggingface`). revision (`str`, *optional*, defaults to `"main"`): The specific model version to use. It can be a branch name, a tag name, or a commit id, since we use a git-based system for storing models and other artifacts on huggingface.co, so `revision` can be any identifier allowed by git. local_files_only (`bool`, *optional*, defaults to `False`): If `True`, will only try to load the tokenizer configuration from local files. <Tip> You may pass a token in `token` if you are not logged in (`huggingface-cli login`) and want to use private or [gated models](https://huggingface.co/docs/hub/models-gated#gated-models). </Tip> Returns: `type`: The class, dynamically imported from the module. Examples: ```python # Download module `modeling.py` from huggingface.co and cache then extract the class `MyBertModel` from this # module. cls = get_class_from_dynamic_module("sgugger/my-bert-model", "modeling.py", "MyBertModel") ```""" # And lastly we get the class inside our newly created module final_module = get_cached_module_file( pretrained_model_name_or_path, module_file, cache_dir=cache_dir, force_download=force_download, resume_download=resume_download, proxies=proxies, token=token, revision=revision, local_files_only=local_files_only, ) return get_class_in_module(class_name, final_module.replace(".py", ""))
diffusers/src/diffusers/utils/dynamic_modules_utils.py/0
{ "file_path": "diffusers/src/diffusers/utils/dynamic_modules_utils.py", "repo_id": "diffusers", "token_count": 7901 }
142
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from typing import Optional, Tuple, Union import torch from diffusers import DiffusionPipeline, ImagePipelineOutput class CustomLocalPipeline(DiffusionPipeline): r""" This model inherits from [`DiffusionPipeline`]. Check the superclass documentation for the generic methods the library implements for all the pipelines (such as downloading or saving, running on a particular device, etc.) Parameters: unet ([`UNet2DModel`]): U-Net architecture to denoise the encoded image. scheduler ([`SchedulerMixin`]): A scheduler to be used in combination with `unet` to denoise the encoded image. Can be one of [`DDPMScheduler`], or [`DDIMScheduler`]. """ def __init__(self, unet, scheduler): super().__init__() self.register_modules(unet=unet, scheduler=scheduler) @torch.no_grad() def __call__( self, batch_size: int = 1, generator: Optional[torch.Generator] = None, num_inference_steps: int = 50, output_type: Optional[str] = "pil", return_dict: bool = True, **kwargs, ) -> Union[ImagePipelineOutput, Tuple]: r""" Args: batch_size (`int`, *optional*, defaults to 1): The number of images to generate. generator (`torch.Generator`, *optional*): A [torch generator](https://pytorch.org/docs/stable/generated/torch.Generator.html) to make generation deterministic. eta (`float`, *optional*, defaults to 0.0): The eta parameter which controls the scale of the variance (0 is DDIM and 1 is one type of DDPM). num_inference_steps (`int`, *optional*, defaults to 50): The number of denoising steps. More denoising steps usually lead to a higher quality image at the expense of slower inference. output_type (`str`, *optional*, defaults to `"pil"`): The output format of the generate image. Choose between [PIL](https://pillow.readthedocs.io/en/stable/): `PIL.Image.Image` or `np.array`. return_dict (`bool`, *optional*, defaults to `True`): Whether or not to return a [`~pipelines.ImagePipelineOutput`] instead of a plain tuple. Returns: [`~pipelines.ImagePipelineOutput`] or `tuple`: [`~pipelines.utils.ImagePipelineOutput`] if `return_dict` is True, otherwise a `tuple. When returning a tuple, the first element is a list with the generated images. """ # Sample gaussian noise to begin loop image = torch.randn( (batch_size, self.unet.config.in_channels, self.unet.config.sample_size, self.unet.config.sample_size), generator=generator, ) image = image.to(self.device) # set step values self.scheduler.set_timesteps(num_inference_steps) for t in self.progress_bar(self.scheduler.timesteps): # 1. predict noise model_output model_output = self.unet(image, t).sample # 2. predict previous mean of image x_t-1 and add variance depending on eta # eta corresponds to η in paper and should be between [0, 1] # do x_t -> x_t-1 image = self.scheduler.step(model_output, t, image).prev_sample image = (image / 2 + 0.5).clamp(0, 1) image = image.cpu().permute(0, 2, 3, 1).numpy() if output_type == "pil": image = self.numpy_to_pil(image) if not return_dict: return (image,), "This is a local test" return ImagePipelineOutput(images=image), "This is a local test"
diffusers/tests/fixtures/custom_pipeline/pipeline.py/0
{ "file_path": "diffusers/tests/fixtures/custom_pipeline/pipeline.py", "repo_id": "diffusers", "token_count": 1738 }
143
# Copyright 2024 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import inspect import unittest from importlib import import_module class DependencyTester(unittest.TestCase): def test_diffusers_import(self): try: import diffusers # noqa: F401 except ImportError: assert False def test_backend_registration(self): import diffusers from diffusers.dependency_versions_table import deps all_classes = inspect.getmembers(diffusers, inspect.isclass) for cls_name, cls_module in all_classes: if "dummy_" in cls_module.__module__: for backend in cls_module._backends: if backend == "k_diffusion": backend = "k-diffusion" elif backend == "invisible_watermark": backend = "invisible-watermark" assert backend in deps, f"{backend} is not in the deps table!" def test_pipeline_imports(self): import diffusers import diffusers.pipelines all_classes = inspect.getmembers(diffusers, inspect.isclass) for cls_name, cls_module in all_classes: if hasattr(diffusers.pipelines, cls_name): pipeline_folder_module = ".".join(str(cls_module.__module__).split(".")[:3]) _ = import_module(pipeline_folder_module, str(cls_name))
diffusers/tests/others/test_dependencies.py/0
{ "file_path": "diffusers/tests/others/test_dependencies.py", "repo_id": "diffusers", "token_count": 775 }
144
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import gc import unittest import numpy as np import torch import torch.nn.functional as F from transformers import ( ClapTextConfig, ClapTextModelWithProjection, RobertaTokenizer, SpeechT5HifiGan, SpeechT5HifiGanConfig, ) from diffusers import ( AudioLDMPipeline, AutoencoderKL, DDIMScheduler, LMSDiscreteScheduler, PNDMScheduler, UNet2DConditionModel, ) from diffusers.utils import is_xformers_available from diffusers.utils.testing_utils import enable_full_determinism, nightly, torch_device from ..pipeline_params import TEXT_TO_AUDIO_BATCH_PARAMS, TEXT_TO_AUDIO_PARAMS from ..test_pipelines_common import PipelineTesterMixin enable_full_determinism() class AudioLDMPipelineFastTests(PipelineTesterMixin, unittest.TestCase): pipeline_class = AudioLDMPipeline params = TEXT_TO_AUDIO_PARAMS batch_params = TEXT_TO_AUDIO_BATCH_PARAMS required_optional_params = frozenset( [ "num_inference_steps", "num_waveforms_per_prompt", "generator", "latents", "output_type", "return_dict", "callback", "callback_steps", ] ) def get_dummy_components(self): torch.manual_seed(0) unet = UNet2DConditionModel( block_out_channels=(32, 64), layers_per_block=2, sample_size=32, in_channels=4, out_channels=4, down_block_types=("DownBlock2D", "CrossAttnDownBlock2D"), up_block_types=("CrossAttnUpBlock2D", "UpBlock2D"), cross_attention_dim=(32, 64), class_embed_type="simple_projection", projection_class_embeddings_input_dim=32, class_embeddings_concat=True, ) scheduler = DDIMScheduler( beta_start=0.00085, beta_end=0.012, beta_schedule="scaled_linear", clip_sample=False, set_alpha_to_one=False, ) torch.manual_seed(0) vae = AutoencoderKL( block_out_channels=[32, 64], in_channels=1, out_channels=1, down_block_types=["DownEncoderBlock2D", "DownEncoderBlock2D"], up_block_types=["UpDecoderBlock2D", "UpDecoderBlock2D"], latent_channels=4, ) torch.manual_seed(0) text_encoder_config = ClapTextConfig( bos_token_id=0, eos_token_id=2, hidden_size=32, intermediate_size=37, layer_norm_eps=1e-05, num_attention_heads=4, num_hidden_layers=5, pad_token_id=1, vocab_size=1000, projection_dim=32, ) text_encoder = ClapTextModelWithProjection(text_encoder_config) tokenizer = RobertaTokenizer.from_pretrained("hf-internal-testing/tiny-random-roberta", model_max_length=77) vocoder_config = SpeechT5HifiGanConfig( model_in_dim=8, sampling_rate=16000, upsample_initial_channel=16, upsample_rates=[2, 2], upsample_kernel_sizes=[4, 4], resblock_kernel_sizes=[3, 7], resblock_dilation_sizes=[[1, 3, 5], [1, 3, 5]], normalize_before=False, ) vocoder = SpeechT5HifiGan(vocoder_config) components = { "unet": unet, "scheduler": scheduler, "vae": vae, "text_encoder": text_encoder, "tokenizer": tokenizer, "vocoder": vocoder, } return components def get_dummy_inputs(self, device, seed=0): if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) inputs = { "prompt": "A hammer hitting a wooden surface", "generator": generator, "num_inference_steps": 2, "guidance_scale": 6.0, } return inputs def test_audioldm_ddim(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() audioldm_pipe = AudioLDMPipeline(**components) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(device) output = audioldm_pipe(**inputs) audio = output.audios[0] assert audio.ndim == 1 assert len(audio) == 256 audio_slice = audio[:10] expected_slice = np.array( [-0.0050, 0.0050, -0.0060, 0.0033, -0.0026, 0.0033, -0.0027, 0.0033, -0.0028, 0.0033] ) assert np.abs(audio_slice - expected_slice).max() < 1e-2 def test_audioldm_prompt_embeds(self): components = self.get_dummy_components() audioldm_pipe = AudioLDMPipeline(**components) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(torch_device) inputs["prompt"] = 3 * [inputs["prompt"]] # forward output = audioldm_pipe(**inputs) audio_1 = output.audios[0] inputs = self.get_dummy_inputs(torch_device) prompt = 3 * [inputs.pop("prompt")] text_inputs = audioldm_pipe.tokenizer( prompt, padding="max_length", max_length=audioldm_pipe.tokenizer.model_max_length, truncation=True, return_tensors="pt", ) text_inputs = text_inputs["input_ids"].to(torch_device) prompt_embeds = audioldm_pipe.text_encoder( text_inputs, ) prompt_embeds = prompt_embeds.text_embeds # additional L_2 normalization over each hidden-state prompt_embeds = F.normalize(prompt_embeds, dim=-1) inputs["prompt_embeds"] = prompt_embeds # forward output = audioldm_pipe(**inputs) audio_2 = output.audios[0] assert np.abs(audio_1 - audio_2).max() < 1e-2 def test_audioldm_negative_prompt_embeds(self): components = self.get_dummy_components() audioldm_pipe = AudioLDMPipeline(**components) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(torch_device) negative_prompt = 3 * ["this is a negative prompt"] inputs["negative_prompt"] = negative_prompt inputs["prompt"] = 3 * [inputs["prompt"]] # forward output = audioldm_pipe(**inputs) audio_1 = output.audios[0] inputs = self.get_dummy_inputs(torch_device) prompt = 3 * [inputs.pop("prompt")] embeds = [] for p in [prompt, negative_prompt]: text_inputs = audioldm_pipe.tokenizer( p, padding="max_length", max_length=audioldm_pipe.tokenizer.model_max_length, truncation=True, return_tensors="pt", ) text_inputs = text_inputs["input_ids"].to(torch_device) text_embeds = audioldm_pipe.text_encoder( text_inputs, ) text_embeds = text_embeds.text_embeds # additional L_2 normalization over each hidden-state text_embeds = F.normalize(text_embeds, dim=-1) embeds.append(text_embeds) inputs["prompt_embeds"], inputs["negative_prompt_embeds"] = embeds # forward output = audioldm_pipe(**inputs) audio_2 = output.audios[0] assert np.abs(audio_1 - audio_2).max() < 1e-2 def test_audioldm_negative_prompt(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() components["scheduler"] = PNDMScheduler(skip_prk_steps=True) audioldm_pipe = AudioLDMPipeline(**components) audioldm_pipe = audioldm_pipe.to(device) audioldm_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(device) negative_prompt = "egg cracking" output = audioldm_pipe(**inputs, negative_prompt=negative_prompt) audio = output.audios[0] assert audio.ndim == 1 assert len(audio) == 256 audio_slice = audio[:10] expected_slice = np.array( [-0.0051, 0.0050, -0.0060, 0.0034, -0.0026, 0.0033, -0.0027, 0.0033, -0.0028, 0.0032] ) assert np.abs(audio_slice - expected_slice).max() < 1e-2 def test_audioldm_num_waveforms_per_prompt(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() components["scheduler"] = PNDMScheduler(skip_prk_steps=True) audioldm_pipe = AudioLDMPipeline(**components) audioldm_pipe = audioldm_pipe.to(device) audioldm_pipe.set_progress_bar_config(disable=None) prompt = "A hammer hitting a wooden surface" # test num_waveforms_per_prompt=1 (default) audios = audioldm_pipe(prompt, num_inference_steps=2).audios assert audios.shape == (1, 256) # test num_waveforms_per_prompt=1 (default) for batch of prompts batch_size = 2 audios = audioldm_pipe([prompt] * batch_size, num_inference_steps=2).audios assert audios.shape == (batch_size, 256) # test num_waveforms_per_prompt for single prompt num_waveforms_per_prompt = 2 audios = audioldm_pipe(prompt, num_inference_steps=2, num_waveforms_per_prompt=num_waveforms_per_prompt).audios assert audios.shape == (num_waveforms_per_prompt, 256) # test num_waveforms_per_prompt for batch of prompts batch_size = 2 audios = audioldm_pipe( [prompt] * batch_size, num_inference_steps=2, num_waveforms_per_prompt=num_waveforms_per_prompt ).audios assert audios.shape == (batch_size * num_waveforms_per_prompt, 256) def test_audioldm_audio_length_in_s(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() audioldm_pipe = AudioLDMPipeline(**components) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe.set_progress_bar_config(disable=None) vocoder_sampling_rate = audioldm_pipe.vocoder.config.sampling_rate inputs = self.get_dummy_inputs(device) output = audioldm_pipe(audio_length_in_s=0.016, **inputs) audio = output.audios[0] assert audio.ndim == 1 assert len(audio) / vocoder_sampling_rate == 0.016 output = audioldm_pipe(audio_length_in_s=0.032, **inputs) audio = output.audios[0] assert audio.ndim == 1 assert len(audio) / vocoder_sampling_rate == 0.032 def test_audioldm_vocoder_model_in_dim(self): components = self.get_dummy_components() audioldm_pipe = AudioLDMPipeline(**components) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe.set_progress_bar_config(disable=None) prompt = ["hey"] output = audioldm_pipe(prompt, num_inference_steps=1) audio_shape = output.audios.shape assert audio_shape == (1, 256) config = audioldm_pipe.vocoder.config config.model_in_dim *= 2 audioldm_pipe.vocoder = SpeechT5HifiGan(config).to(torch_device) output = audioldm_pipe(prompt, num_inference_steps=1) audio_shape = output.audios.shape # waveform shape is unchanged, we just have 2x the number of mel channels in the spectrogram assert audio_shape == (1, 256) def test_attention_slicing_forward_pass(self): self._test_attention_slicing_forward_pass(test_mean_pixel_difference=False) def test_inference_batch_single_identical(self): self._test_inference_batch_single_identical() @unittest.skipIf( torch_device != "cuda" or not is_xformers_available(), reason="XFormers attention is only available with CUDA and `xformers` installed", ) def test_xformers_attention_forwardGenerator_pass(self): self._test_xformers_attention_forwardGenerator_pass(test_mean_pixel_difference=False) @nightly class AudioLDMPipelineSlowTests(unittest.TestCase): def setUp(self): super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): super().tearDown() gc.collect() torch.cuda.empty_cache() def get_inputs(self, device, generator_device="cpu", dtype=torch.float32, seed=0): generator = torch.Generator(device=generator_device).manual_seed(seed) latents = np.random.RandomState(seed).standard_normal((1, 8, 128, 16)) latents = torch.from_numpy(latents).to(device=device, dtype=dtype) inputs = { "prompt": "A hammer hitting a wooden surface", "latents": latents, "generator": generator, "num_inference_steps": 3, "guidance_scale": 2.5, } return inputs def test_audioldm(self): audioldm_pipe = AudioLDMPipeline.from_pretrained("cvssp/audioldm") audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe.set_progress_bar_config(disable=None) inputs = self.get_inputs(torch_device) inputs["num_inference_steps"] = 25 audio = audioldm_pipe(**inputs).audios[0] assert audio.ndim == 1 assert len(audio) == 81920 audio_slice = audio[77230:77240] expected_slice = np.array( [-0.4884, -0.4607, 0.0023, 0.5007, 0.5896, 0.5151, 0.3813, -0.0208, -0.3687, -0.4315] ) max_diff = np.abs(expected_slice - audio_slice).max() assert max_diff < 1e-2 @nightly class AudioLDMPipelineNightlyTests(unittest.TestCase): def setUp(self): super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): super().tearDown() gc.collect() torch.cuda.empty_cache() def get_inputs(self, device, generator_device="cpu", dtype=torch.float32, seed=0): generator = torch.Generator(device=generator_device).manual_seed(seed) latents = np.random.RandomState(seed).standard_normal((1, 8, 128, 16)) latents = torch.from_numpy(latents).to(device=device, dtype=dtype) inputs = { "prompt": "A hammer hitting a wooden surface", "latents": latents, "generator": generator, "num_inference_steps": 3, "guidance_scale": 2.5, } return inputs def test_audioldm_lms(self): audioldm_pipe = AudioLDMPipeline.from_pretrained("cvssp/audioldm") audioldm_pipe.scheduler = LMSDiscreteScheduler.from_config(audioldm_pipe.scheduler.config) audioldm_pipe = audioldm_pipe.to(torch_device) audioldm_pipe.set_progress_bar_config(disable=None) inputs = self.get_inputs(torch_device) audio = audioldm_pipe(**inputs).audios[0] assert audio.ndim == 1 assert len(audio) == 81920 audio_slice = audio[27780:27790] expected_slice = np.array([-0.2131, -0.0873, -0.0124, -0.0189, 0.0569, 0.1373, 0.1883, 0.2886, 0.3297, 0.2212]) max_diff = np.abs(expected_slice - audio_slice).max() assert max_diff < 3e-2
diffusers/tests/pipelines/audioldm/test_audioldm.py/0
{ "file_path": "diffusers/tests/pipelines/audioldm/test_audioldm.py", "repo_id": "diffusers", "token_count": 7604 }
145
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import gc import random import unittest import numpy as np import torch from transformers import ( CLIPImageProcessor, CLIPTextConfig, CLIPTextModel, CLIPTokenizer, CLIPVisionConfig, CLIPVisionModelWithProjection, ) from diffusers import ( AutoencoderKL, DDIMScheduler, I2VGenXLPipeline, ) from diffusers.models.unets import I2VGenXLUNet from diffusers.utils import is_xformers_available, load_image from diffusers.utils.testing_utils import ( enable_full_determinism, floats_tensor, numpy_cosine_similarity_distance, print_tensor_test, require_torch_gpu, skip_mps, slow, torch_device, ) from ..test_pipelines_common import PipelineTesterMixin, SDFunctionTesterMixin enable_full_determinism() @skip_mps class I2VGenXLPipelineFastTests(SDFunctionTesterMixin, PipelineTesterMixin, unittest.TestCase): pipeline_class = I2VGenXLPipeline params = frozenset(["prompt", "negative_prompt", "image"]) batch_params = frozenset(["prompt", "negative_prompt", "image", "generator"]) # No `output_type`. required_optional_params = frozenset(["num_inference_steps", "generator", "latents", "return_dict"]) def get_dummy_components(self): torch.manual_seed(0) scheduler = DDIMScheduler( beta_start=0.00085, beta_end=0.012, beta_schedule="scaled_linear", clip_sample=False, set_alpha_to_one=False, ) torch.manual_seed(0) unet = I2VGenXLUNet( block_out_channels=(4, 8), layers_per_block=1, sample_size=32, in_channels=4, out_channels=4, down_block_types=("CrossAttnDownBlock3D", "DownBlock3D"), up_block_types=("UpBlock3D", "CrossAttnUpBlock3D"), cross_attention_dim=4, attention_head_dim=4, num_attention_heads=None, norm_num_groups=2, ) torch.manual_seed(0) vae = AutoencoderKL( block_out_channels=(8,), in_channels=3, out_channels=3, down_block_types=["DownEncoderBlock2D"], up_block_types=["UpDecoderBlock2D"], latent_channels=4, sample_size=32, norm_num_groups=2, ) torch.manual_seed(0) text_encoder_config = CLIPTextConfig( bos_token_id=0, eos_token_id=2, hidden_size=4, intermediate_size=16, layer_norm_eps=1e-05, num_attention_heads=2, num_hidden_layers=2, pad_token_id=1, vocab_size=1000, hidden_act="gelu", projection_dim=32, ) text_encoder = CLIPTextModel(text_encoder_config) tokenizer = CLIPTokenizer.from_pretrained("hf-internal-testing/tiny-random-clip") torch.manual_seed(0) vision_encoder_config = CLIPVisionConfig( hidden_size=4, projection_dim=4, num_hidden_layers=2, num_attention_heads=2, image_size=32, intermediate_size=16, patch_size=1, ) image_encoder = CLIPVisionModelWithProjection(vision_encoder_config) torch.manual_seed(0) feature_extractor = CLIPImageProcessor(crop_size=32, size=32) components = { "unet": unet, "scheduler": scheduler, "vae": vae, "text_encoder": text_encoder, "image_encoder": image_encoder, "tokenizer": tokenizer, "feature_extractor": feature_extractor, } return components def get_dummy_inputs(self, device, seed=0): if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) input_image = floats_tensor((1, 3, 32, 32), rng=random.Random(seed)).to(device) inputs = { "prompt": "A painting of a squirrel eating a burger", "image": input_image, "generator": generator, "num_inference_steps": 2, "guidance_scale": 6.0, "output_type": "pt", "num_frames": 4, "width": 32, "height": 32, } return inputs def test_text_to_video_default_case(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe = pipe.to(device) pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(device) inputs["output_type"] = "np" frames = pipe(**inputs).frames image_slice = frames[0][0][-3:, -3:, -1] assert frames[0][0].shape == (32, 32, 3) expected_slice = np.array([0.5146, 0.6525, 0.6032, 0.5204, 0.5675, 0.4125, 0.3016, 0.5172, 0.4095]) assert np.abs(image_slice.flatten() - expected_slice).max() < 1e-2 def test_save_load_local(self): super().test_save_load_local(expected_max_difference=0.006) def test_sequential_cpu_offload_forward_pass(self): super().test_sequential_cpu_offload_forward_pass(expected_max_diff=0.008) def test_dict_tuple_outputs_equivalent(self): super().test_dict_tuple_outputs_equivalent(expected_max_difference=0.008) def test_save_load_optional_components(self): super().test_save_load_optional_components(expected_max_difference=0.008) @unittest.skip("Deprecated functionality") def test_attention_slicing_forward_pass(self): pass @unittest.skipIf( torch_device != "cuda" or not is_xformers_available(), reason="XFormers attention is only available with CUDA and `xformers` installed", ) def test_xformers_attention_forwardGenerator_pass(self): self._test_xformers_attention_forwardGenerator_pass(test_mean_pixel_difference=False, expected_max_diff=1e-2) def test_inference_batch_single_identical(self): super().test_inference_batch_single_identical(batch_size=2, expected_max_diff=0.008) def test_model_cpu_offload_forward_pass(self): super().test_model_cpu_offload_forward_pass(expected_max_diff=0.008) def test_num_videos_per_prompt(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe = pipe.to(device) pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(device) inputs["output_type"] = "np" frames = pipe(**inputs, num_videos_per_prompt=2).frames assert frames.shape == (2, 4, 32, 32, 3) assert frames[0][0].shape == (32, 32, 3) image_slice = frames[0][0][-3:, -3:, -1] expected_slice = np.array([0.5146, 0.6525, 0.6032, 0.5204, 0.5675, 0.4125, 0.3016, 0.5172, 0.4095]) assert np.abs(image_slice.flatten() - expected_slice).max() < 1e-2 @slow @require_torch_gpu class I2VGenXLPipelineSlowTests(unittest.TestCase): def setUp(self): # clean up the VRAM before each test super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): # clean up the VRAM after each test super().tearDown() gc.collect() torch.cuda.empty_cache() def test_i2vgen_xl(self): pipe = I2VGenXLPipeline.from_pretrained("ali-vilab/i2vgen-xl", torch_dtype=torch.float16, variant="fp16") pipe = pipe.to(torch_device) pipe.enable_model_cpu_offload() pipe.set_progress_bar_config(disable=None) image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/pix2pix/cat_6.png?download=true" ) generator = torch.Generator("cpu").manual_seed(0) num_frames = 3 output = pipe( image=image, prompt="my cat", num_frames=num_frames, generator=generator, num_inference_steps=3, output_type="np", ) image = output.frames[0] assert image.shape == (num_frames, 704, 1280, 3) image_slice = image[0, -3:, -3:, -1] print_tensor_test(image_slice.flatten()) expected_slice = np.array([0.5482, 0.6244, 0.6274, 0.4584, 0.5935, 0.5937, 0.4579, 0.5767, 0.5892]) assert numpy_cosine_similarity_distance(image_slice.flatten(), expected_slice.flatten()) < 1e-3
diffusers/tests/pipelines/i2vgen_xl/test_i2vgenxl.py/0
{ "file_path": "diffusers/tests/pipelines/i2vgen_xl/test_i2vgenxl.py", "repo_id": "diffusers", "token_count": 4310 }
146
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import random import unittest import numpy as np import torch from PIL import Image from torch import nn from transformers import ( CLIPImageProcessor, CLIPTextConfig, CLIPTextModelWithProjection, CLIPTokenizer, CLIPVisionConfig, CLIPVisionModelWithProjection, ) from diffusers import KandinskyV22PriorEmb2EmbPipeline, PriorTransformer, UnCLIPScheduler from diffusers.utils.testing_utils import enable_full_determinism, floats_tensor, skip_mps, torch_device from ..test_pipelines_common import PipelineTesterMixin enable_full_determinism() class KandinskyV22PriorEmb2EmbPipelineFastTests(PipelineTesterMixin, unittest.TestCase): pipeline_class = KandinskyV22PriorEmb2EmbPipeline params = ["prompt", "image"] batch_params = ["prompt", "image"] required_optional_params = [ "num_images_per_prompt", "strength", "generator", "num_inference_steps", "negative_prompt", "guidance_scale", "output_type", "return_dict", ] test_xformers_attention = False @property def text_embedder_hidden_size(self): return 32 @property def time_input_dim(self): return 32 @property def block_out_channels_0(self): return self.time_input_dim @property def time_embed_dim(self): return self.time_input_dim * 4 @property def cross_attention_dim(self): return 100 @property def dummy_tokenizer(self): tokenizer = CLIPTokenizer.from_pretrained("hf-internal-testing/tiny-random-clip") return tokenizer @property def dummy_text_encoder(self): torch.manual_seed(0) config = CLIPTextConfig( bos_token_id=0, eos_token_id=2, hidden_size=self.text_embedder_hidden_size, projection_dim=self.text_embedder_hidden_size, intermediate_size=37, layer_norm_eps=1e-05, num_attention_heads=4, num_hidden_layers=5, pad_token_id=1, vocab_size=1000, ) return CLIPTextModelWithProjection(config) @property def dummy_prior(self): torch.manual_seed(0) model_kwargs = { "num_attention_heads": 2, "attention_head_dim": 12, "embedding_dim": self.text_embedder_hidden_size, "num_layers": 1, } model = PriorTransformer(**model_kwargs) # clip_std and clip_mean is initialized to be 0 so PriorTransformer.post_process_latents will always return 0 - set clip_std to be 1 so it won't return 0 model.clip_std = nn.Parameter(torch.ones(model.clip_std.shape)) return model @property def dummy_image_encoder(self): torch.manual_seed(0) config = CLIPVisionConfig( hidden_size=self.text_embedder_hidden_size, image_size=224, projection_dim=self.text_embedder_hidden_size, intermediate_size=37, num_attention_heads=4, num_channels=3, num_hidden_layers=5, patch_size=14, ) model = CLIPVisionModelWithProjection(config) return model @property def dummy_image_processor(self): image_processor = CLIPImageProcessor( crop_size=224, do_center_crop=True, do_normalize=True, do_resize=True, image_mean=[0.48145466, 0.4578275, 0.40821073], image_std=[0.26862954, 0.26130258, 0.27577711], resample=3, size=224, ) return image_processor def get_dummy_components(self): prior = self.dummy_prior image_encoder = self.dummy_image_encoder text_encoder = self.dummy_text_encoder tokenizer = self.dummy_tokenizer image_processor = self.dummy_image_processor scheduler = UnCLIPScheduler( variance_type="fixed_small_log", prediction_type="sample", num_train_timesteps=1000, clip_sample=True, clip_sample_range=10.0, ) components = { "prior": prior, "image_encoder": image_encoder, "text_encoder": text_encoder, "tokenizer": tokenizer, "scheduler": scheduler, "image_processor": image_processor, } return components def get_dummy_inputs(self, device, seed=0): if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) image = floats_tensor((1, 3, 64, 64), rng=random.Random(seed)).to(device) image = image.cpu().permute(0, 2, 3, 1)[0] init_image = Image.fromarray(np.uint8(image)).convert("RGB").resize((256, 256)) inputs = { "prompt": "horse", "image": init_image, "strength": 0.5, "generator": generator, "guidance_scale": 4.0, "num_inference_steps": 2, "output_type": "np", } return inputs def test_kandinsky_prior_emb2emb(self): device = "cpu" components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe = pipe.to(device) pipe.set_progress_bar_config(disable=None) output = pipe(**self.get_dummy_inputs(device)) image = output.image_embeds image_from_tuple = pipe( **self.get_dummy_inputs(device), return_dict=False, )[0] image_slice = image[0, -10:] image_from_tuple_slice = image_from_tuple[0, -10:] assert image.shape == (1, 32) expected_slice = np.array( [ 0.1071284, 1.3330271, 0.61260223, -0.6691065, -0.3846852, -1.0303661, 0.22716111, 0.03348901, 0.30040675, -0.24805029, ] ) assert np.abs(image_slice.flatten() - expected_slice).max() < 1e-2 assert np.abs(image_from_tuple_slice.flatten() - expected_slice).max() < 1e-2 @skip_mps def test_inference_batch_single_identical(self): self._test_inference_batch_single_identical(expected_max_diff=1e-2) @skip_mps def test_attention_slicing_forward_pass(self): test_max_difference = torch_device == "cpu" test_mean_pixel_difference = False self._test_attention_slicing_forward_pass( test_max_difference=test_max_difference, test_mean_pixel_difference=test_mean_pixel_difference, )
diffusers/tests/pipelines/kandinsky2_2/test_kandinsky_prior_emb2emb.py/0
{ "file_path": "diffusers/tests/pipelines/kandinsky2_2/test_kandinsky_prior_emb2emb.py", "repo_id": "diffusers", "token_count": 3478 }
147
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import gc import random import unittest import numpy as np import torch from PIL import Image from transformers import CLIPImageProcessor, CLIPVisionConfig from diffusers import AutoencoderKL, PaintByExamplePipeline, PNDMScheduler, UNet2DConditionModel from diffusers.pipelines.paint_by_example import PaintByExampleImageEncoder from diffusers.utils.testing_utils import ( enable_full_determinism, floats_tensor, load_image, nightly, require_torch_gpu, torch_device, ) from ..pipeline_params import IMAGE_GUIDED_IMAGE_INPAINTING_BATCH_PARAMS, IMAGE_GUIDED_IMAGE_INPAINTING_PARAMS from ..test_pipelines_common import PipelineTesterMixin enable_full_determinism() class PaintByExamplePipelineFastTests(PipelineTesterMixin, unittest.TestCase): pipeline_class = PaintByExamplePipeline params = IMAGE_GUIDED_IMAGE_INPAINTING_PARAMS batch_params = IMAGE_GUIDED_IMAGE_INPAINTING_BATCH_PARAMS image_params = frozenset([]) # TO_DO: update the image_prams once refactored VaeImageProcessor.preprocess def get_dummy_components(self): torch.manual_seed(0) unet = UNet2DConditionModel( block_out_channels=(32, 64), layers_per_block=2, sample_size=32, in_channels=9, out_channels=4, down_block_types=("DownBlock2D", "CrossAttnDownBlock2D"), up_block_types=("CrossAttnUpBlock2D", "UpBlock2D"), cross_attention_dim=32, ) scheduler = PNDMScheduler(skip_prk_steps=True) torch.manual_seed(0) vae = AutoencoderKL( block_out_channels=[32, 64], in_channels=3, out_channels=3, down_block_types=["DownEncoderBlock2D", "DownEncoderBlock2D"], up_block_types=["UpDecoderBlock2D", "UpDecoderBlock2D"], latent_channels=4, ) torch.manual_seed(0) config = CLIPVisionConfig( hidden_size=32, projection_dim=32, intermediate_size=37, layer_norm_eps=1e-05, num_attention_heads=4, num_hidden_layers=5, image_size=32, patch_size=4, ) image_encoder = PaintByExampleImageEncoder(config, proj_size=32) feature_extractor = CLIPImageProcessor(crop_size=32, size=32) components = { "unet": unet, "scheduler": scheduler, "vae": vae, "image_encoder": image_encoder, "safety_checker": None, "feature_extractor": feature_extractor, } return components def convert_to_pt(self, image): image = np.array(image.convert("RGB")) image = image[None].transpose(0, 3, 1, 2) image = torch.from_numpy(image).to(dtype=torch.float32) / 127.5 - 1.0 return image def get_dummy_inputs(self, device="cpu", seed=0): # TODO: use tensor inputs instead of PIL, this is here just to leave the old expected_slices untouched image = floats_tensor((1, 3, 32, 32), rng=random.Random(seed)).to(device) image = image.cpu().permute(0, 2, 3, 1)[0] init_image = Image.fromarray(np.uint8(image)).convert("RGB").resize((64, 64)) mask_image = Image.fromarray(np.uint8(image + 4)).convert("RGB").resize((64, 64)) example_image = Image.fromarray(np.uint8(image)).convert("RGB").resize((32, 32)) if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) inputs = { "example_image": example_image, "image": init_image, "mask_image": mask_image, "generator": generator, "num_inference_steps": 2, "guidance_scale": 6.0, "output_type": "np", } return inputs def test_paint_by_example_inpaint(self): components = self.get_dummy_components() # make sure here that pndm scheduler skips prk pipe = PaintByExamplePipeline(**components) pipe = pipe.to("cpu") pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs() output = pipe(**inputs) image = output.images image_slice = image[0, -3:, -3:, -1] assert image.shape == (1, 64, 64, 3) expected_slice = np.array([0.4686, 0.5687, 0.4007, 0.5218, 0.5741, 0.4482, 0.4940, 0.4629, 0.4503]) assert np.abs(image_slice.flatten() - expected_slice).max() < 1e-2 def test_paint_by_example_image_tensor(self): device = "cpu" inputs = self.get_dummy_inputs() inputs.pop("mask_image") image = self.convert_to_pt(inputs.pop("image")) mask_image = image.clamp(0, 1) / 2 # make sure here that pndm scheduler skips prk pipe = PaintByExamplePipeline(**self.get_dummy_components()) pipe = pipe.to(device) pipe.set_progress_bar_config(disable=None) output = pipe(image=image, mask_image=mask_image[:, 0], **inputs) out_1 = output.images image = image.cpu().permute(0, 2, 3, 1)[0] mask_image = mask_image.cpu().permute(0, 2, 3, 1)[0] image = Image.fromarray(np.uint8(image)).convert("RGB") mask_image = Image.fromarray(np.uint8(mask_image)).convert("RGB") output = pipe(**self.get_dummy_inputs()) out_2 = output.images assert out_1.shape == (1, 64, 64, 3) assert np.abs(out_1.flatten() - out_2.flatten()).max() < 5e-2 def test_inference_batch_single_identical(self): super().test_inference_batch_single_identical(expected_max_diff=3e-3) @nightly @require_torch_gpu class PaintByExamplePipelineIntegrationTests(unittest.TestCase): def setUp(self): # clean up the VRAM before each test super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): # clean up the VRAM after each test super().tearDown() gc.collect() torch.cuda.empty_cache() def test_paint_by_example(self): # make sure here that pndm scheduler skips prk init_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main" "/paint_by_example/dog_in_bucket.png" ) mask_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main" "/paint_by_example/mask.png" ) example_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main" "/paint_by_example/panda.jpg" ) pipe = PaintByExamplePipeline.from_pretrained("Fantasy-Studio/Paint-by-Example") pipe = pipe.to(torch_device) pipe.set_progress_bar_config(disable=None) generator = torch.manual_seed(321) output = pipe( image=init_image, mask_image=mask_image, example_image=example_image, generator=generator, guidance_scale=5.0, num_inference_steps=50, output_type="np", ) image = output.images image_slice = image[0, -3:, -3:, -1] assert image.shape == (1, 512, 512, 3) expected_slice = np.array([0.4834, 0.4811, 0.4874, 0.5122, 0.5081, 0.5144, 0.5291, 0.5290, 0.5374]) assert np.abs(image_slice.flatten() - expected_slice).max() < 1e-2
diffusers/tests/pipelines/paint_by_example/test_paint_by_example.py/0
{ "file_path": "diffusers/tests/pipelines/paint_by_example/test_paint_by_example.py", "repo_id": "diffusers", "token_count": 3723 }
148
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import gc import unittest import numpy as np import torch import torch.nn as nn import torch.nn.functional as F from transformers import CLIPTextConfig, CLIPTextModelWithProjection, CLIPTokenizer from diffusers import DDPMWuerstchenScheduler, StableCascadePriorPipeline from diffusers.loaders import AttnProcsLayers from diffusers.models import StableCascadeUNet from diffusers.models.attention_processor import LoRAAttnProcessor, LoRAAttnProcessor2_0 from diffusers.utils.import_utils import is_peft_available from diffusers.utils.testing_utils import ( enable_full_determinism, load_numpy, numpy_cosine_similarity_distance, require_peft_backend, require_torch_gpu, skip_mps, slow, torch_device, ) if is_peft_available(): from peft import LoraConfig from peft.tuners.tuners_utils import BaseTunerLayer from ..test_pipelines_common import PipelineTesterMixin enable_full_determinism() def create_prior_lora_layers(unet: nn.Module): lora_attn_procs = {} for name in unet.attn_processors.keys(): lora_attn_processor_class = ( LoRAAttnProcessor2_0 if hasattr(F, "scaled_dot_product_attention") else LoRAAttnProcessor ) lora_attn_procs[name] = lora_attn_processor_class( hidden_size=unet.config.c, ) unet_lora_layers = AttnProcsLayers(lora_attn_procs) return lora_attn_procs, unet_lora_layers class StableCascadePriorPipelineFastTests(PipelineTesterMixin, unittest.TestCase): pipeline_class = StableCascadePriorPipeline params = ["prompt"] batch_params = ["prompt", "negative_prompt"] required_optional_params = [ "num_images_per_prompt", "generator", "num_inference_steps", "latents", "negative_prompt", "guidance_scale", "output_type", "return_dict", ] test_xformers_attention = False callback_cfg_params = ["text_encoder_hidden_states"] @property def text_embedder_hidden_size(self): return 32 @property def time_input_dim(self): return 32 @property def block_out_channels_0(self): return self.time_input_dim @property def time_embed_dim(self): return self.time_input_dim * 4 @property def dummy_tokenizer(self): tokenizer = CLIPTokenizer.from_pretrained("hf-internal-testing/tiny-random-clip") return tokenizer @property def dummy_text_encoder(self): torch.manual_seed(0) config = CLIPTextConfig( bos_token_id=0, eos_token_id=2, hidden_size=self.text_embedder_hidden_size, projection_dim=self.text_embedder_hidden_size, intermediate_size=37, layer_norm_eps=1e-05, num_attention_heads=4, num_hidden_layers=5, pad_token_id=1, vocab_size=1000, ) return CLIPTextModelWithProjection(config).eval() @property def dummy_prior(self): torch.manual_seed(0) model_kwargs = { "conditioning_dim": 128, "block_out_channels": (128, 128), "num_attention_heads": (2, 2), "down_num_layers_per_block": (1, 1), "up_num_layers_per_block": (1, 1), "switch_level": (False,), "clip_image_in_channels": 768, "clip_text_in_channels": self.text_embedder_hidden_size, "clip_text_pooled_in_channels": self.text_embedder_hidden_size, "dropout": (0.1, 0.1), } model = StableCascadeUNet(**model_kwargs) return model.eval() def get_dummy_components(self): prior = self.dummy_prior text_encoder = self.dummy_text_encoder tokenizer = self.dummy_tokenizer scheduler = DDPMWuerstchenScheduler() components = { "prior": prior, "text_encoder": text_encoder, "tokenizer": tokenizer, "scheduler": scheduler, "feature_extractor": None, "image_encoder": None, } return components def get_dummy_inputs(self, device, seed=0): if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) inputs = { "prompt": "horse", "generator": generator, "guidance_scale": 4.0, "num_inference_steps": 2, "output_type": "np", } return inputs def test_wuerstchen_prior(self): device = "cpu" components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe = pipe.to(device) pipe.set_progress_bar_config(disable=None) output = pipe(**self.get_dummy_inputs(device)) image = output.image_embeddings image_from_tuple = pipe(**self.get_dummy_inputs(device), return_dict=False)[0] image_slice = image[0, 0, 0, -10:] image_from_tuple_slice = image_from_tuple[0, 0, 0, -10:] assert image.shape == (1, 16, 24, 24) expected_slice = np.array( [ 96.139565, -20.213179, -116.40341, -191.57129, 39.350136, 74.80767, 39.782352, -184.67352, -46.426907, 168.41783, ] ) assert np.abs(image_slice.flatten() - expected_slice).max() < 5e-2 assert np.abs(image_from_tuple_slice.flatten() - expected_slice).max() < 5e-2 @skip_mps def test_inference_batch_single_identical(self): self._test_inference_batch_single_identical(expected_max_diff=2e-1) @skip_mps def test_attention_slicing_forward_pass(self): test_max_difference = torch_device == "cpu" test_mean_pixel_difference = False self._test_attention_slicing_forward_pass( test_max_difference=test_max_difference, test_mean_pixel_difference=test_mean_pixel_difference, ) @unittest.skip(reason="fp16 not supported") def test_float16_inference(self): super().test_float16_inference() def check_if_lora_correctly_set(self, model) -> bool: """ Checks if the LoRA layers are correctly set with peft """ for module in model.modules(): if isinstance(module, BaseTunerLayer): return True return False def get_lora_components(self): prior = self.dummy_prior prior_lora_config = LoraConfig( r=4, lora_alpha=4, target_modules=["to_q", "to_k", "to_v", "to_out.0"], init_lora_weights=False ) prior_lora_attn_procs, prior_lora_layers = create_prior_lora_layers(prior) lora_components = { "prior_lora_layers": prior_lora_layers, "prior_lora_attn_procs": prior_lora_attn_procs, } return prior, prior_lora_config, lora_components @require_peft_backend @unittest.skip(reason="no lora support for now") def test_inference_with_prior_lora(self): _, prior_lora_config, _ = self.get_lora_components() device = "cpu" components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe = pipe.to(device) pipe.set_progress_bar_config(disable=None) output_no_lora = pipe(**self.get_dummy_inputs(device)) image_embed = output_no_lora.image_embeddings self.assertTrue(image_embed.shape == (1, 16, 24, 24)) pipe.prior.add_adapter(prior_lora_config) self.assertTrue(self.check_if_lora_correctly_set(pipe.prior), "Lora not correctly set in prior") output_lora = pipe(**self.get_dummy_inputs(device)) lora_image_embed = output_lora.image_embeddings self.assertTrue(image_embed.shape == lora_image_embed.shape) def test_stable_cascade_decoder_prompt_embeds(self): device = "cpu" components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe.set_progress_bar_config(disable=None) prompt = "A photograph of a shiba inu, wearing a hat" ( prompt_embeds, prompt_embeds_pooled, negative_prompt_embeds, negative_prompt_embeds_pooled, ) = pipe.encode_prompt(device, 1, 1, False, prompt=prompt) generator = torch.Generator(device=device) output_prompt = pipe( prompt=prompt, num_inference_steps=1, output_type="np", generator=generator.manual_seed(0), ) output_prompt_embeds = pipe( prompt=None, prompt_embeds=prompt_embeds, prompt_embeds_pooled=prompt_embeds_pooled, negative_prompt_embeds=negative_prompt_embeds, negative_prompt_embeds_pooled=negative_prompt_embeds_pooled, num_inference_steps=1, output_type="np", generator=generator.manual_seed(0), ) assert np.abs(output_prompt.image_embeddings - output_prompt_embeds.image_embeddings).max() < 1e-5 @slow @require_torch_gpu class StableCascadePriorPipelineIntegrationTests(unittest.TestCase): def setUp(self): # clean up the VRAM before each test super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): # clean up the VRAM after each test super().tearDown() gc.collect() torch.cuda.empty_cache() def test_stable_cascade_prior(self): pipe = StableCascadePriorPipeline.from_pretrained( "stabilityai/stable-cascade-prior", variant="bf16", torch_dtype=torch.bfloat16 ) pipe.enable_model_cpu_offload() pipe.set_progress_bar_config(disable=None) prompt = "A photograph of the inside of a subway train. There are raccoons sitting on the seats. One of them is reading a newspaper. The window shows the city in the background." generator = torch.Generator(device="cpu").manual_seed(0) output = pipe(prompt, num_inference_steps=2, output_type="np", generator=generator) image_embedding = output.image_embeddings expected_image_embedding = load_numpy( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/stable_cascade/stable_cascade_prior_image_embeddings.npy" ) assert image_embedding.shape == (1, 16, 24, 24) max_diff = numpy_cosine_similarity_distance(image_embedding.flatten(), expected_image_embedding.flatten()) assert max_diff < 1e-4
diffusers/tests/pipelines/stable_cascade/test_stable_cascade_prior.py/0
{ "file_path": "diffusers/tests/pipelines/stable_cascade/test_stable_cascade_prior.py", "repo_id": "diffusers", "token_count": 5221 }
149
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import gc import unittest from diffusers import FlaxStableDiffusionInpaintPipeline from diffusers.utils import is_flax_available, load_image from diffusers.utils.testing_utils import require_flax, slow if is_flax_available(): import jax import jax.numpy as jnp from flax.jax_utils import replicate from flax.training.common_utils import shard @slow @require_flax class FlaxStableDiffusionInpaintPipelineIntegrationTests(unittest.TestCase): def tearDown(self): # clean up the VRAM after each test super().tearDown() gc.collect() def test_stable_diffusion_inpaint_pipeline(self): init_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main" "/sd2-inpaint/init_image.png" ) mask_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/sd2-inpaint/mask.png" ) model_id = "xvjiarui/stable-diffusion-2-inpainting" pipeline, params = FlaxStableDiffusionInpaintPipeline.from_pretrained(model_id, safety_checker=None) prompt = "Face of a yellow cat, high resolution, sitting on a park bench" prng_seed = jax.random.PRNGKey(0) num_inference_steps = 50 num_samples = jax.device_count() prompt = num_samples * [prompt] init_image = num_samples * [init_image] mask_image = num_samples * [mask_image] prompt_ids, processed_masked_images, processed_masks = pipeline.prepare_inputs(prompt, init_image, mask_image) # shard inputs and rng params = replicate(params) prng_seed = jax.random.split(prng_seed, jax.device_count()) prompt_ids = shard(prompt_ids) processed_masked_images = shard(processed_masked_images) processed_masks = shard(processed_masks) output = pipeline( prompt_ids, processed_masks, processed_masked_images, params, prng_seed, num_inference_steps, jit=True ) images = output.images.reshape(num_samples, 512, 512, 3) image_slice = images[0, 253:256, 253:256, -1] output_slice = jnp.asarray(jax.device_get(image_slice.flatten())) expected_slice = jnp.array( [0.3611307, 0.37649736, 0.3757408, 0.38213953, 0.39295167, 0.3841631, 0.41554978, 0.4137475, 0.4217084] ) print(f"output_slice: {output_slice}") assert jnp.abs(output_slice - expected_slice).max() < 1e-2
diffusers/tests/pipelines/stable_diffusion_2/test_stable_diffusion_flax_inpaint.py/0
{ "file_path": "diffusers/tests/pipelines/stable_diffusion_2/test_stable_diffusion_flax_inpaint.py", "repo_id": "diffusers", "token_count": 1259 }
150
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import gc import unittest import numpy as np import torch from transformers import CLIPTextConfig, CLIPTextModel, CLIPTokenizer from diffusers import ( AutoencoderKL, DDIMScheduler, PNDMScheduler, StableDiffusionLDM3DPipeline, UNet2DConditionModel, ) from diffusers.utils.testing_utils import enable_full_determinism, nightly, require_torch_gpu, torch_device from ..pipeline_params import TEXT_TO_IMAGE_BATCH_PARAMS, TEXT_TO_IMAGE_IMAGE_PARAMS, TEXT_TO_IMAGE_PARAMS enable_full_determinism() class StableDiffusionLDM3DPipelineFastTests(unittest.TestCase): pipeline_class = StableDiffusionLDM3DPipeline params = TEXT_TO_IMAGE_PARAMS batch_params = TEXT_TO_IMAGE_BATCH_PARAMS image_params = TEXT_TO_IMAGE_IMAGE_PARAMS def get_dummy_components(self): torch.manual_seed(0) unet = UNet2DConditionModel( block_out_channels=(32, 64), layers_per_block=2, sample_size=32, in_channels=4, out_channels=4, down_block_types=("DownBlock2D", "CrossAttnDownBlock2D"), up_block_types=("CrossAttnUpBlock2D", "UpBlock2D"), cross_attention_dim=32, ) scheduler = DDIMScheduler( beta_start=0.00085, beta_end=0.012, beta_schedule="scaled_linear", clip_sample=False, set_alpha_to_one=False, ) torch.manual_seed(0) vae = AutoencoderKL( block_out_channels=[32, 64], in_channels=6, out_channels=6, down_block_types=["DownEncoderBlock2D", "DownEncoderBlock2D"], up_block_types=["UpDecoderBlock2D", "UpDecoderBlock2D"], latent_channels=4, ) torch.manual_seed(0) text_encoder_config = CLIPTextConfig( bos_token_id=0, eos_token_id=2, hidden_size=32, intermediate_size=37, layer_norm_eps=1e-05, num_attention_heads=4, num_hidden_layers=5, pad_token_id=1, vocab_size=1000, ) text_encoder = CLIPTextModel(text_encoder_config) tokenizer = CLIPTokenizer.from_pretrained("hf-internal-testing/tiny-random-clip") components = { "unet": unet, "scheduler": scheduler, "vae": vae, "text_encoder": text_encoder, "tokenizer": tokenizer, "safety_checker": None, "feature_extractor": None, "image_encoder": None, } return components def get_dummy_inputs(self, device, seed=0): if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) inputs = { "prompt": "A painting of a squirrel eating a burger", "generator": generator, "num_inference_steps": 2, "guidance_scale": 6.0, "output_type": "np", } return inputs def test_stable_diffusion_ddim(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() ldm3d_pipe = StableDiffusionLDM3DPipeline(**components) ldm3d_pipe = ldm3d_pipe.to(torch_device) ldm3d_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(device) output = ldm3d_pipe(**inputs) rgb, depth = output.rgb, output.depth image_slice_rgb = rgb[0, -3:, -3:, -1] image_slice_depth = depth[0, -3:, -1] assert rgb.shape == (1, 64, 64, 3) assert depth.shape == (1, 64, 64) expected_slice_rgb = np.array( [0.37338176, 0.70247, 0.74203193, 0.51643604, 0.58256793, 0.60932136, 0.4181095, 0.48355877, 0.46535262] ) expected_slice_depth = np.array([103.46727, 85.812004, 87.849236]) assert np.abs(image_slice_rgb.flatten() - expected_slice_rgb).max() < 1e-2 assert np.abs(image_slice_depth.flatten() - expected_slice_depth).max() < 1e-2 def test_stable_diffusion_prompt_embeds(self): components = self.get_dummy_components() ldm3d_pipe = StableDiffusionLDM3DPipeline(**components) ldm3d_pipe = ldm3d_pipe.to(torch_device) ldm3d_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(torch_device) inputs["prompt"] = 3 * [inputs["prompt"]] # forward output = ldm3d_pipe(**inputs) rgb_slice_1, depth_slice_1 = output.rgb, output.depth rgb_slice_1 = rgb_slice_1[0, -3:, -3:, -1] depth_slice_1 = depth_slice_1[0, -3:, -1] inputs = self.get_dummy_inputs(torch_device) prompt = 3 * [inputs.pop("prompt")] text_inputs = ldm3d_pipe.tokenizer( prompt, padding="max_length", max_length=ldm3d_pipe.tokenizer.model_max_length, truncation=True, return_tensors="pt", ) text_inputs = text_inputs["input_ids"].to(torch_device) prompt_embeds = ldm3d_pipe.text_encoder(text_inputs)[0] inputs["prompt_embeds"] = prompt_embeds # forward output = ldm3d_pipe(**inputs) rgb_slice_2, depth_slice_2 = output.rgb, output.depth rgb_slice_2 = rgb_slice_2[0, -3:, -3:, -1] depth_slice_2 = depth_slice_2[0, -3:, -1] assert np.abs(rgb_slice_1.flatten() - rgb_slice_2.flatten()).max() < 1e-4 assert np.abs(depth_slice_1.flatten() - depth_slice_2.flatten()).max() < 1e-4 def test_stable_diffusion_negative_prompt(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() components["scheduler"] = PNDMScheduler(skip_prk_steps=True) ldm3d_pipe = StableDiffusionLDM3DPipeline(**components) ldm3d_pipe = ldm3d_pipe.to(device) ldm3d_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(device) negative_prompt = "french fries" output = ldm3d_pipe(**inputs, negative_prompt=negative_prompt) rgb, depth = output.rgb, output.depth rgb_slice = rgb[0, -3:, -3:, -1] depth_slice = depth[0, -3:, -1] assert rgb.shape == (1, 64, 64, 3) assert depth.shape == (1, 64, 64) expected_slice_rgb = np.array( [0.37044, 0.71811503, 0.7223251, 0.48603675, 0.5638391, 0.6364948, 0.42833704, 0.4901315, 0.47926217] ) expected_slice_depth = np.array([107.84738, 84.62802, 89.962135]) assert np.abs(rgb_slice.flatten() - expected_slice_rgb).max() < 1e-2 assert np.abs(depth_slice.flatten() - expected_slice_depth).max() < 1e-2 @nightly @require_torch_gpu class StableDiffusionLDM3DPipelineSlowTests(unittest.TestCase): def setUp(self): super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): super().tearDown() gc.collect() torch.cuda.empty_cache() def get_inputs(self, device, generator_device="cpu", dtype=torch.float32, seed=0): generator = torch.Generator(device=generator_device).manual_seed(seed) latents = np.random.RandomState(seed).standard_normal((1, 4, 64, 64)) latents = torch.from_numpy(latents).to(device=device, dtype=dtype) inputs = { "prompt": "a photograph of an astronaut riding a horse", "latents": latents, "generator": generator, "num_inference_steps": 3, "guidance_scale": 7.5, "output_type": "np", } return inputs def test_ldm3d_stable_diffusion(self): ldm3d_pipe = StableDiffusionLDM3DPipeline.from_pretrained("Intel/ldm3d") ldm3d_pipe = ldm3d_pipe.to(torch_device) ldm3d_pipe.set_progress_bar_config(disable=None) inputs = self.get_inputs(torch_device) output = ldm3d_pipe(**inputs) rgb, depth = output.rgb, output.depth rgb_slice = rgb[0, -3:, -3:, -1].flatten() depth_slice = rgb[0, -3:, -1].flatten() assert rgb.shape == (1, 512, 512, 3) assert depth.shape == (1, 512, 512) expected_slice_rgb = np.array( [0.53805465, 0.56707305, 0.5486515, 0.57012236, 0.5814511, 0.56253487, 0.54843014, 0.55092263, 0.6459706] ) expected_slice_depth = np.array( [0.9263781, 0.6678672, 0.5486515, 0.92202145, 0.67831135, 0.56253487, 0.9241694, 0.7551478, 0.6459706] ) assert np.abs(rgb_slice - expected_slice_rgb).max() < 3e-3 assert np.abs(depth_slice - expected_slice_depth).max() < 3e-3 @nightly @require_torch_gpu class StableDiffusionPipelineNightlyTests(unittest.TestCase): def setUp(self): super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): super().tearDown() gc.collect() torch.cuda.empty_cache() def get_inputs(self, device, generator_device="cpu", dtype=torch.float32, seed=0): generator = torch.Generator(device=generator_device).manual_seed(seed) latents = np.random.RandomState(seed).standard_normal((1, 4, 64, 64)) latents = torch.from_numpy(latents).to(device=device, dtype=dtype) inputs = { "prompt": "a photograph of an astronaut riding a horse", "latents": latents, "generator": generator, "num_inference_steps": 50, "guidance_scale": 7.5, "output_type": "np", } return inputs def test_ldm3d(self): ldm3d_pipe = StableDiffusionLDM3DPipeline.from_pretrained("Intel/ldm3d").to(torch_device) ldm3d_pipe.set_progress_bar_config(disable=None) inputs = self.get_inputs(torch_device) output = ldm3d_pipe(**inputs) rgb, depth = output.rgb, output.depth expected_rgb_mean = 0.495586 expected_rgb_std = 0.33795515 expected_depth_mean = 112.48518 expected_depth_std = 98.489746 assert np.abs(expected_rgb_mean - rgb.mean()) < 1e-3 assert np.abs(expected_rgb_std - rgb.std()) < 1e-3 assert np.abs(expected_depth_mean - depth.mean()) < 1e-3 assert np.abs(expected_depth_std - depth.std()) < 1e-3 def test_ldm3d_v2(self): ldm3d_pipe = StableDiffusionLDM3DPipeline.from_pretrained("Intel/ldm3d-4c").to(torch_device) ldm3d_pipe.set_progress_bar_config(disable=None) inputs = self.get_inputs(torch_device) output = ldm3d_pipe(**inputs) rgb, depth = output.rgb, output.depth expected_rgb_mean = 0.4194127 expected_rgb_std = 0.35375586 expected_depth_mean = 0.5638502 expected_depth_std = 0.34686103 assert rgb.shape == (1, 512, 512, 3) assert depth.shape == (1, 512, 512, 1) assert np.abs(expected_rgb_mean - rgb.mean()) < 1e-3 assert np.abs(expected_rgb_std - rgb.std()) < 1e-3 assert np.abs(expected_depth_mean - depth.mean()) < 1e-3 assert np.abs(expected_depth_std - depth.std()) < 1e-3
diffusers/tests/pipelines/stable_diffusion_ldm3d/test_stable_diffusion_ldm3d.py/0
{ "file_path": "diffusers/tests/pipelines/stable_diffusion_ldm3d/test_stable_diffusion_ldm3d.py", "repo_id": "diffusers", "token_count": 5675 }
151
import gc import random import unittest import numpy as np import torch from transformers import ( CLIPImageProcessor, CLIPTextConfig, CLIPTextModel, CLIPTokenizer, CLIPVisionConfig, CLIPVisionModelWithProjection, ) from diffusers import AutoencoderKL, DDIMScheduler, DDPMScheduler, StableUnCLIPImg2ImgPipeline, UNet2DConditionModel from diffusers.pipelines.pipeline_utils import DiffusionPipeline from diffusers.pipelines.stable_diffusion.stable_unclip_image_normalizer import StableUnCLIPImageNormalizer from diffusers.utils.import_utils import is_xformers_available from diffusers.utils.testing_utils import ( enable_full_determinism, floats_tensor, load_image, load_numpy, nightly, require_torch_gpu, skip_mps, torch_device, ) from ..pipeline_params import TEXT_GUIDED_IMAGE_VARIATION_BATCH_PARAMS, TEXT_GUIDED_IMAGE_VARIATION_PARAMS from ..test_pipelines_common import ( PipelineKarrasSchedulerTesterMixin, PipelineLatentTesterMixin, PipelineTesterMixin, assert_mean_pixel_difference, ) enable_full_determinism() class StableUnCLIPImg2ImgPipelineFastTests( PipelineLatentTesterMixin, PipelineKarrasSchedulerTesterMixin, PipelineTesterMixin, unittest.TestCase ): pipeline_class = StableUnCLIPImg2ImgPipeline params = TEXT_GUIDED_IMAGE_VARIATION_PARAMS batch_params = TEXT_GUIDED_IMAGE_VARIATION_BATCH_PARAMS image_params = frozenset( [] ) # TO-DO: update image_params once pipeline is refactored with VaeImageProcessor.preprocess image_latents_params = frozenset([]) def get_dummy_components(self): embedder_hidden_size = 32 embedder_projection_dim = embedder_hidden_size # image encoding components feature_extractor = CLIPImageProcessor(crop_size=32, size=32) torch.manual_seed(0) image_encoder = CLIPVisionModelWithProjection( CLIPVisionConfig( hidden_size=embedder_hidden_size, projection_dim=embedder_projection_dim, num_hidden_layers=5, num_attention_heads=4, image_size=32, intermediate_size=37, patch_size=1, ) ) # regular denoising components torch.manual_seed(0) image_normalizer = StableUnCLIPImageNormalizer(embedding_dim=embedder_hidden_size) image_noising_scheduler = DDPMScheduler(beta_schedule="squaredcos_cap_v2") torch.manual_seed(0) tokenizer = CLIPTokenizer.from_pretrained("hf-internal-testing/tiny-random-clip") torch.manual_seed(0) text_encoder = CLIPTextModel( CLIPTextConfig( bos_token_id=0, eos_token_id=2, hidden_size=embedder_hidden_size, projection_dim=32, intermediate_size=37, layer_norm_eps=1e-05, num_attention_heads=4, num_hidden_layers=5, pad_token_id=1, vocab_size=1000, ) ) torch.manual_seed(0) unet = UNet2DConditionModel( sample_size=32, in_channels=4, out_channels=4, down_block_types=("CrossAttnDownBlock2D", "DownBlock2D"), up_block_types=("UpBlock2D", "CrossAttnUpBlock2D"), block_out_channels=(32, 64), attention_head_dim=(2, 4), class_embed_type="projection", # The class embeddings are the noise augmented image embeddings. # I.e. the image embeddings concated with the noised embeddings of the same dimension projection_class_embeddings_input_dim=embedder_projection_dim * 2, cross_attention_dim=embedder_hidden_size, layers_per_block=1, upcast_attention=True, use_linear_projection=True, ) torch.manual_seed(0) scheduler = DDIMScheduler( beta_schedule="scaled_linear", beta_start=0.00085, beta_end=0.012, prediction_type="v_prediction", set_alpha_to_one=False, steps_offset=1, ) torch.manual_seed(0) vae = AutoencoderKL() components = { # image encoding components "feature_extractor": feature_extractor, "image_encoder": image_encoder.eval(), # image noising components "image_normalizer": image_normalizer.eval(), "image_noising_scheduler": image_noising_scheduler, # regular denoising components "tokenizer": tokenizer, "text_encoder": text_encoder.eval(), "unet": unet.eval(), "scheduler": scheduler, "vae": vae.eval(), } return components def get_dummy_inputs(self, device, seed=0, pil_image=True): if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) input_image = floats_tensor((1, 3, 32, 32), rng=random.Random(seed)).to(device) if pil_image: input_image = input_image * 0.5 + 0.5 input_image = input_image.clamp(0, 1) input_image = input_image.cpu().permute(0, 2, 3, 1).float().numpy() input_image = DiffusionPipeline.numpy_to_pil(input_image)[0] return { "prompt": "An anime racoon running a marathon", "image": input_image, "generator": generator, "num_inference_steps": 2, "output_type": "np", } @skip_mps def test_image_embeds_none(self): device = "cpu" # ensure determinism for the device-dependent torch.Generator components = self.get_dummy_components() sd_pipe = StableUnCLIPImg2ImgPipeline(**components) sd_pipe = sd_pipe.to(device) sd_pipe.set_progress_bar_config(disable=None) inputs = self.get_dummy_inputs(device) inputs.update({"image_embeds": None}) image = sd_pipe(**inputs).images image_slice = image[0, -3:, -3:, -1] assert image.shape == (1, 32, 32, 3) expected_slice = np.array([0.3872, 0.7224, 0.5601, 0.4741, 0.6872, 0.5814, 0.4636, 0.3867, 0.5078]) assert np.abs(image_slice.flatten() - expected_slice).max() < 1e-3 # Overriding PipelineTesterMixin::test_attention_slicing_forward_pass # because GPU undeterminism requires a looser check. def test_attention_slicing_forward_pass(self): test_max_difference = torch_device in ["cpu", "mps"] self._test_attention_slicing_forward_pass(test_max_difference=test_max_difference) # Overriding PipelineTesterMixin::test_inference_batch_single_identical # because undeterminism requires a looser check. def test_inference_batch_single_identical(self): self._test_inference_batch_single_identical(expected_max_diff=1e-3) @unittest.skipIf( torch_device != "cuda" or not is_xformers_available(), reason="XFormers attention is only available with CUDA and `xformers` installed", ) def test_xformers_attention_forwardGenerator_pass(self): self._test_xformers_attention_forwardGenerator_pass(test_max_difference=False) @nightly @require_torch_gpu class StableUnCLIPImg2ImgPipelineIntegrationTests(unittest.TestCase): def setUp(self): # clean up the VRAM before each test super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): # clean up the VRAM after each test super().tearDown() gc.collect() torch.cuda.empty_cache() def test_stable_unclip_l_img2img(self): input_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/stable_unclip/turtle.png" ) expected_image = load_numpy( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/stable_unclip/stable_unclip_2_1_l_img2img_anime_turtle_fp16.npy" ) pipe = StableUnCLIPImg2ImgPipeline.from_pretrained( "fusing/stable-unclip-2-1-l-img2img", torch_dtype=torch.float16 ) pipe.to(torch_device) pipe.set_progress_bar_config(disable=None) # stable unclip will oom when integration tests are run on a V100, # so turn on memory savings pipe.enable_attention_slicing() pipe.enable_sequential_cpu_offload() generator = torch.Generator(device="cpu").manual_seed(0) output = pipe(input_image, "anime turle", generator=generator, output_type="np") image = output.images[0] assert image.shape == (768, 768, 3) assert_mean_pixel_difference(image, expected_image) def test_stable_unclip_h_img2img(self): input_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/stable_unclip/turtle.png" ) expected_image = load_numpy( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/stable_unclip/stable_unclip_2_1_h_img2img_anime_turtle_fp16.npy" ) pipe = StableUnCLIPImg2ImgPipeline.from_pretrained( "fusing/stable-unclip-2-1-h-img2img", torch_dtype=torch.float16 ) pipe.to(torch_device) pipe.set_progress_bar_config(disable=None) # stable unclip will oom when integration tests are run on a V100, # so turn on memory savings pipe.enable_attention_slicing() pipe.enable_sequential_cpu_offload() generator = torch.Generator(device="cpu").manual_seed(0) output = pipe(input_image, "anime turle", generator=generator, output_type="np") image = output.images[0] assert image.shape == (768, 768, 3) assert_mean_pixel_difference(image, expected_image) def test_stable_unclip_img2img_pipeline_with_sequential_cpu_offloading(self): input_image = load_image( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main/stable_unclip/turtle.png" ) torch.cuda.empty_cache() torch.cuda.reset_max_memory_allocated() torch.cuda.reset_peak_memory_stats() pipe = StableUnCLIPImg2ImgPipeline.from_pretrained( "fusing/stable-unclip-2-1-h-img2img", torch_dtype=torch.float16 ) pipe = pipe.to(torch_device) pipe.set_progress_bar_config(disable=None) pipe.enable_attention_slicing() pipe.enable_sequential_cpu_offload() _ = pipe( input_image, "anime turtle", num_inference_steps=2, output_type="np", ) mem_bytes = torch.cuda.max_memory_allocated() # make sure that less than 7 GB is allocated assert mem_bytes < 7 * 10**9
diffusers/tests/pipelines/stable_unclip/test_stable_unclip_img2img.py/0
{ "file_path": "diffusers/tests/pipelines/stable_unclip/test_stable_unclip_img2img.py", "repo_id": "diffusers", "token_count": 5116 }
152
# coding=utf-8 # Copyright 2024 HuggingFace Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import gc import unittest import numpy as np import torch from transformers import CLIPTextConfig, CLIPTextModelWithProjection, CLIPTokenizer from diffusers import PriorTransformer, UnCLIPPipeline, UnCLIPScheduler, UNet2DConditionModel, UNet2DModel from diffusers.pipelines.unclip.text_proj import UnCLIPTextProjModel from diffusers.utils.testing_utils import ( enable_full_determinism, load_numpy, nightly, require_torch_gpu, skip_mps, torch_device, ) from ..pipeline_params import TEXT_TO_IMAGE_BATCH_PARAMS, TEXT_TO_IMAGE_PARAMS from ..test_pipelines_common import PipelineTesterMixin, assert_mean_pixel_difference enable_full_determinism() class UnCLIPPipelineFastTests(PipelineTesterMixin, unittest.TestCase): pipeline_class = UnCLIPPipeline params = TEXT_TO_IMAGE_PARAMS - { "negative_prompt", "height", "width", "negative_prompt_embeds", "guidance_scale", "prompt_embeds", "cross_attention_kwargs", } batch_params = TEXT_TO_IMAGE_BATCH_PARAMS required_optional_params = [ "generator", "return_dict", "prior_num_inference_steps", "decoder_num_inference_steps", "super_res_num_inference_steps", ] test_xformers_attention = False @property def text_embedder_hidden_size(self): return 32 @property def time_input_dim(self): return 32 @property def block_out_channels_0(self): return self.time_input_dim @property def time_embed_dim(self): return self.time_input_dim * 4 @property def cross_attention_dim(self): return 100 @property def dummy_tokenizer(self): tokenizer = CLIPTokenizer.from_pretrained("hf-internal-testing/tiny-random-clip") return tokenizer @property def dummy_text_encoder(self): torch.manual_seed(0) config = CLIPTextConfig( bos_token_id=0, eos_token_id=2, hidden_size=self.text_embedder_hidden_size, projection_dim=self.text_embedder_hidden_size, intermediate_size=37, layer_norm_eps=1e-05, num_attention_heads=4, num_hidden_layers=5, pad_token_id=1, vocab_size=1000, ) return CLIPTextModelWithProjection(config) @property def dummy_prior(self): torch.manual_seed(0) model_kwargs = { "num_attention_heads": 2, "attention_head_dim": 12, "embedding_dim": self.text_embedder_hidden_size, "num_layers": 1, } model = PriorTransformer(**model_kwargs) return model @property def dummy_text_proj(self): torch.manual_seed(0) model_kwargs = { "clip_embeddings_dim": self.text_embedder_hidden_size, "time_embed_dim": self.time_embed_dim, "cross_attention_dim": self.cross_attention_dim, } model = UnCLIPTextProjModel(**model_kwargs) return model @property def dummy_decoder(self): torch.manual_seed(0) model_kwargs = { "sample_size": 32, # RGB in channels "in_channels": 3, # Out channels is double in channels because predicts mean and variance "out_channels": 6, "down_block_types": ("ResnetDownsampleBlock2D", "SimpleCrossAttnDownBlock2D"), "up_block_types": ("SimpleCrossAttnUpBlock2D", "ResnetUpsampleBlock2D"), "mid_block_type": "UNetMidBlock2DSimpleCrossAttn", "block_out_channels": (self.block_out_channels_0, self.block_out_channels_0 * 2), "layers_per_block": 1, "cross_attention_dim": self.cross_attention_dim, "attention_head_dim": 4, "resnet_time_scale_shift": "scale_shift", "class_embed_type": "identity", } model = UNet2DConditionModel(**model_kwargs) return model @property def dummy_super_res_kwargs(self): return { "sample_size": 64, "layers_per_block": 1, "down_block_types": ("ResnetDownsampleBlock2D", "ResnetDownsampleBlock2D"), "up_block_types": ("ResnetUpsampleBlock2D", "ResnetUpsampleBlock2D"), "block_out_channels": (self.block_out_channels_0, self.block_out_channels_0 * 2), "in_channels": 6, "out_channels": 3, } @property def dummy_super_res_first(self): torch.manual_seed(0) model = UNet2DModel(**self.dummy_super_res_kwargs) return model @property def dummy_super_res_last(self): # seeded differently to get different unet than `self.dummy_super_res_first` torch.manual_seed(1) model = UNet2DModel(**self.dummy_super_res_kwargs) return model def get_dummy_components(self): prior = self.dummy_prior decoder = self.dummy_decoder text_proj = self.dummy_text_proj text_encoder = self.dummy_text_encoder tokenizer = self.dummy_tokenizer super_res_first = self.dummy_super_res_first super_res_last = self.dummy_super_res_last prior_scheduler = UnCLIPScheduler( variance_type="fixed_small_log", prediction_type="sample", num_train_timesteps=1000, clip_sample_range=5.0, ) decoder_scheduler = UnCLIPScheduler( variance_type="learned_range", prediction_type="epsilon", num_train_timesteps=1000, ) super_res_scheduler = UnCLIPScheduler( variance_type="fixed_small_log", prediction_type="epsilon", num_train_timesteps=1000, ) components = { "prior": prior, "decoder": decoder, "text_proj": text_proj, "text_encoder": text_encoder, "tokenizer": tokenizer, "super_res_first": super_res_first, "super_res_last": super_res_last, "prior_scheduler": prior_scheduler, "decoder_scheduler": decoder_scheduler, "super_res_scheduler": super_res_scheduler, } return components def get_dummy_inputs(self, device, seed=0): if str(device).startswith("mps"): generator = torch.manual_seed(seed) else: generator = torch.Generator(device=device).manual_seed(seed) inputs = { "prompt": "horse", "generator": generator, "prior_num_inference_steps": 2, "decoder_num_inference_steps": 2, "super_res_num_inference_steps": 2, "output_type": "np", } return inputs def test_unclip(self): device = "cpu" components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe = pipe.to(device) pipe.set_progress_bar_config(disable=None) output = pipe(**self.get_dummy_inputs(device)) image = output.images image_from_tuple = pipe( **self.get_dummy_inputs(device), return_dict=False, )[0] image_slice = image[0, -3:, -3:, -1] image_from_tuple_slice = image_from_tuple[0, -3:, -3:, -1] assert image.shape == (1, 64, 64, 3) expected_slice = np.array( [ 0.9997, 0.9988, 0.0028, 0.9997, 0.9984, 0.9965, 0.0029, 0.9986, 0.0025, ] ) assert np.abs(image_slice.flatten() - expected_slice).max() < 1e-2 assert np.abs(image_from_tuple_slice.flatten() - expected_slice).max() < 1e-2 def test_unclip_passed_text_embed(self): device = torch.device("cpu") class DummyScheduler: init_noise_sigma = 1 components = self.get_dummy_components() pipe = self.pipeline_class(**components) pipe = pipe.to(device) prior = components["prior"] decoder = components["decoder"] super_res_first = components["super_res_first"] tokenizer = components["tokenizer"] text_encoder = components["text_encoder"] generator = torch.Generator(device=device).manual_seed(0) dtype = prior.dtype batch_size = 1 shape = (batch_size, prior.config.embedding_dim) prior_latents = pipe.prepare_latents( shape, dtype=dtype, device=device, generator=generator, latents=None, scheduler=DummyScheduler() ) shape = (batch_size, decoder.config.in_channels, decoder.config.sample_size, decoder.config.sample_size) decoder_latents = pipe.prepare_latents( shape, dtype=dtype, device=device, generator=generator, latents=None, scheduler=DummyScheduler() ) shape = ( batch_size, super_res_first.config.in_channels // 2, super_res_first.config.sample_size, super_res_first.config.sample_size, ) super_res_latents = pipe.prepare_latents( shape, dtype=dtype, device=device, generator=generator, latents=None, scheduler=DummyScheduler() ) pipe.set_progress_bar_config(disable=None) prompt = "this is a prompt example" generator = torch.Generator(device=device).manual_seed(0) output = pipe( [prompt], generator=generator, prior_num_inference_steps=2, decoder_num_inference_steps=2, super_res_num_inference_steps=2, prior_latents=prior_latents, decoder_latents=decoder_latents, super_res_latents=super_res_latents, output_type="np", ) image = output.images text_inputs = tokenizer( prompt, padding="max_length", max_length=tokenizer.model_max_length, return_tensors="pt", ) text_model_output = text_encoder(text_inputs.input_ids) text_attention_mask = text_inputs.attention_mask generator = torch.Generator(device=device).manual_seed(0) image_from_text = pipe( generator=generator, prior_num_inference_steps=2, decoder_num_inference_steps=2, super_res_num_inference_steps=2, prior_latents=prior_latents, decoder_latents=decoder_latents, super_res_latents=super_res_latents, text_model_output=text_model_output, text_attention_mask=text_attention_mask, output_type="np", )[0] # make sure passing text embeddings manually is identical assert np.abs(image - image_from_text).max() < 1e-4 # Overriding PipelineTesterMixin::test_attention_slicing_forward_pass # because UnCLIP GPU undeterminism requires a looser check. @skip_mps def test_attention_slicing_forward_pass(self): test_max_difference = torch_device == "cpu" self._test_attention_slicing_forward_pass(test_max_difference=test_max_difference, expected_max_diff=0.01) # Overriding PipelineTesterMixin::test_inference_batch_single_identical # because UnCLIP undeterminism requires a looser check. @skip_mps def test_inference_batch_single_identical(self): additional_params_copy_to_batched_inputs = [ "prior_num_inference_steps", "decoder_num_inference_steps", "super_res_num_inference_steps", ] self._test_inference_batch_single_identical( additional_params_copy_to_batched_inputs=additional_params_copy_to_batched_inputs, expected_max_diff=5e-3 ) def test_inference_batch_consistent(self): additional_params_copy_to_batched_inputs = [ "prior_num_inference_steps", "decoder_num_inference_steps", "super_res_num_inference_steps", ] if torch_device == "mps": # TODO: MPS errors with larger batch sizes batch_sizes = [2, 3] self._test_inference_batch_consistent( batch_sizes=batch_sizes, additional_params_copy_to_batched_inputs=additional_params_copy_to_batched_inputs, ) else: self._test_inference_batch_consistent( additional_params_copy_to_batched_inputs=additional_params_copy_to_batched_inputs ) @skip_mps def test_dict_tuple_outputs_equivalent(self): return super().test_dict_tuple_outputs_equivalent() @skip_mps def test_save_load_local(self): return super().test_save_load_local(expected_max_difference=5e-3) @skip_mps def test_save_load_optional_components(self): return super().test_save_load_optional_components() @unittest.skip("UnCLIP produces very large differences in fp16 vs fp32. Test is not useful.") def test_float16_inference(self): super().test_float16_inference(expected_max_diff=1.0) @nightly class UnCLIPPipelineCPUIntegrationTests(unittest.TestCase): def setUp(self): # clean up the VRAM before each test super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): # clean up the VRAM after each test super().tearDown() gc.collect() torch.cuda.empty_cache() def test_unclip_karlo_cpu_fp32(self): expected_image = load_numpy( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main" "/unclip/karlo_v1_alpha_horse_cpu.npy" ) pipeline = UnCLIPPipeline.from_pretrained("kakaobrain/karlo-v1-alpha") pipeline.set_progress_bar_config(disable=None) generator = torch.manual_seed(0) output = pipeline( "horse", num_images_per_prompt=1, generator=generator, output_type="np", ) image = output.images[0] assert image.shape == (256, 256, 3) assert np.abs(expected_image - image).max() < 1e-1 @nightly @require_torch_gpu class UnCLIPPipelineIntegrationTests(unittest.TestCase): def setUp(self): # clean up the VRAM before each test super().setUp() gc.collect() torch.cuda.empty_cache() def tearDown(self): # clean up the VRAM after each test super().tearDown() gc.collect() torch.cuda.empty_cache() def test_unclip_karlo(self): expected_image = load_numpy( "https://huggingface.co/datasets/hf-internal-testing/diffusers-images/resolve/main" "/unclip/karlo_v1_alpha_horse_fp16.npy" ) pipeline = UnCLIPPipeline.from_pretrained("kakaobrain/karlo-v1-alpha", torch_dtype=torch.float16) pipeline = pipeline.to(torch_device) pipeline.set_progress_bar_config(disable=None) generator = torch.Generator(device="cpu").manual_seed(0) output = pipeline( "horse", generator=generator, output_type="np", ) image = output.images[0] assert image.shape == (256, 256, 3) assert_mean_pixel_difference(image, expected_image) def test_unclip_pipeline_with_sequential_cpu_offloading(self): torch.cuda.empty_cache() torch.cuda.reset_max_memory_allocated() torch.cuda.reset_peak_memory_stats() pipe = UnCLIPPipeline.from_pretrained("kakaobrain/karlo-v1-alpha", torch_dtype=torch.float16) pipe = pipe.to(torch_device) pipe.set_progress_bar_config(disable=None) pipe.enable_attention_slicing() pipe.enable_sequential_cpu_offload() _ = pipe( "horse", num_images_per_prompt=1, prior_num_inference_steps=2, decoder_num_inference_steps=2, super_res_num_inference_steps=2, output_type="np", ) mem_bytes = torch.cuda.max_memory_allocated() # make sure that less than 7 GB is allocated assert mem_bytes < 7 * 10**9
diffusers/tests/pipelines/unclip/test_unclip.py/0
{ "file_path": "diffusers/tests/pipelines/unclip/test_unclip.py", "repo_id": "diffusers", "token_count": 8002 }
153
import tempfile import torch from diffusers import ( DEISMultistepScheduler, DPMSolverMultistepScheduler, DPMSolverSinglestepScheduler, UniPCMultistepScheduler, ) from .test_schedulers import SchedulerCommonTest class DPMSolverMultistepSchedulerTest(SchedulerCommonTest): scheduler_classes = (DPMSolverMultistepScheduler,) forward_default_kwargs = (("num_inference_steps", 25),) def get_scheduler_config(self, **kwargs): config = { "num_train_timesteps": 1000, "beta_start": 0.0001, "beta_end": 0.02, "beta_schedule": "linear", "solver_order": 2, "prediction_type": "epsilon", "thresholding": False, "sample_max_value": 1.0, "algorithm_type": "dpmsolver++", "solver_type": "midpoint", "lower_order_final": False, "euler_at_final": False, "lambda_min_clipped": -float("inf"), "variance_type": None, "final_sigmas_type": "sigma_min", } config.update(**kwargs) return config def check_over_configs(self, time_step=0, **config): kwargs = dict(self.forward_default_kwargs) num_inference_steps = kwargs.pop("num_inference_steps", None) sample = self.dummy_sample residual = 0.1 * sample dummy_past_residuals = [residual + 0.2, residual + 0.15, residual + 0.10] for scheduler_class in self.scheduler_classes: scheduler_config = self.get_scheduler_config(**config) scheduler = scheduler_class(**scheduler_config) scheduler.set_timesteps(num_inference_steps) # copy over dummy past residuals scheduler.model_outputs = dummy_past_residuals[: scheduler.config.solver_order] with tempfile.TemporaryDirectory() as tmpdirname: scheduler.save_config(tmpdirname) new_scheduler = scheduler_class.from_pretrained(tmpdirname) new_scheduler.set_timesteps(num_inference_steps) # copy over dummy past residuals new_scheduler.model_outputs = dummy_past_residuals[: new_scheduler.config.solver_order] output, new_output = sample, sample for t in range(time_step, time_step + scheduler.config.solver_order + 1): t = new_scheduler.timesteps[t] output = scheduler.step(residual, t, output, **kwargs).prev_sample new_output = new_scheduler.step(residual, t, new_output, **kwargs).prev_sample assert torch.sum(torch.abs(output - new_output)) < 1e-5, "Scheduler outputs are not identical" def test_from_save_pretrained(self): pass def check_over_forward(self, time_step=0, **forward_kwargs): kwargs = dict(self.forward_default_kwargs) num_inference_steps = kwargs.pop("num_inference_steps", None) sample = self.dummy_sample residual = 0.1 * sample dummy_past_residuals = [residual + 0.2, residual + 0.15, residual + 0.10] for scheduler_class in self.scheduler_classes: scheduler_config = self.get_scheduler_config() scheduler = scheduler_class(**scheduler_config) scheduler.set_timesteps(num_inference_steps) # copy over dummy past residuals (must be after setting timesteps) scheduler.model_outputs = dummy_past_residuals[: scheduler.config.solver_order] with tempfile.TemporaryDirectory() as tmpdirname: scheduler.save_config(tmpdirname) new_scheduler = scheduler_class.from_pretrained(tmpdirname) # copy over dummy past residuals new_scheduler.set_timesteps(num_inference_steps) # copy over dummy past residual (must be after setting timesteps) new_scheduler.model_outputs = dummy_past_residuals[: new_scheduler.config.solver_order] time_step = new_scheduler.timesteps[time_step] output = scheduler.step(residual, time_step, sample, **kwargs).prev_sample new_output = new_scheduler.step(residual, time_step, sample, **kwargs).prev_sample assert torch.sum(torch.abs(output - new_output)) < 1e-5, "Scheduler outputs are not identical" def full_loop(self, scheduler=None, **config): if scheduler is None: scheduler_class = self.scheduler_classes[0] scheduler_config = self.get_scheduler_config(**config) scheduler = scheduler_class(**scheduler_config) num_inference_steps = 10 model = self.dummy_model() sample = self.dummy_sample_deter scheduler.set_timesteps(num_inference_steps) for i, t in enumerate(scheduler.timesteps): residual = model(sample, t) sample = scheduler.step(residual, t, sample).prev_sample return sample def test_step_shape(self): kwargs = dict(self.forward_default_kwargs) num_inference_steps = kwargs.pop("num_inference_steps", None) for scheduler_class in self.scheduler_classes: scheduler_config = self.get_scheduler_config() scheduler = scheduler_class(**scheduler_config) sample = self.dummy_sample residual = 0.1 * sample if num_inference_steps is not None and hasattr(scheduler, "set_timesteps"): scheduler.set_timesteps(num_inference_steps) elif num_inference_steps is not None and not hasattr(scheduler, "set_timesteps"): kwargs["num_inference_steps"] = num_inference_steps # copy over dummy past residuals (must be done after set_timesteps) dummy_past_residuals = [residual + 0.2, residual + 0.15, residual + 0.10] scheduler.model_outputs = dummy_past_residuals[: scheduler.config.solver_order] time_step_0 = scheduler.timesteps[5] time_step_1 = scheduler.timesteps[6] output_0 = scheduler.step(residual, time_step_0, sample, **kwargs).prev_sample output_1 = scheduler.step(residual, time_step_1, sample, **kwargs).prev_sample self.assertEqual(output_0.shape, sample.shape) self.assertEqual(output_0.shape, output_1.shape) def test_timesteps(self): for timesteps in [25, 50, 100, 999, 1000]: self.check_over_configs(num_train_timesteps=timesteps) def test_thresholding(self): self.check_over_configs(thresholding=False) for order in [1, 2, 3]: for solver_type in ["midpoint", "heun"]: for threshold in [0.5, 1.0, 2.0]: for prediction_type in ["epsilon", "sample"]: self.check_over_configs( thresholding=True, prediction_type=prediction_type, sample_max_value=threshold, algorithm_type="dpmsolver++", solver_order=order, solver_type=solver_type, ) def test_prediction_type(self): for prediction_type in ["epsilon", "v_prediction"]: self.check_over_configs(prediction_type=prediction_type) def test_solver_order_and_type(self): for algorithm_type in ["dpmsolver", "dpmsolver++", "sde-dpmsolver", "sde-dpmsolver++"]: for solver_type in ["midpoint", "heun"]: for order in [1, 2, 3]: for prediction_type in ["epsilon", "sample"]: if algorithm_type in ["sde-dpmsolver", "sde-dpmsolver++"]: if order == 3: continue else: self.check_over_configs( solver_order=order, solver_type=solver_type, prediction_type=prediction_type, algorithm_type=algorithm_type, ) sample = self.full_loop( solver_order=order, solver_type=solver_type, prediction_type=prediction_type, algorithm_type=algorithm_type, ) assert not torch.isnan(sample).any(), "Samples have nan numbers" def test_lower_order_final(self): self.check_over_configs(lower_order_final=True) self.check_over_configs(lower_order_final=False) def test_euler_at_final(self): self.check_over_configs(euler_at_final=True) self.check_over_configs(euler_at_final=False) def test_lambda_min_clipped(self): self.check_over_configs(lambda_min_clipped=-float("inf")) self.check_over_configs(lambda_min_clipped=-5.1) def test_variance_type(self): self.check_over_configs(variance_type=None) self.check_over_configs(variance_type="learned_range") def test_inference_steps(self): for num_inference_steps in [1, 2, 3, 5, 10, 50, 100, 999, 1000]: self.check_over_forward(num_inference_steps=num_inference_steps, time_step=0) def test_rescale_betas_zero_snr(self): for rescale_betas_zero_snr in [True, False]: self.check_over_configs(rescale_betas_zero_snr=rescale_betas_zero_snr) def test_full_loop_no_noise(self): sample = self.full_loop() result_mean = torch.mean(torch.abs(sample)) assert abs(result_mean.item() - 0.3301) < 1e-3 def test_full_loop_with_noise(self): scheduler_class = self.scheduler_classes[0] scheduler_config = self.get_scheduler_config() scheduler = scheduler_class(**scheduler_config) num_inference_steps = 10 t_start = 5 model = self.dummy_model() sample = self.dummy_sample_deter scheduler.set_timesteps(num_inference_steps) # add noise noise = self.dummy_noise_deter timesteps = scheduler.timesteps[t_start * scheduler.order :] sample = scheduler.add_noise(sample, noise, timesteps[:1]) for i, t in enumerate(timesteps): residual = model(sample, t) sample = scheduler.step(residual, t, sample).prev_sample result_sum = torch.sum(torch.abs(sample)) result_mean = torch.mean(torch.abs(sample)) assert abs(result_sum.item() - 318.4111) < 1e-2, f" expected result sum 318.4111, but get {result_sum}" assert abs(result_mean.item() - 0.4146) < 1e-3, f" expected result mean 0.4146, but get {result_mean}" def test_full_loop_no_noise_thres(self): sample = self.full_loop(thresholding=True, dynamic_thresholding_ratio=0.87, sample_max_value=0.5) result_mean = torch.mean(torch.abs(sample)) assert abs(result_mean.item() - 1.1364) < 1e-3 def test_full_loop_with_v_prediction(self): sample = self.full_loop(prediction_type="v_prediction") result_mean = torch.mean(torch.abs(sample)) assert abs(result_mean.item() - 0.2251) < 1e-3 def test_full_loop_with_karras_and_v_prediction(self): sample = self.full_loop(prediction_type="v_prediction", use_karras_sigmas=True) result_mean = torch.mean(torch.abs(sample)) assert abs(result_mean.item() - 0.2096) < 1e-3 def test_full_loop_with_lu_and_v_prediction(self): sample = self.full_loop(prediction_type="v_prediction", use_lu_lambdas=True) result_mean = torch.mean(torch.abs(sample)) assert abs(result_mean.item() - 0.1554) < 1e-3 def test_switch(self): # make sure that iterating over schedulers with same config names gives same results # for defaults scheduler = DPMSolverMultistepScheduler(**self.get_scheduler_config()) sample = self.full_loop(scheduler=scheduler) result_mean = torch.mean(torch.abs(sample)) assert abs(result_mean.item() - 0.3301) < 1e-3 scheduler = DPMSolverSinglestepScheduler.from_config(scheduler.config) scheduler = UniPCMultistepScheduler.from_config(scheduler.config) scheduler = DEISMultistepScheduler.from_config(scheduler.config) scheduler = DPMSolverMultistepScheduler.from_config(scheduler.config) sample = self.full_loop(scheduler=scheduler) result_mean = torch.mean(torch.abs(sample)) assert abs(result_mean.item() - 0.3301) < 1e-3 def test_fp16_support(self): scheduler_class = self.scheduler_classes[0] scheduler_config = self.get_scheduler_config(thresholding=True, dynamic_thresholding_ratio=0) scheduler = scheduler_class(**scheduler_config) num_inference_steps = 10 model = self.dummy_model() sample = self.dummy_sample_deter.half() scheduler.set_timesteps(num_inference_steps) for i, t in enumerate(scheduler.timesteps): residual = model(sample, t) sample = scheduler.step(residual, t, sample).prev_sample assert sample.dtype == torch.float16 def test_duplicated_timesteps(self, **config): for scheduler_class in self.scheduler_classes: scheduler_config = self.get_scheduler_config(**config) scheduler = scheduler_class(**scheduler_config) scheduler.set_timesteps(scheduler.config.num_train_timesteps) assert len(scheduler.timesteps) == scheduler.num_inference_steps
diffusers/tests/schedulers/test_scheduler_dpm_multi.py/0
{ "file_path": "diffusers/tests/schedulers/test_scheduler_dpm_multi.py", "repo_id": "diffusers", "token_count": 6455 }
154
import torch from diffusers import SASolverScheduler from diffusers.utils.testing_utils import require_torchsde, torch_device from .test_schedulers import SchedulerCommonTest @require_torchsde class SASolverSchedulerTest(SchedulerCommonTest): scheduler_classes = (SASolverScheduler,) forward_default_kwargs = (("num_inference_steps", 10),) num_inference_steps = 10 def get_scheduler_config(self, **kwargs): config = { "num_train_timesteps": 1100, "beta_start": 0.0001, "beta_end": 0.02, "beta_schedule": "linear", } config.update(**kwargs) return config def test_step_shape(self): kwargs = dict(self.forward_default_kwargs) num_inference_steps = kwargs.pop("num_inference_steps", None) for scheduler_class in self.scheduler_classes: scheduler_config = self.get_scheduler_config() scheduler = scheduler_class(**scheduler_config) sample = self.dummy_sample residual = 0.1 * sample if num_inference_steps is not None and hasattr(scheduler, "set_timesteps"): scheduler.set_timesteps(num_inference_steps) elif num_inference_steps is not None and not hasattr(scheduler, "set_timesteps"): kwargs["num_inference_steps"] = num_inference_steps # copy over dummy past residuals (must be done after set_timesteps) dummy_past_residuals = [residual + 0.2, residual + 0.15, residual + 0.10] scheduler.model_outputs = dummy_past_residuals[ : max( scheduler.config.predictor_order, scheduler.config.corrector_order - 1, ) ] time_step_0 = scheduler.timesteps[5] time_step_1 = scheduler.timesteps[6] output_0 = scheduler.step(residual, time_step_0, sample, **kwargs).prev_sample output_1 = scheduler.step(residual, time_step_1, sample, **kwargs).prev_sample self.assertEqual(output_0.shape, sample.shape) self.assertEqual(output_0.shape, output_1.shape) def test_timesteps(self): for timesteps in [10, 50, 100, 1000]: self.check_over_configs(num_train_timesteps=timesteps) def test_betas(self): for beta_start, beta_end in zip([0.00001, 0.0001, 0.001], [0.0002, 0.002, 0.02]): self.check_over_configs(beta_start=beta_start, beta_end=beta_end) def test_schedules(self): for schedule in ["linear", "scaled_linear"]: self.check_over_configs(beta_schedule=schedule) def test_prediction_type(self): for prediction_type in ["epsilon", "v_prediction"]: self.check_over_configs(prediction_type=prediction_type) def test_full_loop_no_noise(self): scheduler_class = self.scheduler_classes[0] scheduler_config = self.get_scheduler_config() scheduler = scheduler_class(**scheduler_config) scheduler.set_timesteps(self.num_inference_steps) model = self.dummy_model() sample = self.dummy_sample_deter * scheduler.init_noise_sigma sample = sample.to(torch_device) generator = torch.manual_seed(0) for i, t in enumerate(scheduler.timesteps): sample = scheduler.scale_model_input(sample, t, generator=generator) model_output = model(sample, t) output = scheduler.step(model_output, t, sample) sample = output.prev_sample result_sum = torch.sum(torch.abs(sample)) result_mean = torch.mean(torch.abs(sample)) if torch_device in ["cpu"]: assert abs(result_sum.item() - 337.394287109375) < 1e-2 assert abs(result_mean.item() - 0.43931546807289124) < 1e-3 elif torch_device in ["cuda"]: assert abs(result_sum.item() - 329.1999816894531) < 1e-2 assert abs(result_mean.item() - 0.4286458194255829) < 1e-3 else: print("None") def test_full_loop_with_v_prediction(self): scheduler_class = self.scheduler_classes[0] scheduler_config = self.get_scheduler_config(prediction_type="v_prediction") scheduler = scheduler_class(**scheduler_config) scheduler.set_timesteps(self.num_inference_steps) model = self.dummy_model() sample = self.dummy_sample_deter * scheduler.init_noise_sigma sample = sample.to(torch_device) generator = torch.manual_seed(0) for i, t in enumerate(scheduler.timesteps): sample = scheduler.scale_model_input(sample, t, generator=generator) model_output = model(sample, t) output = scheduler.step(model_output, t, sample) sample = output.prev_sample result_sum = torch.sum(torch.abs(sample)) result_mean = torch.mean(torch.abs(sample)) if torch_device in ["cpu"]: assert abs(result_sum.item() - 193.1467742919922) < 1e-2 assert abs(result_mean.item() - 0.2514931857585907) < 1e-3 elif torch_device in ["cuda"]: assert abs(result_sum.item() - 193.4154052734375) < 1e-2 assert abs(result_mean.item() - 0.2518429756164551) < 1e-3 else: print("None") def test_full_loop_device(self): scheduler_class = self.scheduler_classes[0] scheduler_config = self.get_scheduler_config() scheduler = scheduler_class(**scheduler_config) scheduler.set_timesteps(self.num_inference_steps, device=torch_device) model = self.dummy_model() sample = self.dummy_sample_deter.to(torch_device) * scheduler.init_noise_sigma generator = torch.manual_seed(0) for t in scheduler.timesteps: sample = scheduler.scale_model_input(sample, t) model_output = model(sample, t) output = scheduler.step(model_output, t, sample, generator=generator) sample = output.prev_sample result_sum = torch.sum(torch.abs(sample)) result_mean = torch.mean(torch.abs(sample)) if torch_device in ["cpu"]: assert abs(result_sum.item() - 337.394287109375) < 1e-2 assert abs(result_mean.item() - 0.43931546807289124) < 1e-3 elif torch_device in ["cuda"]: assert abs(result_sum.item() - 337.394287109375) < 1e-2 assert abs(result_mean.item() - 0.4393154978752136) < 1e-3 else: print("None") def test_full_loop_device_karras_sigmas(self): scheduler_class = self.scheduler_classes[0] scheduler_config = self.get_scheduler_config() scheduler = scheduler_class(**scheduler_config, use_karras_sigmas=True) scheduler.set_timesteps(self.num_inference_steps, device=torch_device) model = self.dummy_model() sample = self.dummy_sample_deter.to(torch_device) * scheduler.init_noise_sigma sample = sample.to(torch_device) generator = torch.manual_seed(0) for t in scheduler.timesteps: sample = scheduler.scale_model_input(sample, t) model_output = model(sample, t) output = scheduler.step(model_output, t, sample, generator=generator) sample = output.prev_sample result_sum = torch.sum(torch.abs(sample)) result_mean = torch.mean(torch.abs(sample)) if torch_device in ["cpu"]: assert abs(result_sum.item() - 837.2554931640625) < 1e-2 assert abs(result_mean.item() - 1.0901764631271362) < 1e-2 elif torch_device in ["cuda"]: assert abs(result_sum.item() - 837.25537109375) < 1e-2 assert abs(result_mean.item() - 1.0901763439178467) < 1e-2 else: print("None")
diffusers/tests/schedulers/test_scheduler_sasolver.py/0
{ "file_path": "diffusers/tests/schedulers/test_scheduler_sasolver.py", "repo_id": "diffusers", "token_count": 3629 }
155
import json import logging import os from collections import defaultdict from pathlib import Path from huggingface_hub import HfApi, ModelFilter import diffusers PATH_TO_REPO = Path(__file__).parent.parent.resolve() ALWAYS_TEST_PIPELINE_MODULES = [ "controlnet", "stable_diffusion", "stable_diffusion_2", "stable_diffusion_xl", "stable_diffusion_adapter", "deepfloyd_if", "ip_adapters", "kandinsky", "kandinsky2_2", "text_to_video_synthesis", "wuerstchen", ] PIPELINE_USAGE_CUTOFF = int(os.getenv("PIPELINE_USAGE_CUTOFF", 50000)) logger = logging.getLogger(__name__) api = HfApi() filter = ModelFilter(library="diffusers") def filter_pipelines(usage_dict, usage_cutoff=10000): output = [] for diffusers_object, usage in usage_dict.items(): if usage < usage_cutoff: continue is_diffusers_pipeline = hasattr(diffusers.pipelines, diffusers_object) if not is_diffusers_pipeline: continue output.append(diffusers_object) return output def fetch_pipeline_objects(): models = api.list_models(filter=filter) downloads = defaultdict(int) for model in models: is_counted = False for tag in model.tags: if tag.startswith("diffusers:"): is_counted = True downloads[tag[len("diffusers:") :]] += model.downloads if not is_counted: downloads["other"] += model.downloads # Remove 0 downloads downloads = {k: v for k, v in downloads.items() if v > 0} pipeline_objects = filter_pipelines(downloads, PIPELINE_USAGE_CUTOFF) return pipeline_objects def fetch_pipeline_modules_to_test(): try: pipeline_objects = fetch_pipeline_objects() except Exception as e: logger.error(e) raise RuntimeError("Unable to fetch model list from HuggingFace Hub.") test_modules = [] for pipeline_name in pipeline_objects: module = getattr(diffusers, pipeline_name) test_module = module.__module__.split(".")[-2].strip() test_modules.append(test_module) return test_modules def main(): test_modules = fetch_pipeline_modules_to_test() test_modules.extend(ALWAYS_TEST_PIPELINE_MODULES) # Get unique modules test_modules = list(set(test_modules)) print(json.dumps(test_modules)) save_path = f"{PATH_TO_REPO}/reports" os.makedirs(save_path, exist_ok=True) with open(f"{save_path}/test-pipelines.json", "w") as f: json.dump({"pipeline_test_modules": test_modules}, f) if __name__ == "__main__": main()
diffusers/utils/fetch_torch_cuda_pipeline_test_matrix.py/0
{ "file_path": "diffusers/utils/fetch_torch_cuda_pipeline_test_matrix.py", "repo_id": "diffusers", "token_count": 1082 }
156
<jupyter_start><jupyter_text>Traduction (PyTorch) Installez les bibliothèques 🤗 *Datasets* et 🤗 *Transformers* pour exécuter ce *notebook*.<jupyter_code>!pip install datasets transformers[sentencepiece] !pip install accelerate # Pour exécuter l'entraînement sur TPU, vous devez décommenter la ligne suivante : # !pip install cloud-tpu-client==0.10 torch==1.9.0 https://storage.googleapis.com/tpu-pytorch/wheels/torch_xla-1.9-cp37-cp37m-linux_x86_64.whl !apt install git-lfs<jupyter_output><empty_output><jupyter_text>Vous aurez besoin de configurer git, adaptez votre email et votre nom dans la cellule suivante.<jupyter_code>!git config --global user.email "you@example.com" !git config --global user.name "Your Name"<jupyter_output><empty_output><jupyter_text>Vous devrez également être connecté au Hub d'Hugging Face. Exécutez ce qui suit et entrez vos informations d'identification.<jupyter_code>from huggingface_hub import notebook_login notebook_login() from datasets import load_dataset, load_metric raw_datasets = load_dataset("kde4", lang1="en", lang2="fr") raw_datasets split_datasets = raw_datasets["train"].train_test_split(train_size=0.9, seed=20) split_datasets split_datasets["validation"] = split_datasets.pop("test") split_datasets["train"][1]["translation"] from transformers import pipeline model_checkpoint = "Helsinki-NLP/opus-mt-en-fr" translator = pipeline("translation", model=model_checkpoint) translator("Default to expanded threads") split_datasets["train"][172]["translation"] translator( "Unable to import %1 using the OFX importer plugin. This file is not the correct format." ) from transformers import AutoTokenizer model_checkpoint = "Helsinki-NLP/opus-mt-en-fr" tokenizer = AutoTokenizer.from_pretrained(model_checkpoint, return_tensors="tf") en_sentence = split_datasets["train"][1]["translation"]["en"] fr_sentence = split_datasets["train"][1]["translation"]["fr"] inputs = tokenizer(en_sentence) with tokenizer.as_target_tokenizer(): targets = tokenizer(fr_sentence) wrong_targets = tokenizer(fr_sentence) print(tokenizer.convert_ids_to_tokens(wrong_targets["input_ids"])) print(tokenizer.convert_ids_to_tokens(targets["input_ids"])) max_input_length = 128 max_target_length = 128 def preprocess_function(examples): inputs = [ex["en"] for ex in examples["translation"]] targets = [ex["fr"] for ex in examples["translation"]] model_inputs = tokenizer(inputs, max_length=max_input_length, truncation=True) # Configurer le tokenizer pour les cibles with tokenizer.as_target_tokenizer(): labels = tokenizer(targets, max_length=max_target_length, truncation=True) model_inputs["labels"] = labels["input_ids"] return model_inputs tokenized_datasets = split_datasets.map( preprocess_function, batched=True, remove_columns=split_datasets["train"].column_names, ) from transformers import AutoModelForSeq2SeqLM model = AutoModelForSeq2SeqLM.from_pretrained(model_checkpoint) from transformers import DataCollatorForSeq2Seq data_collator = DataCollatorForSeq2Seq(tokenizer, model=model) batch = data_collator([tokenized_datasets["train"][i] for i in range(1, 3)]) batch.keys() batch["labels"] batch["decoder_input_ids"] for i in range(1, 3): print(tokenized_datasets["train"][i]["labels"]) !pip install sacrebleu from datasets import load_metric metric = load_metric("sacrebleu") predictions = [ "This plugin lets you translate web pages between several languages automatically." ] references = [ [ "This plugin allows you to automatically translate web pages between several languages." ] ] metric.compute(predictions=predictions, references=references) predictions = ["This This This This"] references = [ [ "This plugin allows you to automatically translate web pages between several languages." ] ] metric.compute(predictions=predictions, references=references) predictions = ["This plugin"] references = [ [ "This plugin allows you to automatically translate web pages between several languages." ] ] metric.compute(predictions=predictions, references=references) import numpy as np def compute_metrics(eval_preds): preds, labels = eval_preds # Dans le cas où le modèle retourne plus que les logits de prédiction if isinstance(preds, tuple): preds = preds[0] decoded_preds = tokenizer.batch_decode(preds, skip_special_tokens=True) # Remplacer les -100 dans les étiquettes car nous ne pouvons pas les décoder labels = np.where(labels != -100, labels, tokenizer.pad_token_id) decoded_labels = tokenizer.batch_decode(labels, skip_special_tokens=True) # Quelques post-traitements simples decoded_preds = [pred.strip() for pred in decoded_preds] decoded_labels = [[label.strip()] for label in decoded_labels] result = metric.compute(predictions=decoded_preds, references=decoded_labels) return {"bleu": result["score"]} from huggingface_hub import notebook_login notebook_login() from transformers import Seq2SeqTrainingArguments args = Seq2SeqTrainingArguments( f"marian-finetuned-kde4-en-to-fr", evaluation_strategy="no", save_strategy="epoch", learning_rate=2e-5, per_device_train_batch_size=32, per_device_eval_batch_size=64, weight_decay=0.01, save_total_limit=3, num_train_epochs=3, predict_with_generate=True, fp16=True, push_to_hub=True, ) from transformers import Seq2SeqTrainer trainer = Seq2SeqTrainer( model, args, train_dataset=tokenized_datasets["train"], eval_dataset=tokenized_datasets["validation"], data_collator=data_collator, tokenizer=tokenizer, compute_metrics=compute_metrics, ) trainer.evaluate(max_length=max_target_length) trainer.train() trainer.evaluate(max_length=max_target_length) trainer.push_to_hub(tags="translation", commit_message="Training complete") from torch.utils.data import DataLoader tokenized_datasets.set_format("torch") train_dataloader = DataLoader( tokenized_datasets["train"], shuffle=True, collate_fn=data_collator, batch_size=8, ) eval_dataloader = DataLoader( tokenized_datasets["validation"], collate_fn=data_collator, batch_size=8 ) model = AutoModelForSeq2SeqLM.from_pretrained(model_checkpoint) from transformers import AdamW optimizer = AdamW(model.parameters(), lr=2e-5) from accelerate import Accelerator accelerator = Accelerator() model, optimizer, train_dataloader, eval_dataloader = accelerator.prepare( model, optimizer, train_dataloader, eval_dataloader ) from transformers import get_scheduler num_train_epochs = 3 num_update_steps_per_epoch = len(train_dataloader) num_training_steps = num_train_epochs * num_update_steps_per_epoch lr_scheduler = get_scheduler( "linear", optimizer=optimizer, num_warmup_steps=0, num_training_steps=num_training_steps, ) from huggingface_hub import Repository, get_full_repo_name model_name = "marian-finetuned-kde4-en-to-fr-accelerate" repo_name = get_full_repo_name(model_name) repo_name output_dir = "marian-finetuned-kde4-en-to-fr-accelerate" repo = Repository(output_dir, clone_from=repo_name) def postprocess(predictions, labels): predictions = predictions.cpu().numpy() labels = labels.cpu().numpy() decoded_preds = tokenizer.batch_decode(predictions, skip_special_tokens=True) # Remplacez -100 dans les étiquettes car nous ne pouvons pas les décoder labels = np.where(labels != -100, labels, tokenizer.pad_token_id) decoded_labels = tokenizer.batch_decode(labels, skip_special_tokens=True) # Quelques post-traitements simples decoded_preds = [pred.strip() for pred in decoded_preds] decoded_labels = [[label.strip()] for label in decoded_labels] return decoded_preds, decoded_labels from tqdm.auto import tqdm import torch progress_bar = tqdm(range(num_training_steps)) for epoch in range(num_train_epochs): # Entraînement model.train() for batch in train_dataloader: outputs = model(**batch) loss = outputs.loss accelerator.backward(loss) optimizer.step() lr_scheduler.step() optimizer.zero_grad() progress_bar.update(1) # Evaluation model.eval() for batch in tqdm(eval_dataloader): with torch.no_grad(): generated_tokens = accelerator.unwrap_model(model).generate( batch["input_ids"], attention_mask=batch["attention_mask"], max_length=128, ) labels = batch["labels"] # Nécessaire pour rembourrer les prédictions et les étiquettes à rassembler generated_tokens = accelerator.pad_across_processes( generated_tokens, dim=1, pad_index=tokenizer.pad_token_id ) labels = accelerator.pad_across_processes(labels, dim=1, pad_index=-100) predictions_gathered = accelerator.gather(generated_tokens) labels_gathered = accelerator.gather(labels) decoded_preds, decoded_labels = postprocess(predictions_gathered, labels_gathered) metric.add_batch(predictions=decoded_preds, references=decoded_labels) results = metric.compute() print(f"epoch {epoch}, BLEU score: {results['score']:.2f}") # Sauvegarder et télécharger accelerator.wait_for_everyone() unwrapped_model = accelerator.unwrap_model(model) unwrapped_model.save_pretrained(output_dir, save_function=accelerator.save) if accelerator.is_main_process: tokenizer.save_pretrained(output_dir) repo.push_to_hub( commit_message=f"Training in progress epoch {epoch}", blocking=False ) from transformers import pipeline # Remplacer par votre propre checkpoint model_checkpoint = "huggingface-course/marian-finetuned-kde4-en-to-fr" translator = pipeline("translation", model=model_checkpoint) translator("Default to expanded threads") translator( "Unable to import %1 using the OFX importer plugin. This file is not the correct format." )<jupyter_output><empty_output>
notebooks/course/fr/chapter7/section4_pt.ipynb/0
{ "file_path": "notebooks/course/fr/chapter7/section4_pt.ipynb", "repo_id": "notebooks", "token_count": 3791 }
157
<jupyter_start><jupyter_text>Partager ses démos avec d'autres Installez les bibliothèques 🤗 Transformers et 🤗 Gradio pour exécuter ce *notebook*.<jupyter_code>!pip install datasets transformers[sentencepiece] !pip install gradio import gradio as gr title = "Poser une question (en anglais) à Rick" description = """ Le bot a été entraîné à répondre à des questions basées sur les dialogues de Rick et Morty (en anglais). Demandez à Rick ce que vous voulez ! <img src="https://huggingface.co/spaces/course-demos/Rick_and_Morty_QA/resolve/main/rick.png" width=200px> """ article = "Consultez [le bot original Rick et Morty](https://huggingface.co/spaces/kingabzpro/Rick_and_Morty_Bot) sur lequel cette démo est basée." from transformers import AutoModelForCausalLM, AutoTokenizer import torch tokenizer = AutoTokenizer.from_pretrained("ericzhou/DialoGPT-Medium-Rick_v2") model = AutoModelForCausalLM.from_pretrained("ericzhou/DialoGPT-Medium-Rick_v2") def predict(input, history=[]): # tokenizer la nouvelle phrase d'entrée new_user_input_ids = tokenizer.encode(input + tokenizer.eos_token, return_tensors='pt') # ajouter les nouveaux tokens d'entrée de l'utilisateur à l'historique de chat bot_input_ids = torch.cat([torch.LongTensor(history), new_user_input_ids], dim=-1) # générer une réponse history = model.generate(bot_input_ids, max_length=1000, pad_token_id=tokenizer.eos_token_id).tolist() # convertit les tokens en texte, puis divise les réponses dans le bon format. response = tokenizer.decode(history[0]).split("<|endoftext|>") response = [(response[i], response[i+1]) for i in range(0, len(response)-1, 2)] # convertir en tuples de liste return response, history gr.Interface( fn=predict, inputs="textbox", outputs="text", title=title, description=description, article=article, examples=[["What are you doing?"], ["Where should we time travel to?"]], ).launch() # Vous devez récupérer le fichier pytorch_model.bin ici https://huggingface.co/spaces/course-demos/Sketch-Recognition/blob/main/pytorch_model.bin import torch import gradio as gr from torch import nn import requests from google.colab import drive drive.mount('/content/MyDrive/pytorch_model.bin') LABELS = requests.get("https://huggingface.co/spaces/course-demos/Sketch-Recognition/raw/main/class_names.txt").text.replace("\n","").split("\r") model = nn.Sequential( nn.Conv2d(1, 32, 3, padding="same"), nn.ReLU(), nn.MaxPool2d(2), nn.Conv2d(32, 64, 3, padding="same"), nn.ReLU(), nn.MaxPool2d(2), nn.Conv2d(64, 128, 3, padding="same"), nn.ReLU(), nn.MaxPool2d(2), nn.Flatten(), nn.Linear(1152, 256), nn.ReLU(), nn.Linear(256, len(LABELS)), ) state_dict = torch.load("pytorch_model.bin", map_location="cpu") model.load_state_dict(state_dict, strict=False) model.eval() def predict(im): x = torch.tensor(im, dtype=torch.float32).unsqueeze(0).unsqueeze(0) / 255.0 with torch.no_grad(): out = model(x) probabilities = torch.nn.functional.softmax(out[0], dim=0) values, indices = torch.topk(probabilities, 5) return {LABELS[i]: v.item() for i, v in zip(indices, values)} interface = gr.Interface( predict, inputs="sketchpad", outputs="label", theme="huggingface", title="Reconnaissance de croquis", description="Qui veut jouer au Pictionary ? Dessinez un objet courant comme une pelle ou un ordinateur portable, et l'algorithme le devinera en temps réel !", article="<p style='text-align: center'>Reconnaissance de croquis | Modèle de démonstration</p>", live=True, ) interface.launch(share=True)<jupyter_output><empty_output>
notebooks/course/fr/chapter9/section4.ipynb/0
{ "file_path": "notebooks/course/fr/chapter9/section4.ipynb", "repo_id": "notebooks", "token_count": 1441 }
158
<jupyter_start><jupyter_text>Image super-resolution using Latent Diffusion This colab notebook shows how to use the Latent Diffusion image super-resolution model using 🧨 [diffusers](https://github.com/huggingface/diffusers) libray.The model was originally released in [Latent Diffusion repo](https://github.com/CompVis/latent-diffusion). It's a simple, 4x super-resolution model diffusion model. This model is not conditioned on text. Install the Deps<jupyter_code>!pip install -qq diffusers==0.11.1 accelerate<jupyter_output>Installing build dependencies ... [?25l[?25hdone Getting requirements to build wheel ... [?25l[?25hdone Preparing wheel metadata ... [?25l[?25hdone  |████████████████████████████████| 175 kB 5.1 MB/s  |████████████████████████████████| 182 kB 46.5 MB/s [?25h Building wheel for diffusers (PEP 517) ... [?25l[?25hdone<jupyter_text>Imports<jupyter_code>import torch from PIL import Image import requests from io import BytesIO from diffusers import LDMSuperResolutionPipeline<jupyter_output><empty_output><jupyter_text>Load the pipeline<jupyter_code>device = "cuda" pipe = LDMSuperResolutionPipeline.from_pretrained( "CompVis/ldm-super-resolution-4x-openimages") pipe = pipe.to(device)<jupyter_output><empty_output><jupyter_text>Get the image for demo<jupyter_code># let's download an image url = "https://i.pinimg.com/236x/af/84/56/af8456faa55d76bd9afa18cd2fd72d58.jpg" response = requests.get(url) low_res_img = Image.open(BytesIO(response.content)).convert("RGB") low_res_img = low_res_img.resize((128, 128)) low_res_img<jupyter_output><empty_output><jupyter_text>Run pipeline to upscale the image<jupyter_code># run pipeline in inference (sample random noise and denoise) upscaled_image = pipe(low_res_img, num_inference_steps=100, eta=1).images[0] upscaled_image<jupyter_output><empty_output>
notebooks/diffusers/latent_diffusion_upscaler.ipynb/0
{ "file_path": "notebooks/diffusers/latent_diffusion_upscaler.ipynb", "repo_id": "notebooks", "token_count": 656 }
159
# adapted from https://github.com/huggingface/notebooks/blob/main/transformers_doc/en/pytorch/image_captioning.ipynb # This example demonstrates normal finetuning (w/o peft) - for the sake of keeping the memory # requirements small it freezes the original pre-trained text and image layers to keep the memory # requirements to just 40GB. If you have multiple GPUs then you can remove the unfreeze part to # finetune the whole model. Alternatively use the PEFT solution as shown in # IDEFICS_finetuning_demo.ipynb notebook which requires only 20GB to finetune the whole model. import torch import torchvision.transforms as transforms from datasets import load_dataset from PIL import Image from transformers import IdeficsForVisionText2Text, AutoProcessor, Trainer, TrainingArguments device = "cuda" if torch.cuda.is_available() else "cpu" checkpoint = "HuggingFaceM4/idefics-9b" # checkpoint = "HuggingFaceM4/tiny-random-idefics" processor = AutoProcessor.from_pretrained(checkpoint) model = IdeficsForVisionText2Text.from_pretrained(checkpoint, torch_dtype=torch.bfloat16).to(device) # freeze the original text and vision models and finetune only the layers added by IDEFICS # you can unfreeze the whole model, but it'll require multiple gpus to finetune model.model.freeze_text_layers() model.model.freeze_vision_layers() # help util def check_inference(): url = "https://huggingface.co/datasets/sayakpaul/sample-datasets/resolve/main/pokemon.png" prompts = [ url, "Question: What's on the picture? Answer:", ] inputs = processor(prompts, return_tensors="pt").to(device) generated_ids = model.generate(**inputs, max_length=150) generated_text = processor.batch_decode(generated_ids, skip_special_tokens=True)[0] print(generated_text) # check generation before finetuning check_inference() # well, actually it looks like the model is already aware of pokemon - but this dataset will refine it further # finetune the model on the pokemon types dataset ds = load_dataset("GabeHD/pokemon-type-captions") ds = ds["train"].train_test_split(test_size=0.1) train_ds = ds["train"] eval_ds = ds["test"] def convert_to_rgb(image): # `image.convert("RGB")` would only work for .jpg images, as it creates a wrong background # for transparent images. The call to `alpha_composite` handles this case if image.mode == "RGB": return image image_rgba = image.convert("RGBA") background = Image.new("RGBA", image_rgba.size, (255, 255, 255)) alpha_composite = Image.alpha_composite(background, image_rgba) alpha_composite = alpha_composite.convert("RGB") return alpha_composite def ds_transforms(example_batch): image_size = processor.image_processor.image_size image_mean = processor.image_processor.image_mean image_std = processor.image_processor.image_std image_transform = transforms.Compose([ convert_to_rgb, transforms.RandomResizedCrop((image_size, image_size), scale=(0.9, 1.0), interpolation=transforms.InterpolationMode.BICUBIC), transforms.ToTensor(), transforms.Normalize(mean=image_mean, std=image_std), ]) prompts = [] for i in range(len(example_batch)): prompts.append( [ example_batch["image"][i], f"Question: What's on the picture? Answer: {example_batch['text'][i]}\n", ], ) inputs = processor(prompts, transform=image_transform, return_tensors="pt").to(device) inputs["labels"] = inputs["input_ids"] return inputs train_ds.set_transform(ds_transforms) eval_ds.set_transform(ds_transforms) model_name = checkpoint.split("/")[1] # this setup requires about 40GB of gpu memory training_args = TrainingArguments( output_dir=f"{model_name}-pokemon", learning_rate=5e-6, num_train_epochs=10, bf16=True, per_device_train_batch_size=32, per_device_eval_batch_size=32, gradient_accumulation_steps=2, dataloader_pin_memory=False, save_total_limit=3, evaluation_strategy="steps", save_strategy="steps", save_steps=1000, # don't save until ready... eval_steps=40, logging_steps=40, remove_unused_columns=False, push_to_hub=False, label_names=["labels"], load_best_model_at_end=True, report_to=None, ) trainer = Trainer( model=model, args=training_args, train_dataset=train_ds, eval_dataset=eval_ds, ) trainer.train() # check generation again after finetuning check_inference() # after finetuning ideally we want generate to produce something like: a drawing of a pink and blue pokemon
notebooks/examples/idefics/finetune_image_captioning.py/0
{ "file_path": "notebooks/examples/idefics/finetune_image_captioning.py", "repo_id": "notebooks", "token_count": 1670 }
160
<jupyter_start><jupyter_text>If you're opening this Notebook on colab, you will probably need to install 🤗 Transformers as well as some other libraries. Uncomment the following cell and run it.<jupyter_code># Install !pip install -q biopython transformers datasets huggingface_hub accelerate peft<jupyter_output> ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 3.1/3.1 MB 43.0 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 56.8/56.8 kB 7.4 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 7.2/7.2 MB 104.9 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 486.2/486.2 kB 43.5 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 236.8/236.8 kB 23.1 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 227.6/227.6 kB 21.9 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 7.8/7.8 MB 49.6 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 1.3/1.3 MB 37.2 MB/s eta 0:00:00  ━━━━━━━━━━━━━━━━━━━━━━━━━━[...]<jupyter_text>If you're opening this notebook locally, make sure your environment has an install from the last version of those libraries.To be able to share your model with the community and generate results like the one shown in the picture below via the inference API, there are a few more steps to follow.First you have to login to the huggingface hub<jupyter_code>from huggingface_hub import notebook_login notebook_login()<jupyter_output>Token will not been saved to git credential helper. Pass `add_to_git_credential=True` if you want to set the git credential as well. Token is valid (permission: write). Your token has been saved to /root/.cache/huggingface/token Login successful<jupyter_text>Then you need to install Git-LFS. Uncomment the following instructions:<jupyter_code>!apt install git-lfs<jupyter_output>Reading package lists... Done Building dependency tree Reading state information... Done git-lfs is already the newest version (2.9.2-1). 0 upgraded, 0 newly installed, 0 to remove and 13 not upgraded.<jupyter_text>We also quickly upload some telemetry - this tells us which examples and software versions are getting used so we know where to prioritize our maintenance efforts. We don't collect (or care about) any personally identifiable information, but if you'd prefer not to be counted, feel free to skip this step or delete this cell entirely.<jupyter_code>from transformers.utils import send_example_telemetry send_example_telemetry("nucleotide_transformer_dna_sequence_modeling_with_lora_notebook", framework="pytorch")<jupyter_output><empty_output><jupyter_text>**Fine-Tuning the Nucleotide-transformer with LoRA** The **Nucleotide Transformer** paper [Dalla-torre et al, 2023](https://www.biorxiv.org/content/10.1101/2023.01.11.523679v2) introduces 4 genomics foundational models developed by **InstaDeep**. These transformers, of various sizes and trained on different datasets, allow powerful representations of DNA sequences that allow to tackle a very diverse set of problems such as chromatin accessibility, deleteriousness prediction, promoter and enhancer prediction etc... These representations can be extracted from the transformer and used as proxies of the DNA sequences (this is called probing) or the transformer can be trained further on a specific task (this is called finetuning). This notebook allows you to fine-tune one of these models.[LoRA: Low-Rank Adaptation of Large Language Models](https://arxiv.org/abs/2106.09685) is one of the state of the art parameter-efficient finetuning methods that is explained in details in this [blog post](https://huggingface.co/blog/lora). Any transformer model can be finetuned using this method with very little effort using the 🤗 Transformers library, which is why it is used in this notebook instead of the [IA³ technique](https://arxiv.org/abs/2205.05638) presented in the original paper.The model we are going to use is the [500M Human Ref model](https://huggingface.co/InstaDeepAI/nucleotide-transformer-500m-1000g), which is a 500M parameters transformer pre-trained on the human reference genome, per the training methodology presented in the Nucleotide Transformer Paper. It is one of the 4 models introduced, all available on the [Instadeep HuggingFace page](https://huggingface.co/InstaDeepAI):```| Model name | Num layers | Num parameters | Training dataset ||---------------------|------------|----------------|------------------------|| `500M Human Ref` | 24 | 500M | Human reference genome || `500M 1000G` | 24 | 500M | 1000G genomes || `2.5B 1000G` | 32 | 2.5B | 1000G genomes || `2.5B Multispecies` | 32 | 2.5B | Multi-species dataset |```Note that even though the finetuning is done with a parameter-efficient method, using the larger checkpoints will still require more GPU memory and produce longer finetuning timesIn the following, we showcase the nucleotide transformer ability to classify genomic sequences as two of the most basic genomic motifs: **promoters** and **enhancers types**. Both of them are classification task, but the enhancers types task is much more challenging with its 3 classes.These two tasks are very basic, but the nucleotide transformers have been shown to beat/match state of the art models on much more complex tasks such as [DeepSEA](https://www.nature.com/articles/nmeth.3547), which, given a DNA sequence, predicts 919 chromatin profiles from a diverse set of human cells and tissues from a single sequence or [DeepSTARR](https://www.nature.com/articles/s41588-022-01048-5), which predicts an enhancer's activity. **Importing required packages and setting up PEFT model** **Import and install**<jupyter_code># Imports from transformers import AutoTokenizer, AutoModelForMaskedLM, TrainingArguments, Trainer, AutoModelForSequenceClassification import torch from sklearn.metrics import matthews_corrcoef, f1_score from sklearn.model_selection import train_test_split import matplotlib.pyplot as plt import numpy as np # Define the working device device = torch.device("cuda")<jupyter_output><empty_output><jupyter_text>**Prepare and create the model for fine-tuning** The nucleotide transformer will be fine-tuned on two **classification tasks**: promoter and enhancer types classification.The `AutoModelForSequenceClassification` module automatically loads the model and adds a simple classification head on top of the final embeddings.<jupyter_code>num_labels_promoter = 2 # Load the model model = AutoModelForSequenceClassification.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-human-ref", num_labels=num_labels_promoter) model = model.to(device)<jupyter_output>Some weights of the model checkpoint at InstaDeepAI/nucleotide-transformer-500m-human-ref were not used when initializing EsmForSequenceClassification: ['lm_head.layer_norm.weight', 'lm_head.bias', 'lm_head.dense.bias', 'lm_head.decoder.weight', 'lm_head.dense.weight', 'lm_head.layer_norm.bias'] - This IS expected if you are initializing EsmForSequenceClassification from the checkpoint of a model trained on another task or with another architecture (e.g. initializing a BertForSequenceClassification model from a BertForPreTraining model). - This IS NOT expected if you are initializing EsmForSequenceClassification from the checkpoint of a model that you expect to be exactly identical (initializing a BertForSequenceClassification model from a BertForSequenceClassification model). Some weights of EsmForSequenceClassification were not initialized from the model checkpoint at InstaDeepAI/nucleotide-transformer-500m-human-ref and are newly initialized: ['classifier.out_proj.bias', 'classifier[...]<jupyter_text>The LoRA parameters are now added to the model, and the parameters that will be finetuned are indicated.<jupyter_code>from peft import LoraConfig, TaskType peft_config = LoraConfig( task_type=TaskType.SEQ_CLS, inference_mode=False, r=1, lora_alpha= 32, lora_dropout=0.1, target_modules= ["query", "value"], #modules_to_save=["intermediate"] # modules that are not frozen and updated during the training ) from peft import get_peft_model lora_classifier = get_peft_model(model, peft_config) # transform our classifier into a peft model lora_classifier.print_trainable_parameters() lora_classifier.to(device) # Put the model on the GPU<jupyter_output>trainable params: 3407364 || all params: 482205925 || trainable%: 0.7066201021897439<jupyter_text>**First task : Promoter prediction** Promoter prediction is a **sequence classification** problem, in which the DNA sequence is predicted to be either a promoter or not.A promoter is a region of DNA where transcription of a gene is initiated. Promoters are a vital component of expression vectors because they control the binding of RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately translated into a functional protein This task was introduced in [DeePromoter](https://www.frontiersin.org/articles/10.3389/fgene.2019.00286/full), where a set of TATA and non-TATA promoters was gathered. A negative sequence was generated from each promoter, by randomly sampling subsets of the sequence, to guarantee that some obvious motifs were present both in the positive and negative dataset. **Dataset loading and preparation**<jupyter_code>from datasets import load_dataset, Dataset # Load the promoter dataset from the InstaDeep Hugging Face ressources dataset_name = "promoter_all" train_dataset_promoter = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="train", streaming= False, ) test_dataset_promoter = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="test", streaming= False, ) # Get training data train_sequences_promoter = train_dataset_promoter['sequence'] train_labels_promoter = train_dataset_promoter['label'] # Split the dataset into a training and a validation dataset train_sequences_promoter, validation_sequences_promoter, train_labels_promoter, validation_labels_promoter = train_test_split(train_sequences_promoter, train_labels_promoter, test_size=0.05, random_state=42) # Get test data test_sequences_promoter = test_dataset_promoter['sequence'] test_labels_promoter = test_dataset_promoter['label']<jupyter_output><empty_output><jupyter_text>Let us have a look at the data. If we extract the last sequence of the dataset, we see that it is indeed a promoter, as its label is 1. Furthermore, we can also see that it is a TATA promoter, as the TATA motif is present at the 221th nucleotide of the sequence!<jupyter_code>idx_sequence = -1 sequence, label = train_sequences_promoter[idx_sequence], train_labels_promoter[idx_sequence] print(f"The DNA sequence is {sequence}.") print(f"Its associated label is label {label}.") idx_TATA = sequence.find("TATA") print(f"This promoter is a TATA promoter, as the TATA motif is present at the {idx_TATA}th nucleotide.")<jupyter_output>The DNA sequence is CACACCAGACAAAATTTGGTTAATTTGCGCCCAATATTCATTACTTTGACCTAACCTTTGTTCTGAAGGCCGTGTACAAGGACAAGGCCCTGAGATTATTGCAACAGTAACTTGAAAAACTTTCAGAAGTCTATTCTGTAGGATTAAAGGAATGCTGAGACTATTCAAGTTTGAAGTCCTGGGGGTGGGGAAAAATAAAAAACCTGTGCTAGAAAGCTTAGTATAGCATGTAACTTTAGAGTCCTGTGGAGTCCTGAGTCTCCCACAGACCAGAACAGTCATTTAAAAGTTTTCAGGAAA. Its associated label is label 1. This promoter is a TATA promoter, as the TATA motif is present at the 221th nucleotide.<jupyter_text>**Tokenizing the datasets** All inputs to neural nets must be numerical. The process of converting strings into numerical indices suitable for a neural net is called **tokenization**.<jupyter_code># Load the tokenizer tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-human-ref") # Promoter dataset ds_train_promoter = Dataset.from_dict({"data": train_sequences_promoter,'labels':train_labels_promoter}) ds_validation_promoter = Dataset.from_dict({"data": validation_sequences_promoter,'labels':validation_labels_promoter}) ds_test_promoter = Dataset.from_dict({"data": test_sequences_promoter,'labels':test_labels_promoter}) def tokenize_function(examples): outputs = tokenizer(examples["data"]) return outputs # Creating tokenized promoter dataset tokenized_datasets_train_promoter = ds_train_promoter.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_validation_promoter = ds_validation_promoter.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_test_promoter = ds_test_promoter.map( tokenize_function, batched=True, remove_columns=["data"], )<jupyter_output><empty_output><jupyter_text>**Fine-tuning and evaluation** We initialize our `TrainingArguments`. These control the various training hyperparameters, and will be passed to our `Trainer`.The hyperparameters used for the IA³ method in the paper do not provide good performance for the LoRa method. Mainly, LoRA introduces more trainable parameters, therefore requiring a smaller learning rate. We here use a learning rate of 5.10⁻⁴, which enables us to get close to the [**paper's**](https://www.biorxiv.org/content/10.1101/2023.01.11.523679v1.full.pdf) performance.<jupyter_code>batch_size = 8 model_name='nucleotide-transformer' args_promoter = TrainingArguments( f"{model_name}-finetuned-lora-NucleotideTransformer", remove_unused_columns=False, evaluation_strategy="steps", save_strategy="steps", learning_rate=5e-4, per_device_train_batch_size=batch_size, gradient_accumulation_steps= 1, per_device_eval_batch_size= 64, num_train_epochs= 2, logging_steps= 100, load_best_model_at_end=True, # Keep the best model according to the evaluation metric_for_best_model="f1_score", label_names=["labels"], dataloader_drop_last=True, max_steps= 1000 )<jupyter_output><empty_output><jupyter_text>Next, we define the metric we will use to evaluate our models and write a `compute_metrics` function. We can load this from the `scikit-learn` library.<jupyter_code># Define the metric for the evaluation using the f1 score def compute_metrics_f1_score(eval_pred): """Computes F1 score for binary classification""" predictions = np.argmax(eval_pred.predictions, axis=-1) references = eval_pred.label_ids r={'f1_score': f1_score(references, predictions)} return r trainer = Trainer( model.to(device), args_promoter, train_dataset= tokenized_datasets_train_promoter, eval_dataset= tokenized_datasets_validation_promoter, tokenizer=tokenizer, compute_metrics=compute_metrics_f1_score, )<jupyter_output><empty_output><jupyter_text>We can now finetune our model by just calling the `train` method:<jupyter_code>train_results = trainer.train()<jupyter_output>/usr/local/lib/python3.10/dist-packages/transformers/optimization.py:411: FutureWarning: This implementation of AdamW is deprecated and will be removed in a future version. Use the PyTorch implementation torch.optim.AdamW instead, or set `no_deprecation_warning=True` to disable this warning warnings.warn(<jupyter_text>Note that the finetuning is done with a small batch size (8). The training time can be reduced by increasing the batch size, as it leverages parallelism in the GPU. **Validation F1 score**<jupyter_code>curve_evaluation_f1_score =[[a['step'],a['eval_f1_score']] for a in trainer.state.log_history if 'eval_f1_score' in a.keys()] eval_f1_score = [c[1] for c in curve_evaluation_f1_score] steps = [c[0] for c in curve_evaluation_f1_score] plt.plot(steps, eval_f1_score, 'b', label='Validation F1 score') plt.title('Validation F1 score for promoter prediction') plt.xlabel('Number of training steps performed') plt.ylabel('Validation F1 score') plt.legend() plt.show()<jupyter_output><empty_output><jupyter_text>**F1 score on the test dataset**<jupyter_code># Compute the F1 score on the test dataset : print(f"F1 score on the test dataset: {trainer.predict(tokenized_datasets_test_promoter).metrics['test_f1_score']}")<jupyter_output><empty_output><jupyter_text>For the promoter prediction task, we reproduced the experiment carried out in the [**article**](https://www.biorxiv.org/content/10.1101/2023.01.11.523679v1.full.pdf) by adapting the learning rate to the LoRa method. A F1 score of **0.937** is obtained after just **1000 training steps**. To get closer to the **0.954** score obtained in the nucleotide transformer paper after 10,000 training steps, we surely need to train for longer! **Second task : Enhancer prediction** In this section, we fine-tune the nucleotide transformer model on **enhancer type prediction**, which consists in classifying a DNA sequence as **strong**, **weak** or **non enhancer**.In genetics, an enhancer is a short (50–1500 bp) region of DNA that can be bound by proteins (activators) to increase the likelihood that transcription of a particular gene will occur.[A deep learning framework for enhancer prediction using word embedding and sequence generation](https://www.sciencedirect.com/science/article/abs/pii/S0301462222000643) introduced the dataset used here by augmenting an original set of enhancers with 6000 synthetic enhancers and 6000 syntheticnon-enhancers produced through a generative model. **Dataset loading and preparation**<jupyter_code>from datasets import load_dataset, Dataset # Load the enhancers dataset from the InstaDeep Hugging Face ressources dataset_name = "enhancers_types" train_dataset_enhancers = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="train", streaming= False, ) test_dataset_enhancers = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="test", streaming= False, ) # Get training data train_sequences_enhancers = train_dataset_enhancers['sequence'] train_labels_enhancers = train_dataset_enhancers['label'] # Split the dataset into a training and a validation dataset train_sequences_enhancers, validation_sequences_enhancers, train_labels_enhancers, validation_labels_enhancers = train_test_split(train_sequences_enhancers, train_labels_enhancers, test_size=0.10, random_state=42) # Get test data test_sequences_enhancers = test_dataset_enhancers['sequence'] test_labels_enhancers = test_dataset_enhancers['label']<jupyter_output><empty_output><jupyter_text>**Tokenizing the datasets**<jupyter_code># Enhancer dataset ds_train_enhancers = Dataset.from_dict({"data": train_sequences_enhancers,'labels':train_labels_enhancers}) ds_validation_enhancers = Dataset.from_dict({"data": validation_sequences_enhancers,'labels':validation_labels_enhancers}) ds_test_enhancers = Dataset.from_dict({"data": test_sequences_enhancers,'labels':test_labels_enhancers}) # Creating tokenized enhancer dataset tokenized_datasets_train_enhancers = ds_train_enhancers.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_validation_enhancers = ds_validation_enhancers.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_test_enhancers = ds_test_enhancers.map( tokenize_function, batched=True, remove_columns=["data"], )<jupyter_output><empty_output><jupyter_text>**Fine-tuning and evaluation**<jupyter_code># Load the model num_labels_enhancers = 3 model = AutoModelForSequenceClassification.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-human-ref", num_labels=num_labels_enhancers) model = model.to(device) peft_config = LoraConfig( task_type=TaskType.SEQ_CLS, inference_mode=False, r=1, lora_alpha= 32, lora_dropout=0.1, target_modules= ["query", "value"], #modules_to_save=["intermediate"] # modules that are not frozen and updated during the training ) lora_classifier = get_peft_model(model, peft_config) # transform our classifier into a peft model lora_classifier.print_trainable_parameters() lora_classifier.to(device) # Put the model on the GPU<jupyter_output>trainable params: 3409926 || all params: 482208487 || trainable%: 0.7071476533344383<jupyter_text>We initialize our `TrainingArguments`. These control the various training hyperparameters, and will be passed to our `Trainer`.We keep the same hyperparameters as for the promoter task, i.e the same as in the paper except for a learning rate of 5.10⁻⁴, which enables us to get close to [**paper's**](https://www.biorxiv.org/content/10.1101/2023.01.11.523679v1.full.pdf) performance.<jupyter_code>batch_size = 8 model_name='nucleotide-transformer' args_enhancers = TrainingArguments( f"{model_name}-finetuned-lora-NucleotideTransformer", remove_unused_columns=False, evaluation_strategy="steps", save_strategy="steps", learning_rate=5e-4, per_device_train_batch_size=batch_size, gradient_accumulation_steps= 1, per_device_eval_batch_size= 64, num_train_epochs= 2, logging_steps= 100, load_best_model_at_end=True, # Keep the best model according to the evaluation metric_for_best_model="mcc_score", # The mcc_score on the evaluation dataset used to select the best model label_names=["labels"], dataloader_drop_last=True, max_steps= 1000 )<jupyter_output><empty_output><jupyter_text>Here, the metric used to evaluate the model is the Matthews Correlation Coefficient, which is more relevant than the accuracy when the classes in the dataset are unbalanced. We can load a predefined function from the `scikit-learn` library.<jupyter_code># Define the metric for the evaluation def compute_metrics_mcc(eval_pred): """Computes Matthews correlation coefficient (MCC score) for binary classification""" predictions = np.argmax(eval_pred.predictions, axis=-1) references = eval_pred.label_ids r={'mcc_score': matthews_corrcoef(references, predictions)} return r trainer = Trainer( lora_classifier, args_enhancers, train_dataset= tokenized_datasets_train_enhancers, eval_dataset= tokenized_datasets_validation_enhancers, tokenizer=tokenizer, compute_metrics=compute_metrics_mcc, )<jupyter_output><empty_output><jupyter_text>We can now finetune our model by just calling the `train` method:<jupyter_code>train_results = trainer.train()<jupyter_output>/usr/local/lib/python3.10/dist-packages/transformers/optimization.py:411: FutureWarning: This implementation of AdamW is deprecated and will be removed in a future version. Use the PyTorch implementation torch.optim.AdamW instead, or set `no_deprecation_warning=True` to disable this warning warnings.warn(<jupyter_text>As with the first task, the time can be greatly reduced by increasing the batch size. **Validation MCC score**<jupyter_code>curve_evaluation_mcc_score=[[a['step'],a['eval_mcc_score']] for a in trainer.state.log_history if 'eval_mcc_score' in a.keys()] eval_mcc_score = [c[1] for c in curve_evaluation_mcc_score] steps = [c[0] for c in curve_evaluation_mcc_score] plt.plot(steps, eval_mcc_score, 'b', label='Validation MCC score') plt.title('Validation MCC score for enhancer prediction') plt.xlabel('Number of training steps performed') plt.ylabel('Validation MCC score') plt.legend() plt.show()<jupyter_output><empty_output><jupyter_text>**MCC on the test dataset**<jupyter_code># Compute the MCC score on the test dataset : print(f"MCC score on the test dataset: {trainer.predict(tokenized_datasets_test_enhancers).metrics['test_mcc_score']}")<jupyter_output><empty_output>
notebooks/examples/nucleotide_transformer_dna_sequence_modelling_with_peft.ipynb/0
{ "file_path": "notebooks/examples/nucleotide_transformer_dna_sequence_modelling_with_peft.ipynb", "repo_id": "notebooks", "token_count": 8292 }
161
<jupyter_start><jupyter_text>How to fine-tune a T5 model with ONNX RuntimeThis notebook is largely inspired by the summarization [notebook of Transformers](https://github.com/huggingface/notebooks/blob/main/examples/summarization.ipynb) which takes PyTorch as backend for fine tuning.Here you will use the `ORTSeq2SeqTrainer` class in [Optimum](https://github.com/huggingface/optimum) library and take [ONNX Runtime](https://microsoft.github.io/onnxruntime/) as backend to accelerate the training. In this notebook, we will walk through the fine-tuning of [T5-small](https://huggingface.co/docs/transformers/model_doc/t5) model in the 🤗 Transformers for a summarization task. We will use the [XSum](https://arxiv.org/pdf/1808.08745.pdf) dataset (for extreme summarization) which contains BBC articles accompanied with single-sentence summaries, and the training as well as inference will be done by leveraging `ORTSeq2SeqTrainer` in Optimum! Let's speed the training up! __Dependencies__To use ONNX Runtime for training, you need a machine with at least one NVIDIA GPU.__ONNX Runtime training module need to be properly installed before launching the notebook! Please follow the instruction in [Optimum's documentation](https://huggingface.co/docs/optimum/onnxruntime/trainer) to set up your environment.__Check your GPU:<jupyter_code>!nvidia-smi<jupyter_output>Fri Sep 16 19:04:38 2022 +-----------------------------------------------------------------------------+ | NVIDIA-SMI 440.33.01 Driver Version: 440.33.01 CUDA Version: 11.3 | |-------------------------------+----------------------+----------------------+ | GPU Name Persistence-M| Bus-Id Disp.A | Volatile Uncorr. ECC | | Fan Temp Perf Pwr:Usage/Cap| Memory-Usage | GPU-Util Compute M. | |===============================+======================+======================| | 0 Tesla T4 On | 00000000:00:1E.0 Off | 0 | | N/A 43C P0 25W / 70W | 3420MiB / 15109MiB | 0% Default | +-------------------------------+----------------------+----------------------+ +-----------------------------------------------------------------------------+ | Processes: GPU Memory | | GPU [...]<jupyter_text>If you're opening this Notebook on colab, you will probably need to install 🤗 Optimum, 🤗 Transformers, 🤗 Datasets and 🤗 evaluate. Uncomment the following cell and run it.<jupyter_code>!pip install optimum transformers datasets evaluate rouge-score nltk tokenizers>=0.11.0 import nltk nltk.download("punkt")<jupyter_output>[nltk_data] Downloading package punkt to /root/nltk_data... [nltk_data] Unzipping tokenizers/punkt.zip.<jupyter_text>__[Optional]__ If you want to share your model with the community and generate an inference API, there are a few more steps to follow.First you have to store your authentication token from the Hugging Face website (sign up [here](https://huggingface.co/welcome) if you haven't already!) then execute the following cell and input your username and password:<jupyter_code>from huggingface_hub import notebook_login notebook_login()<jupyter_output><empty_output><jupyter_text>Then you need to install Git-LFS. Uncomment the following instructions:<jupyter_code>!apt install git-lfs<jupyter_output><empty_output><jupyter_text>Make sure your version of Transformers is at least 4.15.0:<jupyter_code>import transformers print(transformers.__version__)<jupyter_output>4.23.0.dev0<jupyter_text>__Setup__<jupyter_code>model_checkpoint = "t5-small" task = "xsum" metric_name = "rouge" batch_size = 8 learning_rate=2e-5 weight_decay = 0.01 num_train_epochs = 1<jupyter_output><empty_output><jupyter_text>We also quickly upload some telemetry - this tells us which examples and software versions are getting used so we know where to prioritize our maintenance efforts. We don't collect (or care about) any personally identifiable information, but if you'd prefer not to be counted, feel free to skip this step or delete this cell entirely.<jupyter_code>from transformers.utils import send_example_telemetry send_example_telemetry("summarization_notebook_ort", framework="none")<jupyter_output><empty_output><jupyter_text>Loading the datasetWe will use the [🤗 Datasets](https://github.com/huggingface/datasets) library to download the data and get the metric we need to use for evaluation (to compare our model to the benchmark). This can be easily done with the functions `load_dataset` and `load_metric`.<jupyter_code>from datasets import load_dataset, load_metric raw_datasets = load_dataset(task) metric = load_metric(metric_name)<jupyter_output><empty_output><jupyter_text>__[Optional]__ To get a sense of what the data looks like, the following function will show some examples picked randomly in the dataset.<jupyter_code>import datasets import random import pandas as pd from IPython.display import display, HTML def show_random_elements(dataset, num_examples=1): assert num_examples <= len(dataset), "Can't pick more elements than there are in the dataset." picks = [] for _ in range(num_examples): pick = random.randint(0, len(dataset)-1) while pick in picks: pick = random.randint(0, len(dataset)-1) picks.append(pick) df = pd.DataFrame(dataset[picks]) for column, typ in dataset.features.items(): if isinstance(typ, datasets.ClassLabel): df[column] = df[column].transform(lambda i: typ.names[i]) display(HTML(df.to_html())) show_random_elements(raw_datasets["train"])<jupyter_output><empty_output><jupyter_text>The metric is an instance of [`datasets.Metric`](https://huggingface.co/docs/datasets/package_reference/main_classes.htmldatasets.Metric):<jupyter_code>metric fake_preds = ["hello there", "general kenobi"] fake_labels = ["hello there", "general kenobi"] metric.compute(predictions=fake_preds, references=fake_labels)<jupyter_output><empty_output><jupyter_text>Preprocessing the dataBefore we can feed those texts to our model, we need to preprocess them. This is done by a 🤗 Transformers `Tokenizer` which will (as the name indicates) tokenize the inputs (including converting the tokens to their corresponding IDs in the pretrained vocabulary) and put it in a format the model expects, as well as generate the other inputs that the model requires.To do all of this, we instantiate our tokenizer with the `AutoTokenizer.from_pretrained` method, which will ensure:* we get a tokenizer that corresponds to the model architecture we want to use,* we download the vocabulary used when pretraining this specific checkpoint.That vocabulary will be cached, so it's not downloaded again the next time we run the cell.<jupyter_code>from transformers import AutoTokenizer tokenizer = AutoTokenizer.from_pretrained(model_checkpoint)<jupyter_output>/usr/local/lib/python3.8/dist-packages/transformers/models/t5/tokenization_t5_fast.py:156: FutureWarning: This tokenizer was incorrectly instantiated with a model max length of 512 which will be corrected in Transformers v5. For now, this behavior is kept to avoid breaking backwards compatibility when padding/encoding with `truncation is True`. - Be aware that you SHOULD NOT rely on t5-small automatically truncating your input to 512 when padding/encoding. - If you want to encode/pad to sequences longer than 512 you can either instantiate this tokenizer with `model_max_length` or pass `max_length` when encoding/padding. - To avoid this warning, please instantiate this tokenizer with `model_max_length` set to your preferred value. warnings.warn(<jupyter_text>To prepare the targets for our model, we need to tokenize them inside the as_target_tokenizer context manager. This will make sure the tokenizer uses the special tokens corresponding to the targets:<jupyter_code>with tokenizer.as_target_tokenizer(): print(tokenizer(["Hello, this one sentence!", "This is another sentence."]))<jupyter_output>{'input_ids': [[8774, 6, 48, 80, 7142, 55, 1], [100, 19, 430, 7142, 5, 1]], 'attention_mask': [[1, 1, 1, 1, 1, 1, 1], [1, 1, 1, 1, 1, 1]]}<jupyter_text>If you are using one of the five T5 checkpoints we have to prefix the inputs with "summarize:" (the model can also translate and it needs the prefix to know which task it has to perform).<jupyter_code>if model_checkpoint in ["t5-small", "t5-base", "t5-large", "t5-3b", "t5-11b"]: prefix = "summarize: " else: prefix = ""<jupyter_output><empty_output><jupyter_text>We can then write the function that will preprocess our samples. We just feed them to the `tokenizer` with the argument `truncation=True`. This will ensure that an input longer that what the model selected can handle will be truncated to the maximum length accepted by the model. The padding will be dealt with later on (in a data collator) so we pad examples to the longest length in the batch and not the whole dataset.<jupyter_code>max_input_length = 1024 max_target_length = 128 def preprocess_function(examples): inputs = [prefix + doc for doc in examples["document"]] model_inputs = tokenizer(inputs, max_length=max_input_length, truncation=True) # Setup the tokenizer for targets with tokenizer.as_target_tokenizer(): labels = tokenizer(examples["summary"], max_length=max_target_length, truncation=True) model_inputs["labels"] = labels["input_ids"] return model_inputs<jupyter_output><empty_output><jupyter_text>To apply this function on all the pairs of sentences in our dataset, we just use the `map` method of our `dataset` object we created earlier. This will apply the function on all the elements of all the splits in `dataset`, so our training, validation and testing data will be preprocessed in one single command.<jupyter_code>tokenized_datasets = raw_datasets.map(preprocess_function, batched=True)<jupyter_output><empty_output><jupyter_text>Even better, the results are automatically cached by the 🤗 Datasets library to avoid spending time on this step the next time you run your notebook. The 🤗 Datasets library is normally smart enough to detect when the function you pass to map has changed (and thus requires to not use the cache data). For instance, it will properly detect if you change the task in the first cell and rerun the notebook. 🤗 Datasets warns you when it uses cached files, you can pass `load_from_cache_file=False` in the call to `map` to not use the cached files and force the preprocessing to be applied again.Note that we passed `batched=True` to encode the texts by batches together. This is to leverage the full benefit of the fast tokenizer we loaded earlier, which will use multi-threading to treat the texts in a batch concurrently. Fine-tuning the modelNow that our data is ready, we can download the pretrained model and fine-tune it. Since our task is of the sequence-to-sequence kind, we use the `AutoModelForSeq2SeqLM` class to fist load the PyTorch model. Like with the tokenizer, the `from_pretrained` method will download and cache the model for us.<jupyter_code>from transformers import AutoModelForSeq2SeqLM, DataCollatorForSeq2Seq from optimum.onnxruntime import ORTSeq2SeqTrainer, ORTSeq2SeqTrainingArguments model = AutoModelForSeq2SeqLM.from_pretrained(model_checkpoint)<jupyter_output>huggingface/tokenizers: The current process just got forked, after parallelism has already been used. Disabling parallelism to avoid deadlocks... To disable this warning, you can either: - Avoid using `tokenizers` before the fork if possible - Explicitly set the environment variable TOKENIZERS_PARALLELISM=(true | false) huggingface/tokenizers: The current process just got forked, after parallelism has already been used. Disabling parallelism to avoid deadlocks... To disable this warning, you can either: - Avoid using `tokenizers` before the fork if possible - Explicitly set the environment variable TOKENIZERS_PARALLELISM=(true | false) huggingface/tokenizers: The current process just got forked, after parallelism has already been used. Disabling parallelism to avoid deadlocks... To disable this warning, you can either: - Avoid using `tokenizers` before the fork if possible - Explicitly set the environment variable TOKENIZERS_PARALLELISM=(true | false)<jupyter_text>Note that we don't get a warning like in our classification example. This means we used all the weights of the pretrained model and there is no randomly initialized head in this case.To instantiate a `ORTSeq2SeqTrainer`, we will need to define three more things. The most important is the [`ORTSeq2SeqTrainingArguments`](https://huggingface.co/docs/optimum/onnxruntime/traineroptimum.onnxruntime.ORTSeq2SeqTrainingArguments), which is a class that contains all the attributes to customize the training. You can also use `Seq2SeqTrainingArguments` in Transformers, but `ORTSeq2SeqTrainingArguments` enables more optimized features of ONNX Runtime. It requires one folder name, which will be used to save the checkpoints of the model, and all other arguments are optional:<jupyter_code>model_name = model_checkpoint.split("/")[-1] args = ORTSeq2SeqTrainingArguments( f"{model_name}-finetuned-xsum", evaluation_strategy = "epoch", learning_rate=learning_rate, per_device_train_batch_size=batch_size, per_device_eval_batch_size=batch_size, weight_decay=weight_decay, save_total_limit=3, num_train_epochs=num_train_epochs, predict_with_generate=True, optim="adamw_ort_fused", # push_to_hub=True, )<jupyter_output><empty_output><jupyter_text>Here we set the evaluation to be done at the end of each epoch, tweak the learning rate, use the `batch_size` defined at the top of the cell and customize the weight decay. Since the `ORTSeq2SeqTrainer` will save the model regularly and our dataset is quite large, we tell it to make three saves maximum. Lastly, we use the `predict_with_generate` option (to properly generate summaries) and activate mixed precision training (to go a bit faster).The last argument to setup everything so we can push the model to the [Hub](https://huggingface.co/models) regularly during training. Remove it if you didn't follow the installation steps at the top of the notebook. If you want to save your model locally in a name that is different than the name of the repository it will be pushed, or if you want to push your model under an organization and not your name space, use the hub_model_id argument to set the repo name (it needs to be the full name, including your namespace: for instance `"optimum/t5-large-finetuned-xsum"`).Then, we need a special kind of data collator, which will not only pad the inputs to the maximum length in the batch, but also the labels:<jupyter_code>data_collator = DataCollatorForSeq2Seq( tokenizer, model=model, label_pad_token_id=tokenizer.pad_token_id, pad_to_multiple_of=8 if args.fp16 else None, )<jupyter_output><empty_output><jupyter_text>The last thing to define for our `ORTSeq2SeqTrainer` is how to compute the metrics from the predictions. We need to define a function for this, which will just use the `metric` we loaded earlier, and we have to do a bit of pre-processing to decode the predictions into texts:<jupyter_code>import nltk import numpy as np def compute_metrics(eval_pred): predictions, labels = eval_pred decoded_preds = tokenizer.batch_decode(predictions, skip_special_tokens=True) # Replace -100 in the labels as we can't decode them. labels = np.where(labels != -100, labels, tokenizer.pad_token_id) decoded_labels = tokenizer.batch_decode(labels, skip_special_tokens=True) # Rouge expects a newline after each sentence decoded_preds = ["\n".join(nltk.sent_tokenize(pred.strip())) for pred in decoded_preds] decoded_labels = ["\n".join(nltk.sent_tokenize(label.strip())) for label in decoded_labels] result = metric.compute(predictions=decoded_preds, references=decoded_labels, use_stemmer=True) # Extract a few results result = {key: value.mid.fmeasure * 100 for key, value in result.items()} # Add mean generated length prediction_lens = [np.count_nonzero(pred != tokenizer.pad_token_id) for pred in predictions] result["gen_len"] = np.mean(prediction_lens) return {k: round(v, 4) for k, v in result.items()}<jupyter_output><empty_output><jupyter_text>Then we just need to pass all of this along with our datasets to the `ORTSeq2SeqTrainer`:<jupyter_code>trainer = ORTSeq2SeqTrainer( model=model, args=args, train_dataset=tokenized_datasets["train"], eval_dataset=tokenized_datasets["validation"], tokenizer=tokenizer, data_collator=data_collator, compute_metrics=compute_metrics if args.predict_with_generate else None, feature="seq2seq-lm", )<jupyter_output><empty_output><jupyter_text>We can now finetune our model by just calling the `train` method:<jupyter_code>trainer.train()<jupyter_output>The following columns in the training set don't have a corresponding argument in `T5ForConditionalGeneration.forward` and have been ignored: summary, id, document. If summary, id, document are not expected by `T5ForConditionalGeneration.forward`, you can safely ignore this message. You're using a T5TokenizerFast tokenizer. Please note that with a fast tokenizer, using the `__call__` method is faster than using a method to encode the text followed by a call to the `pad` method to get a padded encoding. /usr/local/lib/python3.8/dist-packages/onnxruntime/training/ortmodule/_training_manager.py:191: UserWarning: Fast path enabled - skipping checks. Rebuild graph: True, Execution agent: True, Device check: True warnings.warn( WARNING: The shape inference of org.pytorch.aten::ATen type is missing, so it may result in wrong shape inference for the exported graph. Please consider adding it in symbolic function. WARNING: The shape inference of org.pytorch.aten::ATen type is missing, so it ma[...]<jupyter_text>You can now upload the result of the training to the Hub, just execute this instruction:<jupyter_code>trainer.push_to_hub()<jupyter_output><empty_output><jupyter_text>You will also be able to save your fine-tuned model as PyTorch or ONNX model in the `output_dir` that you set in `ORTSeq2SeqTrainer`:<jupyter_code>trainer.save_model()<jupyter_output><empty_output><jupyter_text>Evaluating your model Evaluate the performance of the model that you just fine-tuned with the validation dataset that you've passed to `ORTSeq2SeqTrainer` by just calling the `evaluate` method. If you set `inference_with_ort=True`, the inference will be done with ONNX Runtime backend. Otherwise, the inference will take PyTorch as backend.<jupyter_code>trainer.evaluate(inference_with_ort=True)<jupyter_output>The following columns in the evaluation set don't have a corresponding argument in `T5ForConditionalGeneration.forward` and have been ignored: summary, id, document. If summary, id, document are not expected by `T5ForConditionalGeneration.forward`, you can safely ignore this message. Using framework PyTorch: 1.11.0+cu113 Overriding 1 configuration item(s) - use_cache -> False WARNING: The shape inference of org.pytorch.aten::ATen type is missing, so it may result in wrong shape inference for the exported graph. Please consider adding it in symbolic function. WARNING: The shape inference of org.pytorch.aten::ATen type is missing, so it may result in wrong shape inference for the exported graph. Please consider adding it in symbolic function. WARNING: The shape inference of org.pytorch.aten::ATen type is missing, so it may result in wrong shape inference for the exported graph. Please consider adding it in symbolic function. WARNING: The shape inference of org.pytorch.aten::ATen type i[...]
notebooks/examples/summarization_ort.ipynb/0
{ "file_path": "notebooks/examples/summarization_ort.ipynb", "repo_id": "notebooks", "token_count": 6048 }
162
<jupyter_start><jupyter_text>Getting started with Owl-ViTIn this notebook, we are going to run the [OWL-ViT](https://arxiv.org/abs/2205.06230) model (an open-vocabulary object detection model) by Google Research on scikit-image samples images. OWL-ViT: A Quick IntroOWL-ViT is an open-vocabulary object detector. Given an image and one or multiple free-text queries, it finds objects matching the queries in the image. Unlike traditional object detection models, OWL-ViT is not trained on labeled object datasets and leverages multi-modal representations to perform open-vocabulary detection. OWL-ViT uses CLIP with a ViT-like Transformer as its backbone to get multi-modal visual and text features. To use CLIP for object detection, OWL-ViT removes the final token pooling layer of the vision model and attaches a lightweight classification and box head to each transformer output token. Open-vocabulary classification is enabled by replacing the fixed classification layer weights with the class-name embeddings obtained from the text model. The authors first train CLIP from scratch and fine-tune it end-to-end with the classification and box heads on standard detection datasets using a bipartite matching loss. One or multiple text queries per image can be used to perform zero-shot text-conditioned object detection. Set-up environmentFirst, we install the HuggingFace Transformers library (from source for now, as the model was recently added to the library and is under active development). This might take a few minutes.<jupyter_code>!pip install -q git+https://github.com/huggingface/transformers.git<jupyter_output><empty_output><jupyter_text>**Optional:** Install Pillow, matplotlib and OpenCV if you are running this notebook locally.<jupyter_code>!pip install Pillow !pip install matplotlib !pip install opencv-python<jupyter_output><empty_output><jupyter_text>We also quickly upload some telemetry - this tells us which examples and software versions are getting used so we know where to prioritize our maintenance efforts. We don't collect (or care about) any personally identifiable information, but if you'd prefer not to be counted, feel free to skip this step or delete this cell entirely.<jupyter_code>from transformers.utils import send_example_telemetry send_example_telemetry("zeroshot_object_detection_with_owlvit_notebook", framework="pytorch")<jupyter_output><empty_output><jupyter_text>Load pre-trained model and processorLet's first apply the image preprocessing and tokenize the text queries using `OwlViTProcessor`. The processor will resize the image(s), scale it between [0-1] range and normalize it across the channels using the mean and standard deviation specified in the original codebase.Text queries are tokenized using a CLIP tokenizer and stacked to output tensors of shape [batch_size * num_max_text_queries, sequence_length]. If you are inputting more than one set of (image, text prompt/s), num_max_text_queries is the maximum number of text queries per image across the batch. Input samples with fewer text queries are padded.<jupyter_code>from transformers import OwlViTProcessor, OwlViTForObjectDetection model = OwlViTForObjectDetection.from_pretrained("google/owlvit-base-patch32") processor = OwlViTProcessor.from_pretrained("google/owlvit-base-patch32")<jupyter_output><empty_output><jupyter_text>Preprocess input image and text queriesLet's use the image of astronaut Eileen Collins to test OWL-ViT. It's part of the [NASA](https://www.nasa.gov/multimedia/imagegallery/index.html) Great Images dataset.You can use one or multiple text prompts per image to search for the target object(s). Let's start with a simple example where we search for multiple objects in a single image.<jupyter_code>import cv2 import skimage import numpy as np from PIL import Image # Download sample image image = skimage.data.astronaut() image = Image.fromarray(np.uint8(image)).convert("RGB") # Text queries to search the image for text_queries = ["human face", "rocket", "nasa badge", "star-spangled banner"] image import torch # Use GPU if available if torch.cuda.is_available(): device = torch.device("cuda") else: device = torch.device("cpu") # Process image and text inputs inputs = processor(text=text_queries, images=image, return_tensors="pt").to(device) # Print input names and shapes for key, val in inputs.items(): print(f"{key}: {val.shape}")<jupyter_output>input_ids: torch.Size([4, 16]) attention_mask: torch.Size([4, 16]) pixel_values: torch.Size([1, 3, 768, 768])<jupyter_text>Forward passNow we can pass the inputs to our OWL-ViT model to get object detection predictions. `OwlViTForObjectDetection` model outputs the prediction logits, boundary boxes and class embeddings, along with the image and text embeddings outputted by the `OwlViTModel`, which is the CLIP backbone.<jupyter_code># Set model in evaluation mode model = model.to(device) model.eval() # Get predictions with torch.no_grad(): outputs = model(**inputs) for k, val in outputs.items(): if k not in {"text_model_output", "vision_model_output"}: print(f"{k}: shape of {val.shape}") print("\nText model outputs") for k, val in outputs.text_model_output.items(): print(f"{k}: shape of {val.shape}") print("\nVision model outputs") for k, val in outputs.vision_model_output.items(): print(f"{k}: shape of {val.shape}")<jupyter_output>logits: shape of torch.Size([1, 576, 4]) pred_boxes: shape of torch.Size([1, 576, 4]) text_embeds: shape of torch.Size([1, 4, 512]) image_embeds: shape of torch.Size([1, 24, 24, 768]) class_embeds: shape of torch.Size([1, 576, 512]) Text model outputs last_hidden_state: shape of torch.Size([4, 16, 512]) pooler_output: shape of torch.Size([4, 512]) Vision model outputs last_hidden_state: shape of torch.Size([1, 577, 768]) pooler_output: shape of torch.Size([1, 768])<jupyter_text>Draw predictions on imageLet's draw the predictions / found objects on the input image. Remember the found objects correspond to the input text queries.<jupyter_code>import matplotlib.pyplot as plt from transformers.image_utils import ImageFeatureExtractionMixin mixin = ImageFeatureExtractionMixin() # Load example image image_size = model.config.vision_config.image_size image = mixin.resize(image, image_size) input_image = np.asarray(image).astype(np.float32) / 255.0 # Threshold to eliminate low probability predictions score_threshold = 0.1 # Get prediction logits logits = torch.max(outputs["logits"][0], dim=-1) scores = torch.sigmoid(logits.values).cpu().detach().numpy() # Get prediction labels and boundary boxes labels = logits.indices.cpu().detach().numpy() boxes = outputs["pred_boxes"][0].cpu().detach().numpy() def plot_predictions(input_image, text_queries, scores, boxes, labels): fig, ax = plt.subplots(1, 1, figsize=(8, 8)) ax.imshow(input_image, extent=(0, 1, 1, 0)) ax.set_axis_off() for score, box, label in zip(scores, boxes, labels): if score < score_threshold: continue cx, cy, w, h = box ax.plot([cx-w/2, cx+w/2, cx+w/2, cx-w/2, cx-w/2], [cy-h/2, cy-h/2, cy+h/2, cy+h/2, cy-h/2], "r") ax.text( cx - w / 2, cy + h / 2 + 0.015, f"{text_queries[label]}: {score:1.2f}", ha="left", va="top", color="red", bbox={ "facecolor": "white", "edgecolor": "red", "boxstyle": "square,pad=.3" }) plot_predictions(input_image, text_queries, scores, boxes, labels)<jupyter_output><empty_output><jupyter_text>Batch processingWe can also pass in multiple sets of images and text queries to search for different (or same) objects in different images. Let's download an image of a coffee mug to process alongside the astronaut image.For batch processing, we need to input text queries as a nested list to `OwlViTProcessor` and images as lists of (PIL images or PyTorch tensors or NumPy arrays).<jupyter_code># Download the coffee mug image image = skimage.data.coffee() image = Image.fromarray(np.uint8(image)).convert("RGB") image # Preprocessing images = [skimage.data.astronaut(), skimage.data.coffee()] images = [Image.fromarray(np.uint8(img)).convert("RGB") for img in images] # Nexted list of text queries to search each image for text_queries = [["human face", "rocket", "nasa badge", "star-spangled banner"], ["coffee mug", "spoon", "plate"]] # Process image and text inputs inputs = processor(text=text_queries, images=images, return_tensors="pt").to(device) # Print input names and shapes for key, val in inputs.items(): print(f"{key}: {val.shape}")<jupyter_output>input_ids: torch.Size([8, 16]) attention_mask: torch.Size([8, 16]) pixel_values: torch.Size([2, 3, 768, 768])<jupyter_text>**Note:** Notice the size of the `input_ids `and `attention_mask` is `[batch_size * num_max_text_queries, max_length]`. Max_length is set to 16 for all OWL-ViT models.<jupyter_code># Get predictions with torch.no_grad(): outputs = model(**inputs) for k, val in outputs.items(): if k not in {"text_model_output", "vision_model_output"}: print(f"{k}: shape of {val.shape}") print("\nText model outputs") for k, val in outputs.text_model_output.items(): print(f"{k}: shape of {val.shape}") print("\nVision model outputs") for k, val in outputs.vision_model_output.items(): print(f"{k}: shape of {val.shape}") # Let's plot the predictions for the second image image_idx = 1 image_size = model.config.vision_config.image_size image = mixin.resize(images[image_idx], image_size) input_image = np.asarray(image).astype(np.float32) / 255.0 # Threshold to eliminate low probability predictions score_threshold = 0.1 # Get prediction logits logits = torch.max(outputs["logits"][image_idx], dim=-1) scores = torch.sigmoid(logits.values).cpu().detach().numpy() # Get prediction labels and boundary boxes labels = logits.indices.cpu().detach().numpy() boxes = outputs["pred_boxes"][image_idx].cpu().detach().numpy() plot_predictions(input_image, text_queries[image_idx], scores, boxes, labels)<jupyter_output><empty_output><jupyter_text>Post-processing model predictionsNotice how we printed the output predictions on the resized input image. This is because OWL-ViT outputs normalized box coordinates in `[cx, cy, w, h]` format assuming a fixed input image size. We can use the `OwlViTProcessor`'s convenient post_process() method to convert the model outputs to a COCO API format and retrieve rescaled coordinates (with respect to the original image sizes) in `[x0, y0, x1, y1]` format.<jupyter_code># Target image sizes (height, width) to rescale box predictions [batch_size, 2] target_sizes = torch.Tensor([img.size[::-1] for img in images]).to(device) # Convert outputs (bounding boxes and class logits) to COCO API results = processor.post_process(outputs=outputs, target_sizes=target_sizes) # Loop over predictions for each image in the batch for i in range(len(images)): print(f"\nProcessing image {i}") text = text_queries[i] boxes, scores, labels = results[i]["boxes"], results[i]["scores"], results[i]["labels"] score_threshold = 0.1 for box, score, label in zip(boxes, scores, labels): box = [round(i, 2) for i in box.tolist()] if score >= score_threshold: print(f"Detected {text[label]} with confidence {round(score.item(), 3)} at location {box}")<jupyter_output>Processing image 0 Detected human face with confidence 0.357 at location [180.23, 71.53, 271.25, 178.76] Detected rocket with confidence 0.106 at location [358.81, 64.85, 424.18, 280.84] Detected star-spangled banner with confidence 0.138 at location [1.43, 1.26, 105.38, 509.68] Detected rocket with confidence 0.211 at location [350.98, -1.17, 468.6, 288.51] Detected nasa badge with confidence 0.281 at location [129.58, 348.54, 206.46, 427.98] Detected nasa badge with confidence 0.12 at location [277.15, 338.86, 327.42, 380.85] Processing image 1 Detected coffee mug with confidence 0.175 at location [175.23, 24.72, 420.98, 246.83] Detected spoon with confidence 0.132 at location [248.54, 63.72, 418.45, 327.98] Detected plate with confidence 0.115 at location [78.9, 74.04, 481.06, 391.81]<jupyter_text>Bonus: one-shot / image-guided object detectionInstead of performing zero-shot detection with text inputs, we can use the `OwlViTForObjectDetection.image_guided_detection()` method to query an input image with a query / example image and detect similar looking objects. To do this, we simply pass in `query_images` instead of text to the processor to get the `query_pixel_values`. Note that, unlike text input, `OwlViTProcessor` expects one query image per target image we'd like to query for similar objects. We will also see that the output and post-processing of one-shot object detection is very similar to the zero-shot / text-guided detection.Let's try this out by querying an image with cats with another random cat image. For this part of the demo, we will perform image-guided object detection, post-process the results and display the predicted boundary boxes on the original input image using OpenCV.<jupyter_code>import cv2 import requests from matplotlib import rcParams # Set figure size %matplotlib inline rcParams['figure.figsize'] = 11 ,8 # Input image url = "http://images.cocodataset.org/val2017/000000039769.jpg" image = Image.open(requests.get(url, stream=True).raw) target_sizes = torch.Tensor([image.size[::-1]]) # Query image query_url = "http://images.cocodataset.org/val2017/000000058111.jpg" query_image = Image.open(requests.get(query_url, stream=True).raw) # Display input image and query image fig, ax = plt.subplots(1,2) ax[0].imshow(image) ax[1].imshow(query_image) # Process input and query image inputs = processor(images=image, query_images=query_image, return_tensors="pt").to(device) # Print input names and shapes for key, val in inputs.items(): print(f"{key}: {val.shape}") # Get predictions with torch.no_grad(): outputs = model.image_guided_detection(**inputs) for k, val in outputs.items(): if k not in {"text_model_output", "vision_model_output"}: print(f"{k}: shape of {val.shape}") print("\nVision model outputs") for k, val in outputs.vision_model_output.items(): print(f"{k}: shape of {val.shape}") img = cv2.cvtColor(np.array(image), cv2.COLOR_BGR2RGB) outputs.logits = outputs.logits.cpu() outputs.target_pred_boxes = outputs.target_pred_boxes.cpu() results = processor.post_process_image_guided_detection(outputs=outputs, threshold=0.6, nms_threshold=0.3, target_sizes=target_sizes) boxes, scores = results[0]["boxes"], results[0]["scores"] # Draw predicted bounding boxes for box, score in zip(boxes, scores): box = [int(i) for i in box.tolist()] img = cv2.rectangle(img, box[:2], box[2:], (255,0,0), 5) if box[3] + 25 > 768: y = box[3] - 10 else: y = box[3] + 25 plt.imshow(img[:,:,::-1])<jupyter_output><empty_output>
notebooks/examples/zeroshot_object_detection_with_owlvit.ipynb/0
{ "file_path": "notebooks/examples/zeroshot_object_detection_with_owlvit.ipynb", "repo_id": "notebooks", "token_count": 4929 }
163
import argparse import logging import os import random import sys from datasets import load_from_disk from sklearn.metrics import accuracy_score, precision_recall_fscore_support import torch from transformers import AutoModelForSequenceClassification, Trainer, TrainingArguments, AutoTokenizer if __name__ == "__main__": parser = argparse.ArgumentParser() # hyperparameters sent by the client are passed as command-line arguments to the script. parser.add_argument("--epochs", type=int, default=3) parser.add_argument("--train_batch_size", type=int, default=32) parser.add_argument("--eval_batch_size", type=int, default=64) parser.add_argument("--warmup_steps", type=int, default=500) parser.add_argument("--model_name", type=str) parser.add_argument("--learning_rate", type=float, default=5e-5) # Data, model, and output directories parser.add_argument("--checkpoints", type=str, default="/opt/ml/checkpoints/") parser.add_argument("--model_dir", type=str, default=os.environ["SM_MODEL_DIR"]) parser.add_argument("--n_gpus", type=str, default=os.environ["SM_NUM_GPUS"]) parser.add_argument("--training_dir", type=str, default=os.environ["SM_CHANNEL_TRAIN"]) parser.add_argument("--test_dir", type=str, default=os.environ["SM_CHANNEL_TEST"]) args, _ = parser.parse_known_args() # Set up logging logger = logging.getLogger(__name__) logging.basicConfig( level=logging.getLevelName("INFO"), handlers=[logging.StreamHandler(sys.stdout)], format="%(asctime)s - %(name)s - %(levelname)s - %(message)s", ) # load datasets train_dataset = load_from_disk(args.training_dir) test_dataset = load_from_disk(args.test_dir) logger.info(f" loaded train_dataset length is: {len(train_dataset)}") logger.info(f" loaded test_dataset length is: {len(test_dataset)}") # compute metrics function for binary classification def compute_metrics(pred): labels = pred.label_ids preds = pred.predictions.argmax(-1) precision, recall, f1, _ = precision_recall_fscore_support(labels, preds, average="binary") acc = accuracy_score(labels, preds) return {"accuracy": acc, "f1": f1, "precision": precision, "recall": recall} # download model from model hub model = AutoModelForSequenceClassification.from_pretrained(args.model_name) tokenizer = AutoTokenizer.from_pretrained(args.model_name) # define training args training_args = TrainingArguments( output_dir=args.checkpoints, num_train_epochs=args.epochs, per_device_train_batch_size=args.train_batch_size, per_device_eval_batch_size=args.eval_batch_size, warmup_steps=args.warmup_steps, evaluation_strategy="epoch", logging_dir=f"{args.checkpoints}/logs", learning_rate=args.learning_rate, ) # create Trainer instance trainer = Trainer( model=model, args=training_args, compute_metrics=compute_metrics, train_dataset=train_dataset, eval_dataset=test_dataset, tokenizer=tokenizer, ) # train model trainer.train() # evaluate model eval_result = trainer.evaluate(eval_dataset=test_dataset) # writes eval result to file which can be accessed later in s3 ouput with open(os.path.join(args.checkpoints, "eval_results.txt"), "w") as writer: print(f"***** Eval results *****") for key, value in sorted(eval_result.items()): writer.write(f"{key} = {value}\n") # Saves the model locally. In SageMaker, writing in /opt/ml/model sends it to S3 trainer.save_model(args.model_dir)
notebooks/sagemaker/06_sagemaker_metrics/scripts/train.py/0
{ "file_path": "notebooks/sagemaker/06_sagemaker_metrics/scripts/train.py", "repo_id": "notebooks", "token_count": 1415 }
164
# SageMaker push to hf.co/models example
notebooks/sagemaker/14_train_and_push_to_hub/README.md/0
{ "file_path": "notebooks/sagemaker/14_train_and_push_to_hub/README.md", "repo_id": "notebooks", "token_count": 12 }
165
# Builds GPU docker image of PyTorch # Uses multi-staged approach to reduce size # Stage 1 # Use base conda image to reduce time FROM continuumio/miniconda3:latest AS compile-image # Specify py version ENV PYTHON_VERSION=3.8 # Install apt libs - copied from https://github.com/huggingface/accelerate/blob/main/docker/accelerate-gpu/Dockerfile RUN apt-get update && \ apt-get install -y curl git wget software-properties-common git-lfs && \ apt-get clean && \ rm -rf /var/lib/apt/lists* # Install audio-related libraries RUN apt-get update && \ apt install -y ffmpeg RUN apt install -y libsndfile1-dev RUN git lfs install # Create our conda env - copied from https://github.com/huggingface/accelerate/blob/main/docker/accelerate-gpu/Dockerfile RUN conda create --name peft python=${PYTHON_VERSION} ipython jupyter pip RUN python3 -m pip install --no-cache-dir --upgrade pip # Below is copied from https://github.com/huggingface/accelerate/blob/main/docker/accelerate-gpu/Dockerfile # We don't install pytorch here yet since CUDA isn't available # instead we use the direct torch wheel ENV PATH /opt/conda/envs/peft/bin:$PATH # Activate our bash shell RUN chsh -s /bin/bash SHELL ["/bin/bash", "-c"] # Stage 2 FROM nvidia/cuda:12.2.2-devel-ubuntu22.04 AS build-image COPY --from=compile-image /opt/conda /opt/conda ENV PATH /opt/conda/bin:$PATH RUN chsh -s /bin/bash SHELL ["/bin/bash", "-c"] RUN source activate peft && \ python3 -m pip install --no-cache-dir bitsandbytes optimum auto-gptq # Add autoawq for quantization testing RUN source activate peft && \ python3 -m pip install --no-cache-dir https://github.com/casper-hansen/AutoAWQ/releases/download/v0.2.1/autoawq-0.2.1-cp38-cp38-linux_x86_64.whl RUN source activate peft && \ python3 -m pip install --no-cache-dir https://github.com/casper-hansen/AutoAWQ_kernels/releases/download/v0.0.4/autoawq_kernels-0.0.4-cp38-cp38-linux_x86_64.whl # Install apt libs RUN apt-get update && \ apt-get install -y curl git wget && \ apt-get clean && \ rm -rf /var/lib/apt/lists* # Activate the conda env and install transformers + accelerate from source RUN source activate peft && \ python3 -m pip install -U --no-cache-dir \ librosa \ "soundfile>=0.12.1" \ scipy \ git+https://github.com/huggingface/transformers \ git+https://github.com/huggingface/accelerate \ peft[test]@git+https://github.com/huggingface/peft # Add aqlm for quantization testing RUN source activate peft && \ pip install aqlm[gpu]>=1.0.2 RUN source activate peft && \ pip freeze | grep transformers RUN echo "source activate peft" >> ~/.profile # Activate the virtualenv CMD ["/bin/bash"]
peft/docker/peft-gpu/Dockerfile/0
{ "file_path": "peft/docker/peft-gpu/Dockerfile", "repo_id": "peft", "token_count": 1010 }
166
<!--Copyright 2023 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ⚠️ Note that this file is in Markdown but contain specific syntax for our doc-builder (similar to MDX) that may not be rendered properly in your Markdown viewer. --> # Quantization Quantization represents data with fewer bits, making it a useful technique for reducing memory-usage and accelerating inference especially when it comes to large language models (LLMs). There are several ways to quantize a model including: * optimizing which model weights are quantized with the [AWQ](https://hf.co/papers/2306.00978) algorithm * independently quantizing each row of a weight matrix with the [GPTQ](https://hf.co/papers/2210.17323) algorithm * quantizing to 8-bit and 4-bit precision with the [bitsandbytes](https://github.com/TimDettmers/bitsandbytes) library * quantizing to as low as 2-bit precision with the [AQLM](https://arxiv.org/abs/2401.06118) algorithm However, after a model is quantized it isn't typically further trained for downstream tasks because training can be unstable due to the lower precision of the weights and activations. But since PEFT methods only add *extra* trainable parameters, this allows you to train a quantized model with a PEFT adapter on top! Combining quantization with PEFT can be a good strategy for training even the largest models on a single GPU. For example, [QLoRA](https://hf.co/papers/2305.14314) is a method that quantizes a model to 4-bits and then trains it with LoRA. This method allows you to finetune a 65B parameter model on a single 48GB GPU! In this guide, you'll see how to quantize a model to 4-bits and train it with LoRA. ## Quantize a model [bitsandbytes](https://github.com/TimDettmers/bitsandbytes) is a quantization library with a Transformers integration. With this integration, you can quantize a model to 8 or 4-bits and enable many other options by configuring the [`~transformers.BitsAndBytesConfig`] class. For example, you can: * set `load_in_4bit=True` to quantize the model to 4-bits when you load it * set `bnb_4bit_quant_type="nf4"` to use a special 4-bit data type for weights initialized from a normal distribution * set `bnb_4bit_use_double_quant=True` to use a nested quantization scheme to quantize the already quantized weights * set `bnb_4bit_compute_dtype=torch.bfloat16` to use bfloat16 for faster computation ```py import torch from transformers import BitsAndBytesConfig config = BitsAndBytesConfig( load_in_4bit=True, bnb_4bit_quant_type="nf4", bnb_4bit_use_double_quant=True, bnb_4bit_compute_dtype=torch.bfloat16, ) ``` Pass the `config` to the [`~transformers.AutoModelForCausalLM.from_pretrained`] method. ```py from transformers import AutoModelForCausalLM model = AutoModelForCausalLM.from_pretrained("mistralai/Mistral-7B-v0.1", quantization_config=config) ``` Next, you should call the [`~peft.utils.prepare_model_for_kbit_training`] function to preprocess the quantized model for training. ```py from peft import prepare_model_for_kbit_training model = prepare_model_for_kbit_training(model) ``` Now that the quantized model is ready, let's set up a configuration. ## LoraConfig Create a [`LoraConfig`] with the following parameters (or choose your own): ```py from peft import LoraConfig config = LoraConfig( r=16, lora_alpha=8, target_modules=["q_proj", "k_proj", "v_proj", "o_proj"], lora_dropout=0.05, bias="none", task_type="CAUSAL_LM" ) ``` Then use the [`get_peft_model`] function to create a [`PeftModel`] from the quantized model and configuration. ```py from peft import get_peft_model model = get_peft_model(model, config) ``` You're all set for training with whichever training method you prefer! ### LoftQ initialization [LoftQ](https://hf.co/papers/2310.08659) initializes LoRA weights such that the quantization error is minimized, and it can improve performance when training quantized models. To get started, follow [these instructions](https://github.com/huggingface/peft/tree/main/examples/loftq_finetuning). In general, for LoftQ to work best, it is recommended to target as many layers with LoRA as possible, since those not targeted cannot have LoftQ applied. This means that passing `LoraConfig(..., target_modules="all-linear")` will most likely give the best results. Also, you should use `nf4` as quant type in your quantization config when using 4bit quantization, i.e. `BitsAndBytesConfig(load_in_4bit=True, bnb_4bit_quant_type="nf4")`. ### QLoRA-style training QLoRA adds trainable weights to all the linear layers in the transformer architecture. Since the attribute names for these linear layers can vary across architectures, set `target_modules` to `"all-linear"` to add LoRA to all the linear layers: ```py config = LoraConfig(target_modules="all-linear", ...) ``` ## AQLM quantization Additive Quantization of Language Models ([AQLM](https://arxiv.org/abs/2401.06118)) is a Large Language Models compression method. It quantizes multiple weights together and takes advantage of interdependencies between them. AQLM represents groups of 8-16 weights as a sum of multiple vector codes. This allows it to compress models down to as low as 2-bit with considerably low accuracy losses. Since the AQLM quantization process is computationally expensive, a use of prequantized models is recommended. A partial list of available models can be found in the official aqlm [repository](https://github.com/Vahe1994/AQLM). The models support LoRA adapter tuning. To tune the quantized model you'll need to install the `aqlm` inference library: `pip install aqlm>=1.0.2`. Finetuned LoRA adapters shall be saved separately, as merging them with AQLM quantized weights is not possible. ```py quantized_model = AutoModelForCausalLM.from_pretrained( "BlackSamorez/Mixtral-8x7b-AQLM-2Bit-1x16-hf-test-dispatch", torch_dtype="auto", device_map="auto", low_cpu_mem_usage=True, ) peft_config = LoraConfig(...) quantized_model = get_peft_model(quantized_model, peft_config) ``` You can refer to the [Google Colab](https://colab.research.google.com/drive/12GTp1FCj5_0SnnNQH18h_2XFh9vS_guX?usp=sharing) example for an overview of AQLM+LoRA finetuning. ## Next steps If you're interested in learning more about quantization, the following may be helpful: * Learn more about details about QLoRA and check out some benchmarks on its impact in the [Making LLMs even more accessible with bitsandbytes, 4-bit quantization and QLoRA](https://huggingface.co/blog/4bit-transformers-bitsandbytes) blog post. * Read more about different quantization schemes in the Transformers [Quantization](https://hf.co/docs/transformers/main/quantization) guide.
peft/docs/source/developer_guides/quantization.md/0
{ "file_path": "peft/docs/source/developer_guides/quantization.md", "repo_id": "peft", "token_count": 2133 }
167
<!--Copyright 2023 The HuggingFace Team. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ⚠️ Note that this file is in Markdown but contain specific syntax for our doc-builder (similar to MDX) that may not be rendered properly in your Markdown viewer. --> # P-tuning [P-tuning](https://hf.co/papers/2103.10385) adds trainable prompt embeddings to the input that is optimized by a prompt encoder to find a better prompt, eliminating the need to manually design prompts. The prompt tokens can be added anywhere in the input sequence, and p-tuning also introduces anchor tokens for improving performance. The abstract from the paper is: *While GPTs with traditional fine-tuning fail to achieve strong results on natural language understanding (NLU), we show that GPTs can be better than or comparable to similar-sized BERTs on NLU tasks with a novel method P-tuning -- which employs trainable continuous prompt embeddings. On the knowledge probing (LAMA) benchmark, the best GPT recovers 64\% (P@1) of world knowledge without any additional text provided during test time, which substantially improves the previous best by 20+ percentage points. On the SuperGlue benchmark, GPTs achieve comparable and sometimes better performance to similar-sized BERTs in supervised learning. Importantly, we find that P-tuning also improves BERTs' performance in both few-shot and supervised settings while largely reducing the need for prompt engineering. Consequently, P-tuning outperforms the state-of-the-art approaches on the few-shot SuperGlue benchmark.*. ## PromptEncoderConfig [[autodoc]] tuners.p_tuning.config.PromptEncoderConfig ## PromptEncoder [[autodoc]] tuners.p_tuning.model.PromptEncoder
peft/docs/source/package_reference/p_tuning.md/0
{ "file_path": "peft/docs/source/package_reference/p_tuning.md", "repo_id": "peft", "token_count": 540 }
168
<jupyter_start><jupyter_text>Training PEFT models with new tokens being added to the embedding layers and tokenizerIn this example, we will learn how to train a LoRA model when adding new tokens to the tokenizer and model. This is a common usecase when doing the following:1. Instruction finetuning with new tokens beind added such as ``, ``, ``, ``, `` to properly format the conversations2. Finetuning on a specific language wherein language spoecific tokens are added, e.g., korean tokens being added to vocabulary for finetuning LLM on Korean datasets.3. Instruction finetuning to return outputs in certain format to enable agent behaviour new tokens such as ``, ``, ``, ``, ``, ``, ``.In such cases, you add the Embedding modules to the LORA `target_modules`. PEFT will take care of saving the embedding layers with the new added tokens along with the adapter weights that were trained on the specific initialization of the embeddings weights of the added tokens. Let's import the necessary libraries<jupyter_code>import os os.environ["CUDA_VISIBLE_DEVICES"] = "3" os.environ["WANDB_PROJECT"] = "PeftExamples" import transformers from peft import ( LoraConfig, PeftConfig, PeftModel, get_peft_model, prepare_model_for_kbit_training, ) from transformers import ( AutoModelForCausalLM, AutoTokenizer, HfArgumentParser, TrainingArguments, Trainer, default_data_collator, ) import torch from dataclasses import dataclass, field from typing import Optional from dataclass_csv import DataclassReader from torch.utils.data import Dataset, DataLoader from enum import Enum<jupyter_output><empty_output><jupyter_text>Prepare Model and Tokenizer Now, we will be adding 27 new tokens as well as replace the existing pad, bos and eos tokens of the model.<jupyter_code>class SpecialTokens(str, Enum): begin_target = "<|begintarget|>" end_target = "<|endtarget|>" begin_context = "<|begincontext|>" end_context = "<|endcontext|>" system = "<|system|>" user = "<|user|>" begin_last_user_utterance = "<|beginlastuserutterance|>" end_last_user_utterance = "<|endlastuserutterance|>" begin_dsts = "<|begindsts|>" end_dsts = "<|enddsts|>" begin_dst = "<|begindst|>" end_dst = "<|enddst|>" begin_belief = "<|beginbelief|>" end_belief = "<|endbelief|>" begin_response = "<|beginresponse|>" end_response = "<|endresponse|>" begin_action = "<|beginaction|>" end_action = "<|endaction|>" begin_user_action = "<|beginuseraction|>" end_user_action = "<|enduseraction|>" sys_actions = "<|sysactions|>" begin_intent = "<|beginintent|>" end_intent = "<|endintent|>" begin_requested_slots = "<|beginrequestedslots|>" end_requested_slots = "<|endrequestedslots|>" pad_token = "<|pad|>" bos_token = "<|startoftext|>" @classmethod def list(cls): return [c.value for c in cls]<jupyter_output><empty_output><jupyter_text>We will be finetuning Mistral-7B model. Let's load the tokenizer and add the special tokens followed by loading the base model and resizzing the embedding layers to accomodate the newly added tokens.<jupyter_code>model_name = "mistralai/Mistral-7B-v0.1" tokenizer = AutoTokenizer.from_pretrained( model_name, pad_token=SpecialTokens.pad_token.value, bos_token=SpecialTokens.bos_token.value, eos_token=SpecialTokens.end_target.value, additional_special_tokens=SpecialTokens.list(), ) model = AutoModelForCausalLM.from_pretrained( model_name, low_cpu_mem_usage=True # use_flash_attention_2=True, # leading to an error ) model.resize_token_embeddings(len(tokenizer))<jupyter_output><empty_output><jupyter_text>Apply LoRA<jupyter_code>config = LoraConfig( r=64, lora_alpha=128, lora_dropout=0.0, target_modules=["embed_tokens", "lm_head", "q_proj", "v_proj"] ) model = get_peft_model(model, config) print(model.print_trainable_parameters()) print(model)<jupyter_output>trainable params: 31,886,720 || all params: 7,273,840,000 || trainable%: 0.43837532857472805 None PeftModel( (base_model): LoraModel( (model): MistralForCausalLM( (model): MistralModel( (embed_tokens): lora.Embedding( (base_layer): Embedding(32027, 4096) (lora_dropout): ModuleDict( (default): Identity() ) (lora_A): ModuleDict() (lora_B): ModuleDict() (lora_embedding_A): ParameterDict( (default): Parameter containing: [torch.FloatTensor of size 64x32027]) (lora_embedding_B): ParameterDict( (default): Parameter containing: [torch.FloatTensor of size 4096x64]) ) (layers): ModuleList( (0-31): 32 x MistralDecoderLayer( (self_attn): MistralAttention( (q_proj): lora.Linear( (base_layer): Linear(in_features=4096, out_features=4096, bias=False) (lora_dropout): ModuleDict( (default): Identity([...]<jupyter_text>Preapre Dataset<jupyter_code>from datasets import load_dataset dataset = load_dataset("smangrul/assistant_chatbot_dataset") dataset = dataset["train"].train_test_split(0.2) text_column = "context" label_column = "target" max_length = 512 def preprocess_function(examples): batch_size = len(examples[text_column]) targets = [str(x) for x in examples[label_column]] model_inputs = tokenizer(examples[text_column]) labels = tokenizer(targets, add_special_tokens=False) # don't add bos token because we concatenate with inputs for i in range(batch_size): sample_input_ids = model_inputs["input_ids"][i] label_input_ids = labels["input_ids"][i] + [tokenizer.eos_token_id] # print(i, sample_input_ids, label_input_ids) model_inputs["input_ids"][i] = sample_input_ids + label_input_ids labels["input_ids"][i] = [-100] * len(sample_input_ids) + label_input_ids model_inputs["attention_mask"][i] = [1] * len(model_inputs["input_ids"][i]) # print(model_inputs) for i in range(batch_size): sample_input_ids = model_inputs["input_ids"][i] label_input_ids = labels["input_ids"][i] model_inputs["input_ids"][i] = [tokenizer.pad_token_id] * ( max_length - len(sample_input_ids) ) + sample_input_ids model_inputs["attention_mask"][i] = [0] * (max_length - len(sample_input_ids)) + model_inputs[ "attention_mask" ][i] labels["input_ids"][i] = [-100] * (max_length - len(sample_input_ids)) + label_input_ids model_inputs["input_ids"][i] = model_inputs["input_ids"][i][:max_length] model_inputs["attention_mask"][i] = model_inputs["attention_mask"][i][:max_length] labels["input_ids"][i] = labels["input_ids"][i][:max_length] model_inputs["labels"] = labels["input_ids"] return model_inputs processed_datasets = dataset.map( preprocess_function, batched=True, num_proc=1, remove_columns=dataset["train"].column_names, load_from_cache_file=False, desc="Running tokenizer on dataset", ) train_dataset = processed_datasets["train"] train_dataset train_dataloader = DataLoader( train_dataset, shuffle=True, collate_fn=default_data_collator, batch_size=8, pin_memory=True ) next(iter(train_dataloader)) tokenizer.decode(train_dataset[0]["input_ids"])<jupyter_output><empty_output><jupyter_text>Train the model<jupyter_code>training_args = TrainingArguments( output_dir="mistral_lora_clm_with_added_tokens", num_train_epochs=2, save_total_limit=5, per_device_train_batch_size=8, warmup_steps=10, weight_decay=0.0001, dataloader_drop_last=True, bf16=True, logging_steps=10, learning_rate=1e-5, gradient_checkpointing=True, gradient_checkpointing_kwargs={"use_reentrant": False}, remove_unused_columns=False, hub_model_id="smangrul/mistral_lora_clm_with_added_tokens", push_to_hub=True, hub_private_repo=True, ) trainer = Trainer( model=model, args=training_args, train_dataset=train_dataset, data_collator=default_data_collator, ) # model.config.use_cache = False trainer.train()<jupyter_output>Detected kernel version 5.4.0, which is below the recommended minimum of 5.5.0; this can cause the process to hang. It is recommended to upgrade the kernel to the minimum version or higher. Failed to detect the name of this notebook, you can set it manually with the WANDB_NOTEBOOK_NAME environment variable to enable code saving. wandb: Currently logged in as: smangrul. Use `wandb login --relogin` to force relogin<jupyter_text>Check the model output on a sample from evaluation dataset<jupyter_code>import random i = random.randint(0, len(dataset["test"])) context = dataset["test"][i]["context"] batch = tokenizer(context, return_tensors="pt") batch = {k: v.to("cuda") for k, v in batch.items()} model.eval() output_tokens = model.generate( **batch, max_new_tokens=256, do_sample=True, temperature=0.2, top_p=0.95, top_k=50, eos_token_id=tokenizer.eos_token_id, pad_token_id=tokenizer.pad_token_id, ) target_predicted = tokenizer.decode(output_tokens[0], skip_special_tokens=False).split("<|endcontext|>")[1] target = dataset["test"][i]["target"] print(f"{context=} \n\n {target_predicted=} \n\n {target=}")<jupyter_output>context="<|begincontext|><|user|>Can you find me a place to eat please?<|system|>Where at? And what kind of cuisine are you craving?<|user|>Somewhere in SF, and I am really craving Thai food at the moment!<|system|>I found a bunch of restaurants, there's actually 10 that you might like in San Francisco, one of them being Baan Thai House & Wine Bar<|user|>How can I reach them? And what's their address?<|system|>You can reach them by phone at 415-379-4505 and visit them at 534 Irving Street<|beginlastuserutterance|>Great, that restaurant sounds good<|endlastuserutterance|><|endcontext|>" target_predicted='<|begintarget|><|begindsts|><|begindst|><|beginintent|> FindRestaurants<|endintent|><|beginbelief|> Restaurants^city->SF~San Francisco|Restaurants^cuisine->Thai|Restaurants^restaurant_name->Baan Thai House & Wine Bar<|endbelief|><|enddst|><|enddsts|><|beginuseraction|> REQUEST->Restaurants^phone_number~|REQUEST->Restaurants^street_address~<|enduseraction|><|beginaction|> INFORM->Rest[...]<jupyter_text>Save the Adapter model When the lora layers are applied to embedding layers, the corresponding base model embedding layers are also saved.<jupyter_code>trainer.push_to_hub() trainer.model.push_to_hub(training_args.output_dir)<jupyter_output>/raid/sourab/peft/src/peft/utils/save_and_load.py:128: UserWarning: Setting `is_embedding_layer_resized` to `True` as embedding layers found in `target_modules` warnings.warn("Setting `is_embedding_layer_resized` to `True` as embedding layers found in `target_modules`")<jupyter_text>Check the model loading is working as expected and generating plausible outputs.<jupyter_code>from peft import PeftModel inference_model = AutoModelForCausalLM.from_pretrained( model_name, low_cpu_mem_usage=True, # use_flash_attention_2=True, ) inference_model.resize_token_embeddings(len(tokenizer)) inference_model = PeftModel.from_pretrained(inference_model, "smangrul/mistral_lora_clm_with_added_tokens") inference_model.to("cuda") inference_model.eval() output_tokens = inference_model.generate( **batch, max_new_tokens=256, do_sample=True, temperature=0.2, top_p=0.95, top_k=50, eos_token_id=tokenizer.eos_token_id, pad_token_id=tokenizer.pad_token_id, ) target_predicted = tokenizer.decode(output_tokens[0], skip_special_tokens=False).split("<|endcontext|>")[1] print(f"{context=} \n\n {target_predicted=} \n\n {target=}")<jupyter_output><empty_output>
peft/examples/causal_language_modeling/peft_lora_clm_with_additional_tokens.ipynb/0
{ "file_path": "peft/examples/causal_language_modeling/peft_lora_clm_with_additional_tokens.ipynb", "repo_id": "peft", "token_count": 4571 }
169
# Copyright 2023-present the HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import argparse import logging import math import os import random from pathlib import Path import datasets import evaluate import torch import transformers from accelerate import Accelerator from accelerate.logging import get_logger from accelerate.utils import set_seed from datasets import DatasetDict, load_dataset from huggingface_hub import Repository, create_repo from torch import nn from torch.utils.data import DataLoader from tqdm import tqdm from transformers import AutoModel, AutoTokenizer, SchedulerType, default_data_collator, get_scheduler from transformers.utils import get_full_repo_name from peft import LoraConfig, TaskType, get_peft_model logger = get_logger(__name__) def parse_args(): parser = argparse.ArgumentParser(description="Training a PEFT model for Semantic Search task") parser.add_argument("--dataset_name", type=str, default=None, help="dataset name on HF hub") parser.add_argument( "--max_length", type=int, default=128, help=( "The maximum total input sequence length after tokenization. Sequences longer than this will be truncated," " sequences shorter will be padded if `--pad_to_max_length` is passed." ), ) parser.add_argument( "--model_name_or_path", type=str, help="Path to pretrained model or model identifier from huggingface.co/models.", required=True, ) parser.add_argument( "--per_device_train_batch_size", type=int, default=8, help="Batch size (per device) for the training dataloader.", ) parser.add_argument( "--per_device_eval_batch_size", type=int, default=8, help="Batch size (per device) for the evaluation dataloader.", ) parser.add_argument( "--learning_rate", type=float, default=5e-5, help="Initial learning rate (after the potential warmup period) to use.", ) parser.add_argument("--weight_decay", type=float, default=0.0, help="Weight decay to use.") parser.add_argument("--num_train_epochs", type=int, default=3, help="Total number of training epochs to perform.") parser.add_argument( "--max_train_steps", type=int, default=None, help="Total number of training steps to perform. If provided, overrides num_train_epochs.", ) parser.add_argument( "--gradient_accumulation_steps", type=int, default=1, help="Number of updates steps to accumulate before performing a backward/update pass.", ) parser.add_argument( "--lr_scheduler_type", type=SchedulerType, default="linear", help="The scheduler type to use.", choices=["linear", "cosine", "cosine_with_restarts", "polynomial", "constant", "constant_with_warmup"], ) parser.add_argument( "--num_warmup_steps", type=int, default=0, help="Number of steps for the warmup in the lr scheduler." ) parser.add_argument("--output_dir", type=str, default=None, help="Where to store the final model.") parser.add_argument("--seed", type=int, default=None, help="A seed for reproducible training.") parser.add_argument("--push_to_hub", action="store_true", help="Whether or not to push the model to the Hub.") parser.add_argument( "--hub_model_id", type=str, help="The name of the repository to keep in sync with the local `output_dir`." ) parser.add_argument("--hub_token", type=str, help="The token to use to push to the Model Hub.") parser.add_argument( "--checkpointing_steps", type=str, default=None, help="Whether the various states should be saved at the end of every n steps, or 'epoch' for each epoch.", ) parser.add_argument( "--resume_from_checkpoint", type=str, default=None, help="If the training should continue from a checkpoint folder.", ) parser.add_argument( "--with_tracking", action="store_true", help="Whether to enable experiment trackers for logging.", ) parser.add_argument( "--report_to", type=str, default="all", help=( 'The integration to report the results and logs to. Supported platforms are `"tensorboard"`,' ' `"wandb"`, `"comet_ml"` and `"clearml"`. Use `"all"` (default) to report to all integrations.' "Only applicable when `--with_tracking` is passed." ), ) parser.add_argument( "--sanity_test", action="store_true", help="Whether to enable sanity test.", ) parser.add_argument( "--use_peft", action="store_true", help="Whether to use PEFT.", ) args = parser.parse_args() if args.push_to_hub: assert args.output_dir is not None, "Need an `output_dir` to create a repo when `--push_to_hub` is passed." return args def save_model_hook(models, weights, output_dir): for i, model in enumerate(models): model.save_pretrained(output_dir, state_dict=weights[i]) # make sure to pop weight so that corresponding model is not saved again weights.pop() def load_model_hook(models, input_dir): while len(models) > 0: model = models.pop() # pop models so that they are not loaded again if hasattr(model, "active_adapter") and hasattr(model, "load_adapter"): model.load_adapter(input_dir, model.active_adapter, is_trainable=True) class AutoModelForSentenceEmbedding(nn.Module): def __init__(self, model_name, tokenizer, normalize=True): super().__init__() self.model = AutoModel.from_pretrained( model_name ) # , quantizaton_config=BitsAndBytesConfig(load_in_8bit=True), device_map={"":0}) self.normalize = normalize self.tokenizer = tokenizer def forward(self, **kwargs): model_output = self.model(**kwargs) embeddings = self.mean_pooling(model_output, kwargs["attention_mask"]) if self.normalize: embeddings = torch.nn.functional.normalize(embeddings, p=2, dim=1) return embeddings def mean_pooling(self, model_output, attention_mask): token_embeddings = model_output[0] # First element of model_output contains all token embeddings input_mask_expanded = attention_mask.unsqueeze(-1).expand(token_embeddings.size()).float() return torch.sum(token_embeddings * input_mask_expanded, 1) / torch.clamp(input_mask_expanded.sum(1), min=1e-9) def __getattr__(self, name: str): """Forward missing attributes to the wrapped module.""" try: return super().__getattr__(name) # defer to nn.Module's logic except AttributeError: return getattr(self.model, name) def get_cosing_embeddings(query_embs, product_embs): return torch.sum(query_embs * product_embs, axis=1) def get_loss(cosine_score, labels): return torch.mean(torch.square(labels * (1 - cosine_score) + torch.clamp((1 - labels) * cosine_score, min=0.0))) def main(): args = parse_args() accelerator_kwargs = {"gradient_accumulation_steps": args.gradient_accumulation_steps} if args.with_tracking: accelerator_kwargs["log_with"] = args.report_to accelerator_kwargs["project_dir"] = args.output_dir accelerator = Accelerator(**accelerator_kwargs) # Make one log on every process with the configuration for debugging. logging.basicConfig( format="%(asctime)s - %(levelname)s - %(name)s - %(message)s", datefmt="%m/%d/%Y %H:%M:%S", level=logging.INFO, ) logger.info(accelerator.state, main_process_only=False) if accelerator.is_local_main_process: datasets.utils.logging.set_verbosity_warning() transformers.utils.logging.set_verbosity_info() else: datasets.utils.logging.set_verbosity_error() transformers.utils.logging.set_verbosity_error() # If passed along, set the training seed now. if args.seed is not None: set_seed(args.seed) # Handle the repository creation if accelerator.is_main_process: if args.push_to_hub: if args.hub_model_id is None: repo_name = get_full_repo_name(Path(args.output_dir).name, token=args.hub_token) else: repo_name = args.hub_model_id create_repo(repo_name, exist_ok=True, token=args.hub_token) repo = Repository(args.output_dir, clone_from=repo_name, token=args.hub_token) with open(os.path.join(args.output_dir, ".gitignore"), "w+") as gitignore: if "step_*" not in gitignore: gitignore.write("step_*\n") if "epoch_*" not in gitignore: gitignore.write("epoch_*\n") elif args.output_dir is not None: os.makedirs(args.output_dir, exist_ok=True) accelerator.wait_for_everyone() # get the tokenizer tokenizer = AutoTokenizer.from_pretrained(args.model_name_or_path) # dataset download and preprocessing if args.sanity_test: train_dataset = load_dataset("smangrul/amazon_esci", split="train[:1024]") val_dataset = load_dataset("smangrul/amazon_esci", split="validation[:1024]") dataset = DatasetDict({"train": train_dataset, "validation": val_dataset}) else: dataset = load_dataset(args.dataset_name) def preprocess_function(examples): queries = examples["query"] result = tokenizer(queries, padding="max_length", max_length=70, truncation=True) result = {f"query_{k}": v for k, v in result.items()} products = examples["product_title"] result_products = tokenizer(products, padding="max_length", max_length=70, truncation=True) for k, v in result_products.items(): result[f"product_{k}"] = v result["labels"] = examples["relevance_label"] return result processed_datasets = dataset.map( preprocess_function, batched=True, remove_columns=dataset["train"].column_names, desc="Running tokenizer on dataset", ) # Log a few random samples from the training set: for index in random.sample(range(len(processed_datasets["train"])), 3): logger.info(f"Sample {index} of the training set: {processed_datasets['train'][index]}.") # base model model = AutoModelForSentenceEmbedding(args.model_name_or_path, tokenizer) if args.use_peft: # peft config and wrapping peft_config = LoraConfig( r=8, lora_alpha=16, bias="none", task_type=TaskType.FEATURE_EXTRACTION, target_modules=["key", "query", "value"], ) model = get_peft_model(model, peft_config) model.print_trainable_parameters() accelerator.print(model) # get dataloaders train_dataloader = DataLoader( processed_datasets["train"], shuffle=True, collate_fn=default_data_collator, batch_size=args.per_device_train_batch_size, pin_memory=True, ) eval_dataloader = DataLoader( processed_datasets["validation"], shuffle=False, collate_fn=default_data_collator, batch_size=args.per_device_eval_batch_size, pin_memory=True, ) optimizer = torch.optim.Adam(model.parameters(), lr=args.learning_rate) # Scheduler and math around the number of training steps. overrode_max_train_steps = False num_update_steps_per_epoch = math.ceil(len(train_dataloader) / args.gradient_accumulation_steps) if args.max_train_steps is None: args.max_train_steps = args.num_train_epochs * num_update_steps_per_epoch overrode_max_train_steps = True lr_scheduler = get_scheduler( name=args.lr_scheduler_type, optimizer=optimizer, num_warmup_steps=args.num_warmup_steps, num_training_steps=args.max_train_steps, ) # Prepare everything with our `accelerator`. model, optimizer, train_dataloader, eval_dataloader, lr_scheduler = accelerator.prepare( model, optimizer, train_dataloader, eval_dataloader, lr_scheduler ) # We need to recalculate our total training steps as the size of the training dataloader may have changed num_update_steps_per_epoch = math.ceil(len(train_dataloader) / args.gradient_accumulation_steps) if overrode_max_train_steps: args.max_train_steps = args.num_train_epochs * num_update_steps_per_epoch # Afterwards we recalculate our number of training epochs args.num_train_epochs = math.ceil(args.max_train_steps / num_update_steps_per_epoch) # Figure out how many steps we should save the Accelerator states checkpointing_steps = args.checkpointing_steps if checkpointing_steps is not None and checkpointing_steps.isdigit(): checkpointing_steps = int(checkpointing_steps) # We need to initialize the trackers we use, and also store our configuration. # The trackers initializes automatically on the main process. if args.with_tracking: experiment_config = vars(args) # TensorBoard cannot log Enums, need the raw value experiment_config["lr_scheduler_type"] = experiment_config["lr_scheduler_type"].value accelerator.init_trackers("peft_semantic_search", experiment_config) metric = evaluate.load("roc_auc") total_batch_size = args.per_device_train_batch_size * accelerator.num_processes * args.gradient_accumulation_steps if args.use_peft: # saving and loading checkpoints for resuming training accelerator.register_save_state_pre_hook(save_model_hook) accelerator.register_load_state_pre_hook(load_model_hook) logger.info("***** Running training *****") logger.info(f" Num examples = {len(processed_datasets['train'])}") logger.info(f" Num Epochs = {args.num_train_epochs}") logger.info(f" Instantaneous batch size per device = {args.per_device_train_batch_size}") logger.info(f" Total train batch size (w. parallel, distributed & accumulation) = {total_batch_size}") logger.info(f" Gradient Accumulation steps = {args.gradient_accumulation_steps}") logger.info(f" Total optimization steps = {args.max_train_steps}") # Only show the progress bar once on each machine. progress_bar = tqdm(range(args.max_train_steps), disable=not accelerator.is_local_main_process) completed_steps = 0 starting_epoch = 0 # Potentially load in the weights and states from a previous save if args.resume_from_checkpoint: if args.resume_from_checkpoint is not None or args.resume_from_checkpoint != "": accelerator.print(f"Resumed from checkpoint: {args.resume_from_checkpoint}") accelerator.load_state(args.resume_from_checkpoint) path = os.path.basename(args.resume_from_checkpoint) else: # Get the most recent checkpoint dirs = [f.name for f in os.scandir(os.getcwd()) if f.is_dir()] dirs.sort(key=os.path.getctime) path = dirs[-1] # Sorts folders by date modified, most recent checkpoint is the last # Extract `epoch_{i}` or `step_{i}` training_difference = os.path.splitext(path)[0] if "epoch" in training_difference: starting_epoch = int(training_difference.replace("epoch_", "")) + 1 resume_step = None completed_steps = starting_epoch * num_update_steps_per_epoch else: # need to multiply `gradient_accumulation_steps` to reflect real steps resume_step = int(training_difference.replace("step_", "")) * args.gradient_accumulation_steps starting_epoch = resume_step // len(train_dataloader) resume_step -= starting_epoch * len(train_dataloader) completed_steps = resume_step // args.gradient_accumulation_steps # update the progress_bar if load from checkpoint progress_bar.update(completed_steps) for epoch in range(starting_epoch, args.num_train_epochs): model.train() if args.with_tracking: total_loss = 0 if args.resume_from_checkpoint and epoch == starting_epoch and resume_step is not None: # We skip the first `n` batches in the dataloader when resuming from a checkpoint active_dataloader = accelerator.skip_first_batches(train_dataloader, resume_step) else: active_dataloader = train_dataloader for step, batch in enumerate(active_dataloader): with accelerator.accumulate(model): query_embs = model(**{k.replace("query_", ""): v for k, v in batch.items() if "query" in k}) product_embs = model(**{k.replace("product_", ""): v for k, v in batch.items() if "product" in k}) loss = get_loss(get_cosing_embeddings(query_embs, product_embs), batch["labels"]) total_loss += accelerator.reduce(loss.detach().float(), reduction="sum") accelerator.backward(loss) optimizer.step() lr_scheduler.step() model.zero_grad() # Checks if the accelerator has performed an optimization step behind the scenes if accelerator.sync_gradients: progress_bar.update(1) completed_steps += 1 if (step + 1) % 100 == 0: logger.info(f"Step: {step+1}, Loss: {total_loss/(step+1)}") if args.with_tracking: accelerator.log({"train/loss": total_loss / (step + 1)}, step=completed_steps) if isinstance(checkpointing_steps, int): if completed_steps % checkpointing_steps == 0: output_dir = f"step_{completed_steps }" if args.output_dir is not None: output_dir = os.path.join(args.output_dir, output_dir) accelerator.save_state(output_dir) if completed_steps >= args.max_train_steps: break model.eval() for step, batch in enumerate(eval_dataloader): with torch.no_grad(): query_embs = model(**{k.replace("query_", ""): v for k, v in batch.items() if "query" in k}) product_embs = model(**{k.replace("product_", ""): v for k, v in batch.items() if "product" in k}) prediction_scores = get_cosing_embeddings(query_embs, product_embs) prediction_scores, references = accelerator.gather_for_metrics((prediction_scores, batch["labels"])) metric.add_batch( prediction_scores=prediction_scores, references=references, ) result = metric.compute() result = {f"eval/{k}": v for k, v in result.items()} # Use accelerator.print to print only on the main process. accelerator.print(f"epoch {epoch}:", result) if args.with_tracking: result["train/epoch_loss"] = total_loss.item() / len(train_dataloader) accelerator.log(result, step=completed_steps) if args.output_dir is not None: accelerator.wait_for_everyone() if accelerator.is_main_process: if isinstance(checkpointing_steps, str): accelerator.save_state(os.path.join(args.output_dir, f"epoch_{epoch}")) accelerator.unwrap_model(model).save_pretrained( args.output_dir, state_dict=accelerator.get_state_dict(accelerator.unwrap_model(model)) ) tokenizer.save_pretrained(args.output_dir) if args.push_to_hub: commit_message = ( f"Training in progress epoch {epoch}" if epoch < args.num_train_epochs - 1 else "End of training" ) repo.push_to_hub(commit_message=commit_message, blocking=False, auto_lfs_prune=True) accelerator.wait_for_everyone() accelerator.end_training() if __name__ == "__main__": main()
peft/examples/feature_extraction/peft_lora_embedding_semantic_search.py/0
{ "file_path": "peft/examples/feature_extraction/peft_lora_embedding_semantic_search.py", "repo_id": "peft", "token_count": 8634 }
170
# Copyright 2023-present the HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import argparse import copy import logging import math import os import random import re from pathlib import Path import datasets import torch import transformers from accelerate import Accelerator, DistributedType from accelerate.logging import get_logger from accelerate.utils import set_seed from datasets import load_dataset from huggingface_hub import Repository, create_repo from torch.utils.data import DataLoader from tqdm.auto import tqdm from transformers import ( CONFIG_MAPPING, MODEL_MAPPING, AutoConfig, AutoModelForCausalLM, AutoTokenizer, BitsAndBytesConfig, SchedulerType, default_data_collator, get_scheduler, ) from transformers.utils import send_example_telemetry from transformers.utils.versions import require_version from peft import PeftModel # Will error if the minimal version of Transformers is not installed. Remove at your own risks. # check_min_version("4.32.0.dev0") logger = get_logger(__name__) require_version("datasets>=1.8.0", "To fix: pip install -r examples/pytorch/language-modeling/requirements.txt") MODEL_CONFIG_CLASSES = list(MODEL_MAPPING.keys()) MODEL_TYPES = tuple(conf.model_type for conf in MODEL_CONFIG_CLASSES) def parse_args(): parser = argparse.ArgumentParser(description="Finetune a transformers model on a causal language modeling task") parser.add_argument( "--dataset_name", type=str, default=None, help="The name of the dataset to use (via the datasets library).", ) parser.add_argument( "--dataset_config_name", type=str, default=None, help="The configuration name of the dataset to use (via the datasets library).", ) parser.add_argument( "--train_file", type=str, default=None, help="A csv, txt or a json file containing the training data." ) parser.add_argument( "--validation_file", type=str, default=None, help="A csv, txt or a json file containing the validation data." ) parser.add_argument( "--validation_split_percentage", default=5, help="The percentage of the train set used as validation set in case there's no validation split", ) parser.add_argument( "--model_name_or_path", type=str, help="Path to pretrained model or model identifier from huggingface.co/models.", required=False, ) parser.add_argument( "--config_name", type=str, default=None, help="Pretrained config name or path if not the same as model_name", ) parser.add_argument( "--tokenizer_name", type=str, default=None, help="Pretrained tokenizer name or path if not the same as model_name", ) parser.add_argument( "--use_slow_tokenizer", action="store_true", help="If passed, will use a slow tokenizer (not backed by the 🤗 Tokenizers library).", ) parser.add_argument( "--per_device_train_batch_size", type=int, default=8, help="Batch size (per device) for the training dataloader.", ) parser.add_argument( "--per_device_eval_batch_size", type=int, default=8, help="Batch size (per device) for the evaluation dataloader.", ) parser.add_argument( "--learning_rate", type=float, default=5e-5, help="Initial learning rate (after the potential warmup period) to use.", ) parser.add_argument("--weight_decay", type=float, default=0.0, help="Weight decay to use.") parser.add_argument("--num_train_epochs", type=int, default=3, help="Total number of training epochs to perform.") parser.add_argument( "--max_train_steps", type=int, default=None, help="Total number of training steps to perform. If provided, overrides num_train_epochs.", ) parser.add_argument( "--gradient_accumulation_steps", type=int, default=1, help="Number of updates steps to accumulate before performing a backward/update pass.", ) parser.add_argument( "--lr_scheduler_type", type=SchedulerType, default="linear", help="The scheduler type to use.", choices=["linear", "cosine", "cosine_with_restarts", "polynomial", "constant", "constant_with_warmup"], ) parser.add_argument( "--num_warmup_steps", type=int, default=0, help="Number of steps for the warmup in the lr scheduler." ) parser.add_argument("--output_dir", type=str, default=None, help="Where to store the final model.") parser.add_argument("--seed", type=int, default=None, help="A seed for reproducible training.") parser.add_argument( "--model_type", type=str, default=None, help="Model type to use if training from scratch.", choices=MODEL_TYPES, ) parser.add_argument( "--ignore_pad_token_for_loss", type=bool, default=True, help="Whether to ignore the tokens corresponding to padded labels in the loss computation or not.", ) parser.add_argument( "--max_source_length", type=int, default=128, help=( "The maximum total input sequence length after " "tokenization.Sequences longer than this will be truncated, sequences shorter will be padded." ), ) parser.add_argument( "--max_target_length", type=int, default=128, help=( "The maximum total sequence length for target text after " "tokenization. Sequences longer than this will be truncated, sequences shorter will be padded." "during ``evaluate`` and ``predict``." ), ) parser.add_argument( "--pad_to_max_length", action="store_true", help="If passed, pad all samples to `max_length`. Otherwise, dynamic padding is used.", ) parser.add_argument( "--preprocessing_num_workers", type=int, default=None, help="The number of processes to use for the preprocessing.", ) parser.add_argument( "--overwrite_cache", action="store_true", help="Overwrite the cached training and evaluation sets" ) parser.add_argument( "--no_keep_linebreaks", action="store_true", help="Do not keep line breaks when using TXT files." ) parser.add_argument("--push_to_hub", action="store_true", help="Whether or not to push the model to the Hub.") parser.add_argument( "--hub_model_id", type=str, help="The name of the repository to keep in sync with the local `output_dir`." ) parser.add_argument("--hub_token", type=str, help="The token to use to push to the Model Hub.") parser.add_argument( "--trust_remote_code", type=bool, default=False, help=( "Whether or not to allow for custom models defined on the Hub in their own modeling files. This option" "should only be set to `True` for repositories you trust and in which you have read the code, as it will" "execute code present on the Hub on your local machine." ), ) parser.add_argument( "--checkpointing_steps", type=str, default=None, help="Whether the various states should be saved at the end of every n steps, or 'epoch' for each epoch.", ) parser.add_argument( "--resume_from_checkpoint", type=str, default=None, help="If the training should continue from a checkpoint folder.", ) parser.add_argument( "--with_tracking", action="store_true", help="Whether to enable experiment trackers for logging.", ) parser.add_argument( "--report_to", type=str, default="tensorboard", help=( 'The integration to report the results and logs to. Supported platforms are `"tensorboard"`,' ' `"wandb"`, `"comet_ml"` and `"clearml"`. Use `"all"` (default) to report to all integrations.' "Only applicable when `--with_tracking` is passed." ), ) parser.add_argument( "--low_cpu_mem_usage", action="store_true", help=( "It is an option to create the model as an empty shell, then only materialize its parameters when the pretrained weights are loaded." "If passed, LLM loading time and RAM consumption will be benefited." ), ) ########################## # Generation Config # ########################## parser.add_argument( "--temperature", type=float, default=0.8, help="temperature of 1.0 has no effect, lower tend toward greedy sampling", ) parser.add_argument("--k", type=int, default=40, help="Choose k candidate words") parser.add_argument("--p", type=float, default=0.95, help="The sum of probability of candidate words is 0.9 ") ########################## # Exp Args # ########################## parser.add_argument( "--adapter_name_or_path", type=str, default=None, help=( "The LoRA adapter checkpoint. Set None if you want to fine-tune from LoftQ." "Specify a path if you want to evaluate." ), ) args = parser.parse_args() # Sanity checks if args.dataset_name is None and args.train_file is None and args.validation_file is None: raise ValueError("Need either a dataset name or a training/validation file.") else: if args.train_file is not None: extension = args.train_file.split(".")[-1] assert extension in ["csv", "json", "txt"], "`train_file` should be a csv, json or txt file." if args.validation_file is not None: extension = args.validation_file.split(".")[-1] assert extension in ["csv", "json", "txt"], "`validation_file` should be a csv, json or txt file." if args.push_to_hub: assert args.output_dir is not None, "Need an `output_dir` to create a repo when `--push_to_hub` is passed." return args def main(): args = parse_args() # Sending telemetry. Tracking the example usage helps us better allocate resources to maintain them. The # information sent is the one passed as arguments along with your Python/PyTorch versions. send_example_telemetry("run_clm_no_trainer", args) # Initialize the accelerator. We will let the accelerator handle device placement for us in this example. # If we're using tracking, we also need to initialize it here and it will by default pick up all supported trackers # in the environment accelerator_log_kwargs = {} if args.with_tracking: accelerator_log_kwargs["log_with"] = args.report_to accelerator_log_kwargs["project_dir"] = args.output_dir accelerator = Accelerator(gradient_accumulation_steps=args.gradient_accumulation_steps, **accelerator_log_kwargs) # Make one log on every process with the configuration for debugging. logging.basicConfig( format="%(asctime)s - %(levelname)s - %(name)s - %(message)s", datefmt="%m/%d/%Y %H:%M:%S", level=logging.INFO, ) logger.info(accelerator.state, main_process_only=False) if accelerator.is_local_main_process: datasets.utils.logging.set_verbosity_warning() transformers.utils.logging.set_verbosity_info() else: datasets.utils.logging.set_verbosity_error() transformers.utils.logging.set_verbosity_error() # If passed along, set the training seed now. if args.seed is not None: set_seed(args.seed) # Handle the repository creation if accelerator.is_main_process: if args.push_to_hub: # Retrieve of infer repo_name repo_name = args.hub_model_id if repo_name is None: repo_name = Path(args.output_dir).absolute().name # Create repo and retrieve repo_id repo_id = create_repo(repo_name, exist_ok=True, token=args.hub_token).repo_id # Clone repo locally repo = Repository(args.output_dir, clone_from=repo_id, token=args.hub_token) with open(os.path.join(args.output_dir, ".gitignore"), "w+") as gitignore: if "step_*" not in gitignore: gitignore.write("step_*\n") if "epoch_*" not in gitignore: gitignore.write("epoch_*\n") elif args.output_dir is not None: os.makedirs(args.output_dir, exist_ok=True) accelerator.wait_for_everyone() # Get the datasets: you can either provide your own CSV/JSON/TXT training and evaluation files (see below) # or just provide the name of one of the public datasets available on the hub at https://huggingface.co/datasets/ # (the dataset will be downloaded automatically from the datasets Hub). # # For CSV/JSON files, this script will use the column called 'text' or the first column if no column called # 'text' is found. You can easily tweak this behavior (see below). # # In distributed training, the load_dataset function guarantee that only one local process can concurrently # download the dataset. if args.dataset_name is not None: # Downloading and loading a dataset from the hub. raw_datasets = load_dataset(args.dataset_name, args.dataset_config_name) if "validation" not in raw_datasets.keys(): raw_datasets["validation"] = load_dataset( args.dataset_name, args.dataset_config_name, split=f"train[:{args.validation_split_percentage}%]", ) raw_datasets["train"] = load_dataset( args.dataset_name, args.dataset_config_name, split=f"train[{args.validation_split_percentage}%:]", ) else: data_files = {} dataset_args = {} if args.train_file is not None: data_files["train"] = args.train_file if args.validation_file is not None: data_files["validation"] = args.validation_file extension = args.train_file.split(".")[-1] if extension == "txt": extension = "text" dataset_args["keep_linebreaks"] = not args.no_keep_linebreaks raw_datasets = load_dataset(extension, data_files=data_files, **dataset_args) # If no validation data is there, validation_split_percentage will be used to divide the dataset. if "validation" not in raw_datasets.keys(): raw_datasets["validation"] = load_dataset( extension, data_files=data_files, split=f"train[:{args.validation_split_percentage}%]", **dataset_args, ) raw_datasets["train"] = load_dataset( extension, data_files=data_files, split=f"train[{args.validation_split_percentage}%:]", **dataset_args, ) # See more about loading any type of standard or custom dataset (from files, python dict, pandas DataFrame, etc) at # https://huggingface.co/docs/datasets/loading_datasets.html. # Load pretrained model and tokenizer # # In distributed training, the .from_pretrained methods guarantee that only one local process can concurrently # download model & vocab. if args.config_name: config = AutoConfig.from_pretrained( args.config_name, trust_remote_code=args.trust_remote_code, ) elif args.model_name_or_path: config = AutoConfig.from_pretrained( args.model_name_or_path, trust_remote_code=args.trust_remote_code, ) else: config = CONFIG_MAPPING[args.model_type]() logger.warning("You are instantiating a new config instance from scratch.") if args.tokenizer_name: tokenizer = AutoTokenizer.from_pretrained( args.tokenizer_name, use_fast=not args.use_slow_tokenizer, trust_remote_code=args.trust_remote_code ) elif args.model_name_or_path: tokenizer = AutoTokenizer.from_pretrained( args.model_name_or_path, use_fast=not args.use_slow_tokenizer, trust_remote_code=args.trust_remote_code, ) else: raise ValueError( "You are instantiating a new tokenizer from scratch. This is not supported by this script." "You can do it from another script, save it, and load it from here, using --tokenizer_name." ) ########################## # Tokenizer # ########################## tokenizer.pad_token_id = 0 # unk. we want this to be different from the eos token tokenizer.padding_side = "left" # Allow batched inference tokenizer.truncation_side = "left" if args.model_name_or_path: model = AutoModelForCausalLM.from_pretrained( args.model_name_or_path, from_tf=bool(".ckpt" in args.model_name_or_path), config=config, low_cpu_mem_usage=True, quantization_config=BitsAndBytesConfig( load_in_4bit=True, bnb_4bit_use_double_quant=False, bnb_4bit_quant_type="nf4", bnb_4bit_compute_dtype=config.torch_dtype, ), ) else: logger.info("Training new model from scratch") model = AutoModelForCausalLM.from_config(config, trust_remote_code=args.trust_remote_code) ########################## # Peft Model # ########################## if args.adapter_name_or_path is None: model = PeftModel.from_pretrained(model, args.model_name_or_path, subfolder="loftq_init", is_trainable=True) else: model = PeftModel.from_pretrained(model, args.adapter_name_or_path, is_trainable=True) model.print_trainable_parameters() # We resize the embeddings only when necessary to avoid index errors. If you are creating a model from scratch # on a small vocab and want a smaller embedding size, remove this test. embedding_size = model.get_input_embeddings().weight.shape[0] if len(tokenizer) > embedding_size: model.resize_token_embeddings(len(tokenizer)) # Preprocessing the datasets. # First we tokenize all the texts. ########################## # GSM8K dataset # ########################## # Preprocessing the datasets. # First we tokenize all the texts. column_names = raw_datasets["train"].column_names # Get the column names for source/target. source_column, target_column = "question", "answer" # Temporarily set max_target_length for training. padding = "max_length" if args.pad_to_max_length else False task_prompt = "\nAnswer the above question. First think step by step and then answer the final number.\n" def prompt_process(sent_1, sent_2, prompt_1="", prompt_2="", prompt_3=""): sent_2 = sent_2.replace("####", "The final answer is") return prompt_1 + sent_1 + prompt_2 + sent_2 + prompt_3 def preprocess_function_train(examples): sources = examples[source_column] targets = examples[target_column] inputs = [prompt_process(source, target, prompt_2=task_prompt) for (source, target) in zip(sources, targets)] model_inputs = tokenizer( inputs, max_length=args.max_source_length + args.max_target_length, padding=padding, truncation=True, return_tensors="pt", ) labels = copy.deepcopy(model_inputs) # If we are padding here, replace all tokenizer.pad_token_id in the labels by -100 when we want to ignore # padding in the loss. if padding == "max_length" and args.ignore_pad_token_for_loss: # get the length of the target tokens. -1 to kick out the <BOS> token target_tokens = tokenizer(targets, padding=False) target_len = [len(label) - 1 for label in target_tokens["input_ids"]] # don't calculate the loss from source and padding (left padding) for i in range(len(labels["input_ids"])): labels["input_ids"][i, : -target_len[i]] = -100 model_inputs["labels"] = labels["input_ids"] return model_inputs def preprocess_function_test(examples): sources = examples[source_column] labels = examples[target_column] inputs = [source + task_prompt for source in sources] model_inputs = tokenizer(inputs, max_length=args.max_source_length, padding=padding, truncation=True) labels = tokenizer(labels, max_length=args.max_target_length, padding=padding, truncation=True) model_inputs["labels"] = labels["input_ids"] return model_inputs with accelerator.main_process_first(): train_dataset = raw_datasets["train"].map( preprocess_function_train, batched=True, num_proc=args.preprocessing_num_workers, remove_columns=column_names, load_from_cache_file=not args.overwrite_cache, desc="Running tokenizer on training dataset", ) eval_dataset = raw_datasets["test"].map( preprocess_function_test, batched=True, num_proc=args.preprocessing_num_workers, remove_columns=column_names, load_from_cache_file=not args.overwrite_cache, desc="Running tokenizer on test dataset", ) # Log a few random samples from the set: for index in random.sample(range(len(train_dataset)), 2): logger.info(f"Sample {index} of the training set: {train_dataset[index]}.") for index in random.sample(range(len(eval_dataset)), 2): logger.info(f"Sample {index} of the validation set: {eval_dataset[index]}.") # DataLoaders creation: train_dataloader = DataLoader( train_dataset, shuffle=True, collate_fn=default_data_collator, batch_size=args.per_device_train_batch_size ) eval_dataloader = DataLoader( eval_dataset, collate_fn=default_data_collator, batch_size=args.per_device_eval_batch_size ) # Optimizer # Split weights in two groups, one with weight decay and the other not. no_decay = ["bias", "layer_norm.weight"] optimizer_grouped_parameters = [ { "params": [p for n, p in model.named_parameters() if not any(nd in n for nd in no_decay) and "lora" in n], "weight_decay": args.weight_decay, }, { "params": [p for n, p in model.named_parameters() if any(nd in n for nd in no_decay)], "weight_decay": 0.0, }, ] optimizer = torch.optim.AdamW(optimizer_grouped_parameters, lr=args.learning_rate) # Scheduler and math around the number of training steps. overrode_max_train_steps = False num_update_steps_per_epoch = math.ceil(len(train_dataloader) / args.gradient_accumulation_steps) if args.max_train_steps is None: args.max_train_steps = args.num_train_epochs * num_update_steps_per_epoch overrode_max_train_steps = True lr_scheduler = get_scheduler( name=args.lr_scheduler_type, optimizer=optimizer, num_warmup_steps=args.num_warmup_steps * args.gradient_accumulation_steps, num_training_steps=args.max_train_steps * args.gradient_accumulation_steps, ) # Prepare everything with our `accelerator`. model, optimizer, train_dataloader, eval_dataloader, lr_scheduler = accelerator.prepare( model, optimizer, train_dataloader, eval_dataloader, lr_scheduler ) # On TPU, the tie weights in our model have been disconnected, so we need to restore the ties. if accelerator.distributed_type == DistributedType.TPU: model.tie_weights() # We need to recalculate our total training steps as the size of the training dataloader may have changed. num_update_steps_per_epoch = math.ceil(len(train_dataloader) / args.gradient_accumulation_steps) if overrode_max_train_steps: args.max_train_steps = args.num_train_epochs * num_update_steps_per_epoch # Afterwards we recalculate our number of training epochs args.num_train_epochs = math.ceil(args.max_train_steps / num_update_steps_per_epoch) # Figure out how many steps we should save the Accelerator states checkpointing_steps = args.checkpointing_steps if checkpointing_steps is not None and checkpointing_steps.isdigit(): checkpointing_steps = int(checkpointing_steps) # We need to initialize the trackers we use, and also store our configuration. # The trackers initializes automatically on the main process. if args.with_tracking: experiment_config = vars(args) # TensorBoard cannot log Enums, need the raw value experiment_config["lr_scheduler_type"] = experiment_config["lr_scheduler_type"].value accelerator.init_trackers("clm_no_trainer", experiment_config) # Train! total_batch_size = args.per_device_train_batch_size * accelerator.num_processes * args.gradient_accumulation_steps logger.info("***** Running training *****") logger.info(f" Num examples = {len(train_dataset)}") logger.info(f" Num Epochs = {args.num_train_epochs}") logger.info(f" Instantaneous batch size per device = {args.per_device_train_batch_size}") logger.info(f" Total train batch size (w. parallel, distributed & accumulation) = {total_batch_size}") logger.info(f" Gradient Accumulation steps = {args.gradient_accumulation_steps}") logger.info(f" Total optimization steps = {args.max_train_steps}") # Only show the progress bar once on each machine. progress_bar = tqdm(range(args.max_train_steps), disable=not accelerator.is_local_main_process) completed_steps = 0 starting_epoch = 0 # Potentially load in the weights and states from a previous save if args.resume_from_checkpoint: if args.resume_from_checkpoint is not None or args.resume_from_checkpoint != "": checkpoint_path = args.resume_from_checkpoint path = os.path.basename(args.resume_from_checkpoint) else: # Get the most recent checkpoint dirs = [f.name for f in os.scandir(os.getcwd()) if f.is_dir()] dirs.sort(key=os.path.getctime) path = dirs[-1] # Sorts folders by date modified, most recent checkpoint is the last checkpoint_path = path path = os.path.basename(checkpoint_path) accelerator.print(f"Resumed from checkpoint: {checkpoint_path}") accelerator.load_state(path) # Extract `epoch_{i}` or `step_{i}` training_difference = os.path.splitext(path)[0] if "epoch" in training_difference: starting_epoch = int(training_difference.replace("epoch_", "")) + 1 resume_step = None completed_steps = starting_epoch * num_update_steps_per_epoch else: # need to multiply `gradient_accumulation_steps` to reflect real steps resume_step = int(training_difference.replace("step_", "")) * args.gradient_accumulation_steps starting_epoch = resume_step // len(train_dataloader) resume_step -= starting_epoch * len(train_dataloader) completed_steps = resume_step // args.gradient_accumulation_steps # update the progress_bar if load from checkpoint progress_bar.update(completed_steps) for epoch in range(starting_epoch, args.num_train_epochs): model.train() if args.with_tracking: total_loss = 0 if args.resume_from_checkpoint and epoch == starting_epoch and resume_step is not None: # We skip the first `n` batches in the dataloader when resuming from a checkpoint active_dataloader = accelerator.skip_first_batches(train_dataloader, resume_step) else: active_dataloader = train_dataloader for step, batch in enumerate(active_dataloader): with accelerator.accumulate(model): outputs = model(**batch) loss = outputs.loss # We keep track of the loss at each epoch if args.with_tracking: total_loss += loss.detach().float() accelerator.backward(loss) if completed_steps % 50: accelerator.print(f"Epoch: {epoch} | Step: {completed_steps} | Loss: {loss}") optimizer.step() lr_scheduler.step() optimizer.zero_grad() # Checks if the accelerator has performed an optimization step behind the scenes if accelerator.sync_gradients: progress_bar.update(1) completed_steps += 1 if isinstance(checkpointing_steps, int): if completed_steps % checkpointing_steps == 0: output_dir = f"step_{completed_steps}" if args.output_dir is not None: output_dir = os.path.join(args.output_dir, output_dir) accelerator.save_state(output_dir) if completed_steps >= args.max_train_steps: break model.eval() gen_kwargs = { "max_new_tokens": args.max_target_length, "temperature": args.temperature, "top_k": args.k, "top_p": args.p, "do_sample": True, } ans_pred_list = [] ans_gold_list = [] for step, batch in enumerate(eval_dataloader): with torch.no_grad(): gen_kwargs["input_ids"] = batch["input_ids"] gen_kwargs["attention_mask"] = batch["attention_mask"] generated_tokens = accelerator.unwrap_model(model).generate(**gen_kwargs) pred_tokens = generated_tokens[:, args.max_source_length :] pred_tokens = accelerator.pad_across_processes(pred_tokens, dim=1, pad_index=tokenizer.pad_token_id) gold_tokens = batch["labels"] if not args.pad_to_max_length: # If we did not pad to max length, we need to pad the labels too gold_tokens = accelerator.pad_across_processes( batch["labels"], dim=1, pad_index=tokenizer.pad_token_id ) pred_tokens, gold_tokens = accelerator.gather_for_metrics((pred_tokens, gold_tokens)) pred_tokens, gold_tokens = pred_tokens.cpu().numpy(), gold_tokens.cpu().numpy() if isinstance(pred_tokens, tuple): pred_tokens = pred_tokens[0] decoded_pred = tokenizer.batch_decode(pred_tokens, skip_special_tokens=True) decoded_gold = tokenizer.batch_decode(gold_tokens, skip_special_tokens=True) # Extract the numbers in sentences accelerator.print(decoded_pred) ans_pred_list += [extract_answer_number(sentence_pred) for sentence_pred in decoded_pred] ans_gold_list += [extract_answer_number(sentence_gold) for sentence_gold in decoded_gold] accelerator.print(ans_pred_list) accelerator.print(ans_gold_list) accuracy = compute_accuracy(ans_gold_list, ans_pred_list) logger.info(f"epoch {epoch}: accuracy: {accuracy}") if args.with_tracking: accelerator.log( { "accuracy": accuracy, "train_loss": total_loss.item() / len(train_dataloader), "epoch": epoch, "step": completed_steps, }, step=completed_steps, ) if args.push_to_hub and epoch < args.num_train_epochs - 1: accelerator.wait_for_everyone() unwrapped_model = accelerator.unwrap_model(model) unwrapped_model.save_pretrained( args.output_dir, is_main_process=accelerator.is_main_process, save_function=accelerator.save ) if accelerator.is_main_process: tokenizer.save_pretrained(args.output_dir) repo.push_to_hub( commit_message=f"Training in progress epoch {epoch}", blocking=False, auto_lfs_prune=True ) if args.checkpointing_steps == "epoch": output_dir = f"epoch_{epoch}" if args.output_dir is not None: output_dir = os.path.join(args.output_dir, output_dir) accelerator.save_state(output_dir) if args.with_tracking: accelerator.end_training() if args.output_dir is not None: accelerator.wait_for_everyone() unwrapped_model = accelerator.unwrap_model(model) unwrapped_model.save_pretrained( args.output_dir, is_main_process=accelerator.is_main_process, save_function=accelerator.save ) if accelerator.is_main_process: tokenizer.save_pretrained(args.output_dir) if args.push_to_hub: repo.push_to_hub(commit_message="End of training", auto_lfs_prune=True) PATTERN_NUMBER = re.compile(r"-?\d+\.?\d*") def extract_answer_number(sentence: str) -> float: sentence = sentence.replace(",", "") pred = PATTERN_NUMBER.findall(sentence) if not pred: return float("inf") segment = sentence.split("The final answer is ") if len(segment) > 1: pred_answer = segment[1] pred_answer = PATTERN_NUMBER.findall(pred_answer) if len(pred_answer) > 0: pred_answer = pred_answer[0] else: pred_answer = float(pred[-1]) else: pred_answer = float(pred[-1]) if isinstance(pred_answer, str): try: pred_answer = float(pred_answer) except ValueError: pred_answer = float("inf") return pred_answer def compute_accuracy(pred: list, gold: list): acc = 0.0 for p, g in zip(pred, gold): if p == g: acc += 1 return acc / len(pred) if __name__ == "__main__": main()
peft/examples/loftq_finetuning/train_gsm8k_llama.py/0
{ "file_path": "peft/examples/loftq_finetuning/train_gsm8k_llama.py", "repo_id": "peft", "token_count": 14574 }
171
<jupyter_start><jupyter_text>IntroductionIn this notebook, we will learn how to use [LoRA](https://arxiv.org/abs/2106.09685) from 🤗 PEFT to fine-tune a SegFormer model variant for semantic segmentation by ONLY using **14%** of the original trainable parameters of the model. LoRA adds low-rank "update matrices" to certain blocks in the underlying model (in this case the attention blocks) and ONLY trains those matrices during fine-tuning. During inference, these update matrices are _merged_ with the original model parameters. For more details, check out the [original LoRA paper](https://arxiv.org/abs/2106.09685). Let's get started by installing the dependencies. Install dependenciesHere we're installing `peft` from source to ensure we have access to all the bleeding edge features of `peft`.<jupyter_code>!pip install transformers accelerate evaluate datasets git+https://github.com/huggingface/peft -q<jupyter_output><empty_output><jupyter_text>AuthenticationWe will share our fine-tuned model at the end of training. So, to do that we just authenticate using our 🤗 token. This token is available from [here](https://huggingface.co/settings/tokens). If you don't have a 🤗 account already, we highly encourage you to do so; it's free!<jupyter_code>from huggingface_hub import notebook_login notebook_login()<jupyter_output><empty_output><jupyter_text>Load a datasetWe're only loading the first 150 instances from the training set of the [SceneParse150 dataset](https://huggingface.co/datasets/scene_parse_150) to keep this example runtime short.<jupyter_code>from datasets import load_dataset ds = load_dataset("scene_parse_150", split="train[:150]")<jupyter_output><empty_output><jupyter_text>Prepare train and test splits<jupyter_code>ds = ds.train_test_split(test_size=0.1) train_ds = ds["train"] test_ds = ds["test"]<jupyter_output><empty_output><jupyter_text>Prepare label mappersWe create two dictionaries:* `label2id`: maps the semantic classes of the dataset to integer ids.* `id2label`: `label2id` reversed.<jupyter_code>import json from huggingface_hub import cached_download, hf_hub_url repo_id = "huggingface/label-files" filename = "ade20k-id2label.json" id2label = json.load(open(cached_download(hf_hub_url(repo_id, filename, repo_type="dataset")), "r")) id2label = {int(k): v for k, v in id2label.items()} label2id = {v: k for k, v in id2label.items()} num_labels = len(id2label)<jupyter_output><empty_output><jupyter_text>Prepare datasets for training and evaluation<jupyter_code>from transformers import AutoImageProcessor checkpoint = "nvidia/mit-b0" image_processor = AutoImageProcessor.from_pretrained(checkpoint, do_reduce_labels=True) from torchvision.transforms import ColorJitter jitter = ColorJitter(brightness=0.25, contrast=0.25, saturation=0.25, hue=0.1) from PIL import Image import numpy as np def handle_grayscale_image(image): np_image = np.array(image) if np_image.ndim == 2: tiled_image = np.tile(np.expand_dims(np_image, -1), 3) return Image.fromarray(tiled_image) else: return Image.fromarray(np_image) def train_transforms(example_batch): images = [jitter(handle_grayscale_image(x)) for x in example_batch["image"]] labels = [x for x in example_batch["annotation"]] inputs = image_processor(images, labels) return inputs def val_transforms(example_batch): images = [handle_grayscale_image(x) for x in example_batch["image"]] labels = [x for x in example_batch["annotation"]] inputs = image_processor(images, labels) return inputs train_ds.set_transform(train_transforms) test_ds.set_transform(val_transforms)<jupyter_output><empty_output><jupyter_text>Evaluation functionIncluding a metric during training is often helpful for evaluating your model’s performance. You can quickly load a evaluation method with the [🤗 Evaluate](https://huggingface.co/docs/evaluate/index) library. For this task, load the [mean Intersection over Union (IoU)](https://huggingface.co/spaces/evaluate-metric/accuracy) metric (see the 🤗 Evaluate [quick tour](https://huggingface.co/docs/evaluate/a_quick_tour) to learn more about how to load and compute a metric):<jupyter_code>import torch from torch import nn import evaluate metric = evaluate.load("mean_iou") def compute_metrics(eval_pred): with torch.no_grad(): logits, labels = eval_pred logits_tensor = torch.from_numpy(logits) # scale the logits to the size of the label logits_tensor = nn.functional.interpolate( logits_tensor, size=labels.shape[-2:], mode="bilinear", align_corners=False, ).argmax(dim=1) pred_labels = logits_tensor.detach().cpu().numpy() # currently using _compute instead of compute # see this issue for more info: https://github.com/huggingface/evaluate/pull/328#issuecomment-1286866576 metrics = metric._compute( predictions=pred_labels, references=labels, num_labels=len(id2label), ignore_index=0, reduce_labels=image_processor.do_reduce_labels, ) # add per category metrics as individual key-value pairs per_category_accuracy = metrics.pop("per_category_accuracy").tolist() per_category_iou = metrics.pop("per_category_iou").tolist() metrics.update({f"accuracy_{id2label[i]}": v for i, v in enumerate(per_category_accuracy)}) metrics.update({f"iou_{id2label[i]}": v for i, v in enumerate(per_category_iou)}) return metrics<jupyter_output><empty_output><jupyter_text>Load a base modelFor this example, we use the [SegFormer B0 variant](https://huggingface.co/nvidia/mit-b0).<jupyter_code>def print_trainable_parameters(model): """ Prints the number of trainable parameters in the model. """ trainable_params = 0 all_param = 0 for _, param in model.named_parameters(): all_param += param.numel() if param.requires_grad: trainable_params += param.numel() print( f"trainable params: {trainable_params} || all params: {all_param} || trainable%: {100 * trainable_params / all_param:.2f}" )<jupyter_output><empty_output><jupyter_text>We pass the `label2id` and `id2label` dictionaries to let the `AutoModelForSemanticSegmentation` class know that we're interested in a custom base model where the decoder head should be randomly initialized w.r.t our custom dataset. Note, however, that the rest of the model parameters are pre-trained and will be fine-tuned in a regular transfer learning setup.We also notice that the 100% parameters in the `model` are trainable.<jupyter_code>from transformers import AutoModelForSemanticSegmentation, TrainingArguments, Trainer model = AutoModelForSemanticSegmentation.from_pretrained( checkpoint, id2label=id2label, label2id=label2id, ignore_mismatched_sizes=True ) print_trainable_parameters(model)<jupyter_output><empty_output><jupyter_text>Wrap `model` as a `PeftModel` for LoRA trainingThis involves two steps:* Defining a config with `LoraConfig`* Wrapping the original `model` with `get_peft_model()` with the config defined in the step above.<jupyter_code>from peft import LoraConfig, get_peft_model config = LoraConfig( r=32, lora_alpha=32, target_modules=["query", "value"], lora_dropout=0.1, bias="lora_only", modules_to_save=["decode_head"], ) lora_model = get_peft_model(model, config) print_trainable_parameters(lora_model)<jupyter_output>===================================BUG REPORT=================================== Welcome to bitsandbytes. For bug reports, please submit your error trace to: https://github.com/TimDettmers/bitsandbytes/issues ================================================================================ trainable params: 564374 || all params: 3883766 || trainable%: 14.53<jupyter_text>Let's unpack what's going on here. In order for LoRA to take effect, we need to specify the target modules to `LoraConfig` so that `PeftModel` knows which modules inside our model needs to be amended with LoRA matrices. In this case, we're only interested in targetting the query and value matrices of the attention blocks of the base model. Since the parameters corresponding to these matrices are "named" with `query` and `value` respectively, we specify them accordingly in the `target_modules` argument of `LoraConfig`. We also specify `modules_to_save`. After we wrap our base model `model` with `PeftModel` along with the `config`, we get a new model where only the LoRA parameters are trainable (so-called "update matrices") while the pre-trained parameters are kept frozen. These include the parameters of the randomly initialized classifier parameters too. This is NOT we want when fine-tuning the base model on our custom dataset. To ensure that the classifier parameters are also trained, we specify `modules_to_save`. This also ensures that these modules are serialized alongside the LoRA trainable parameters when using utilities like `save_pretrained()` and `push_to_hub()`. Regarding the other parameters:* `r`: The dimension used by the LoRA update matrices.* `alpha`: Scaling factor.* `bias`: Specifying if the `bias` parameters should be trained. `lora_only` denotes only the LoRA `bias` parameters will be trained. `r` and `alpha` together control the total number of final trainable parameters when using LoRA giving us the flexbility to balance a trade-off between end performance and compute efficiency. We can also how many parameters we're actually training. Since we're interested in performing **parameter-efficient fine-tuning**, we should expect to notice a less number of trainable parameters from the `lora_model` in comparison to the original `model` which is indeed the case here. For sanity, let's also manually verify the modules that are actually trainable in `lora_model`.<jupyter_code>for name, param in lora_model.named_parameters(): if param.requires_grad: print(name, param.shape)<jupyter_output>base_model.model.segformer.encoder.block.0.0.attention.self.query.lora_A.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.0.0.attention.self.query.lora_B.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.0.0.attention.self.value.lora_A.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.0.0.attention.self.value.lora_B.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.0.1.attention.self.query.lora_A.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.0.1.attention.self.query.lora_B.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.0.1.attention.self.value.lora_A.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.0.1.attention.self.value.lora_B.weight torch.Size([32, 32]) base_model.model.segformer.encoder.block.1.0.attention.self.query.lora_A.weight torch.Size([32, 64]) base_model.model.segformer.encoder.block.1.0.attention.self.query.lora_B.weight torch.Size([...]<jupyter_text>We can confirm that only the LoRA parameters appended to the attention blocks and the `decode_head` parameters are trainable. Train!This is a two-step process: 1. Define your training hyperparameters in [TrainingArguments](https://huggingface.co/docs/transformers/v4.26.0/en/main_classes/trainertransformers.TrainingArguments). It is important you don’t remove unused columns because this’ll drop the image column. Without the image column, you can’t create `pixel_values`. Set `remove_unused_columns=False` to prevent this behavior! The only other required parameter is output_dir which specifies where to save your model. At the end of each epoch, the `Trainer` will evaluate the IoU metric and save the training checkpoint.2. Pass the training arguments to [Trainer](https://huggingface.co/docs/transformers/v4.26.0/en/main_classes/trainertransformers.Trainer) along with the model, dataset, tokenizer, data collator, and `compute_metrics` function.3. Call `train()` to finetune your model.**Note** that This example is meant to walk you through the workflow when using PEFT for semantic segmentation. We didn't perform extensive hyperparameter tuning to achieve optimal results.<jupyter_code>model_name = checkpoint.split("/")[-1] training_args = TrainingArguments( output_dir=f"{model_name}-scene-parse-150-lora", learning_rate=5e-4, num_train_epochs=50, per_device_train_batch_size=4, per_device_eval_batch_size=2, save_total_limit=3, evaluation_strategy="epoch", save_strategy="epoch", logging_steps=5, remove_unused_columns=False, push_to_hub=True, label_names=["labels"], ) trainer = Trainer( model=lora_model, args=training_args, train_dataset=train_ds, eval_dataset=test_ds, compute_metrics=compute_metrics, ) trainer.train()<jupyter_output><empty_output><jupyter_text>Saving the model and inference Here we use the `save_pretrained()` method of the `lora_model` to save the *LoRA-only parameters* locally. However, you can also use thr `push_to_hub()` method to upload these parameters directly to the Hugging Face Hub (as shown [here](https://colab.research.google.com/github/huggingface/peft/blob/main/examples/image_classification/image_classification_peft_lora.ipynb)).<jupyter_code>model_id = "segformer-scene-parse-150-lora" lora_model.save_pretrained(model_id)<jupyter_output><empty_output><jupyter_text>We can see that the LoRA-only parameters are just **2.2 MB in size**! This greatly improves the portability when using very large models.<jupyter_code>!ls -lh {model_id}<jupyter_output>total 2.2M -rw-r--r-- 1 root root 369 Feb 8 03:09 adapter_config.json -rw-r--r-- 1 root root 2.2M Feb 8 03:09 adapter_model.bin<jupyter_text>Let's now prepare our `inference_model` and run an inference.<jupyter_code>from peft import PeftConfig config = PeftConfig.from_pretrained(model_id) model = AutoModelForSemanticSegmentation.from_pretrained( checkpoint, id2label=id2label, label2id=label2id, ignore_mismatched_sizes=True ) # Load the Lora model inference_model = PeftModel.from_pretrained(model, model_id)<jupyter_output><empty_output><jupyter_text>Fetch an image.<jupyter_code>import requests url = "https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/semantic-seg-image.png" image = Image.open(requests.get(url, stream=True).raw) image<jupyter_output><empty_output><jupyter_text>Preprocess the image.<jupyter_code># prepare image for the model encoding = image_processor(image.convert("RGB"), return_tensors="pt") print(encoding.pixel_values.shape)<jupyter_output>torch.Size([1, 3, 512, 512])<jupyter_text>Run an inference.<jupyter_code>with torch.no_grad(): outputs = inference_model(pixel_values=encoding.pixel_values) logits = outputs.logits upsampled_logits = nn.functional.interpolate( logits, size=image.size[::-1], mode="bilinear", align_corners=False, ) pred_seg = upsampled_logits.argmax(dim=1)[0]<jupyter_output><empty_output><jupyter_text>Visualize the results.We need a color palette to visualize the results. Here, we use [one provided by the TensorFlow Model Garden repository](https://github.com/tensorflow/models/blob/3f1ca33afe3c1631b733ea7e40c294273b9e406d/research/deeplab/utils/get_dataset_colormap.pyL51).<jupyter_code>def ade_palette(): """Creates a label colormap used in ADE20K segmentation benchmark. Returns: A colormap for visualizing segmentation results. """ return np.asarray( [ [0, 0, 0], [120, 120, 120], [180, 120, 120], [6, 230, 230], [80, 50, 50], [4, 200, 3], [120, 120, 80], [140, 140, 140], [204, 5, 255], [230, 230, 230], [4, 250, 7], [224, 5, 255], [235, 255, 7], [150, 5, 61], [120, 120, 70], [8, 255, 51], [255, 6, 82], [143, 255, 140], [204, 255, 4], [255, 51, 7], [204, 70, 3], [0, 102, 200], [61, 230, 250], [255, 6, 51], [11, 102, 255], [255, 7, 71], [255, 9, 224], [9, 7, 230], [220, 220, 220], [255, 9, 92], [112, 9, 255], [8, 255, 214], [7, 255, 224], [255, 184, 6], [10, 255, 71], [255, 41, 10], [7, 255, 255], [224, 255, 8], [102, 8, 255], [255, 61, 6], [255, 194, 7], [255, 122, 8], [0, 255, 20], [255, 8, 41], [255, 5, 153], [6, 51, 255], [235, 12, 255], [160, 150, 20], [0, 163, 255], [140, 140, 140], [250, 10, 15], [20, 255, 0], [31, 255, 0], [255, 31, 0], [255, 224, 0], [153, 255, 0], [0, 0, 255], [255, 71, 0], [0, 235, 255], [0, 173, 255], [31, 0, 255], [11, 200, 200], [255, 82, 0], [0, 255, 245], [0, 61, 255], [0, 255, 112], [0, 255, 133], [255, 0, 0], [255, 163, 0], [255, 102, 0], [194, 255, 0], [0, 143, 255], [51, 255, 0], [0, 82, 255], [0, 255, 41], [0, 255, 173], [10, 0, 255], [173, 255, 0], [0, 255, 153], [255, 92, 0], [255, 0, 255], [255, 0, 245], [255, 0, 102], [255, 173, 0], [255, 0, 20], [255, 184, 184], [0, 31, 255], [0, 255, 61], [0, 71, 255], [255, 0, 204], [0, 255, 194], [0, 255, 82], [0, 10, 255], [0, 112, 255], [51, 0, 255], [0, 194, 255], [0, 122, 255], [0, 255, 163], [255, 153, 0], [0, 255, 10], [255, 112, 0], [143, 255, 0], [82, 0, 255], [163, 255, 0], [255, 235, 0], [8, 184, 170], [133, 0, 255], [0, 255, 92], [184, 0, 255], [255, 0, 31], [0, 184, 255], [0, 214, 255], [255, 0, 112], [92, 255, 0], [0, 224, 255], [112, 224, 255], [70, 184, 160], [163, 0, 255], [153, 0, 255], [71, 255, 0], [255, 0, 163], [255, 204, 0], [255, 0, 143], [0, 255, 235], [133, 255, 0], [255, 0, 235], [245, 0, 255], [255, 0, 122], [255, 245, 0], [10, 190, 212], [214, 255, 0], [0, 204, 255], [20, 0, 255], [255, 255, 0], [0, 153, 255], [0, 41, 255], [0, 255, 204], [41, 0, 255], [41, 255, 0], [173, 0, 255], [0, 245, 255], [71, 0, 255], [122, 0, 255], [0, 255, 184], [0, 92, 255], [184, 255, 0], [0, 133, 255], [255, 214, 0], [25, 194, 194], [102, 255, 0], [92, 0, 255], ] ) import matplotlib.pyplot as plt color_seg = np.zeros((pred_seg.shape[0], pred_seg.shape[1], 3), dtype=np.uint8) palette = np.array(ade_palette()) for label, color in enumerate(palette): color_seg[pred_seg == label, :] = color color_seg = color_seg[..., ::-1] # convert to BGR img = np.array(image) * 0.5 + color_seg * 0.5 # plot the image with the segmentation map img = img.astype(np.uint8) plt.figure(figsize=(15, 10)) plt.imshow(img) plt.show()<jupyter_output><empty_output>
peft/examples/semantic_segmentation/semantic_segmentation_peft_lora.ipynb/0
{ "file_path": "peft/examples/semantic_segmentation/semantic_segmentation_peft_lora.ipynb", "repo_id": "peft", "token_count": 8322 }
172
accelerate launch --config_file "configs/deepspeed_config.yaml" train.py \ --seed 100 \ --model_name_or_path "meta-llama/Llama-2-70b-hf" \ --dataset_name "smangrul/ultrachat-10k-chatml" \ --chat_template_format "chatml" \ --add_special_tokens False \ --append_concat_token False \ --splits "train,test" \ --max_seq_len 2048 \ --num_train_epochs 1 \ --logging_steps 5 \ --log_level "info" \ --logging_strategy "steps" \ --evaluation_strategy "epoch" \ --save_strategy "epoch" \ --push_to_hub \ --hub_private_repo True \ --hub_strategy "every_save" \ --bf16 True \ --packing True \ --learning_rate 1e-4 \ --lr_scheduler_type "cosine" \ --weight_decay 1e-4 \ --warmup_ratio 0.0 \ --max_grad_norm 1.0 \ --output_dir "mistral-sft-lora-deepspeed" \ --per_device_train_batch_size 8 \ --per_device_eval_batch_size 8 \ --gradient_accumulation_steps 4 \ --gradient_checkpointing True \ --use_reentrant False \ --dataset_text_field "content" \ --use_flash_attn True \ --use_peft_lora True \ --lora_r 8 \ --lora_alpha 16 \ --lora_dropout 0.1 \ --lora_target_modules "all-linear" \ --use_4bit_quantization False
peft/examples/sft/run_peft_deepspeed.sh/0
{ "file_path": "peft/examples/sft/run_peft_deepspeed.sh", "repo_id": "peft", "token_count": 454 }
173
# Copyright 2023-present the HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import warnings from typing import Any, List, Optional import torch from torch import nn from peft.tuners.lora import LoraLayer from peft.tuners.tuners_utils import check_adapters_to_merge from peft.utils import transpose class AdaLoraLayer(LoraLayer): # List all names of layers that may contain adapter weights # Note: ranknum doesn't need to be included as it is not an nn.Module adapter_layer_names = ("lora_A", "lora_B", "lora_E", "lora_embedding_A", "lora_embedding_B") # other_param_names is defined in LoraLayer def __init__(self, base_layer: nn.Module) -> None: super().__init__(base_layer) self.lora_E = nn.ParameterDict({}) self.lora_A = nn.ParameterDict({}) self.lora_B = nn.ParameterDict({}) self.ranknum = nn.ParameterDict({}) def update_layer(self, adapter_name, r, lora_alpha, lora_dropout, init_lora_weights): if r < 0: # note: r == 0 is allowed for AdaLora, see #1539 raise ValueError(f"`r` should be a positive integer or 0, but the value passed is {r}") self.r[adapter_name] = r self.lora_alpha[adapter_name] = lora_alpha if lora_dropout > 0.0: lora_dropout_layer = nn.Dropout(p=lora_dropout) else: lora_dropout_layer = nn.Identity() self.lora_dropout[adapter_name] = lora_dropout_layer # Actual trainable parameters # Right singular vectors self.lora_A[adapter_name] = nn.Parameter(torch.randn(r, self.in_features)) # Singular values self.lora_E[adapter_name] = nn.Parameter(torch.randn(r, 1)) # Left singular vectors self.lora_B[adapter_name] = nn.Parameter(torch.randn(self.out_features, r)) # The current rank self.ranknum[adapter_name] = nn.Parameter(torch.randn(1), requires_grad=False) self.ranknum[adapter_name].data.fill_(float(r)) self.ranknum[adapter_name].requires_grad = False self.scaling[adapter_name] = lora_alpha if lora_alpha > 0 else float(r) if init_lora_weights: self.reset_lora_parameters(adapter_name) if hasattr(self.get_base_layer(), "qweight"): # QuantLinear self.to(self.get_base_layer().qweight.device) else: self.to(self.get_base_layer().weight.device) self.set_adapter(self.active_adapters) def reset_lora_parameters(self, adapter_name): if adapter_name in self.lora_A.keys(): nn.init.normal_(self.lora_E[adapter_name], mean=0.0, std=0.02) nn.init.normal_(self.lora_A[adapter_name], mean=0.0, std=0.02) nn.init.normal_(self.lora_B[adapter_name], mean=0.0, std=0.02) class SVDLinear(nn.Module, AdaLoraLayer): # SVD-based adaptation by a dense layer def __init__( self, base_layer: nn.Module, adapter_name: str, r: int = 0, lora_alpha: int = 1, lora_dropout: float = 0.0, fan_in_fan_out: bool = False, init_lora_weights: bool = True, **kwargs, ) -> None: super().__init__() AdaLoraLayer.__init__(self, base_layer) # Freezing the pre-trained weight matrix self.get_base_layer().weight.requires_grad = False self.fan_in_fan_out = fan_in_fan_out self._active_adapter = adapter_name self.update_layer(adapter_name, r, lora_alpha, lora_dropout, init_lora_weights) def merge(self, safe_merge: bool = False, adapter_names: Optional[List[str]] = None) -> None: """ Merge the active adapter weights into the base weights Args: safe_merge (`bool`, *optional*): If True, the merge operation will be performed in a copy of the original weights and check for NaNs before merging the weights. This is useful if you want to check if the merge operation will produce NaNs. Defaults to `False`. adapter_names (`List[str]`, *optional*): The list of adapter names that should be merged. If None, all active adapters will be merged. Defaults to `None`. """ adapter_names = check_adapters_to_merge(self, adapter_names) if not adapter_names: # no adapter to merge return for active_adapter in adapter_names: base_layer = self.get_base_layer() if active_adapter in self.lora_A.keys(): if safe_merge: # Note that safe_merge will be slower than the normal merge # because of the copy operation. orig_weights = base_layer.weight.data.clone() orig_weights += self.get_delta_weight(active_adapter) if not torch.isfinite(orig_weights).all(): raise ValueError( f"NaNs detected in the merged weights. The adapter {active_adapter} seems to be broken" ) base_layer.weight.data = orig_weights else: base_layer.weight.data += self.get_delta_weight(active_adapter) self.merged_adapters.append(active_adapter) def unmerge(self) -> None: """ This method unmerges all merged adapter layers from the base weights. """ if not self.merged: warnings.warn("Already unmerged. Nothing to do.") return while len(self.merged_adapters) > 0: active_adapter = self.merged_adapters.pop() if active_adapter in self.lora_A.keys(): self.get_base_layer().weight.data -= self.get_delta_weight(active_adapter) def get_delta_weight(self, adapter) -> torch.Tensor: return ( transpose(self.lora_B[adapter] @ (self.lora_A[adapter] * self.lora_E[adapter]), self.fan_in_fan_out) * self.scaling[adapter] / (self.ranknum[adapter] + 1e-5) ) def forward(self, x: torch.Tensor, *args: Any, **kwargs: Any) -> torch.Tensor: if self.disable_adapters: if self.merged: self.unmerge() result = self.base_layer(x, *args, **kwargs) elif self.merged: result = self.base_layer(x, *args, **kwargs) else: result = self.base_layer(x, *args, **kwargs) for active_adapter in self.active_adapters: if active_adapter not in self.lora_A.keys(): continue lora_A = self.lora_A[active_adapter] lora_B = self.lora_B[active_adapter] lora_E = self.lora_E[active_adapter] dropout = self.lora_dropout[active_adapter] scaling = self.scaling[active_adapter] ranknum = self.ranknum[active_adapter] + 1e-5 x = x.to(lora_A.dtype) result += (dropout(x) @ (lora_A * lora_E).T @ lora_B.T) * scaling / ranknum return result def __repr__(self) -> str: rep = super().__repr__() return "adalora." + rep class RankAllocator: """ The RankAllocator for AdaLoraModel. Paper: https://openreview.net/pdf?id=lq62uWRJjiY Args: config ([`AdaLoraConfig`]): The configuration of the AdaLora model. model: the model that we apply AdaLoRA to. """ def __init__(self, model, peft_config, adapter_name): self.peft_config = peft_config self.adapter_name = adapter_name self.beta1 = peft_config.beta1 self.beta2 = peft_config.beta2 assert self.beta1 > 0 and self.beta1 < 1 assert self.beta2 > 0 and self.beta2 < 1 self.reset_ipt() self._set_budget_scheduler(model) def set_total_step(self, total_step): self.peft_config.total_step = total_step def reset_ipt(self): self.ipt = {} self.exp_avg_ipt = {} self.exp_avg_unc = {} def _set_budget_scheduler(self, model): self.init_bgt = 0 self.name_set = set() for n, p in model.named_parameters(): if f"lora_A.{self.adapter_name}" in n: self.init_bgt += p.size(0) self.name_set.add(n.replace("lora_A", "%s")) self.name_set = sorted(self.name_set) # The total final rank budget self.target_bgt = self.peft_config.target_r * len(self.name_set) def budget_schedule(self, step: int): tinit = self.peft_config.tinit tfinal = self.peft_config.tfinal total_step = self.peft_config.total_step # Initial warmup if step <= tinit: budget = self.init_bgt mask_ind = False # Final fine-tuning elif step > total_step - tfinal: budget = self.target_bgt mask_ind = True else: # Budget decreasing with a cubic scheduler mul_coeff = 1 - (step - tinit) / (total_step - tfinal - tinit) budget = int((self.init_bgt - self.target_bgt) * (mul_coeff**3) + self.target_bgt) mask_ind = True if step % self.peft_config.deltaT == 0 else False return budget, mask_ind def update_ipt(self, model): # Update the sensitivity and uncertainty for every weight for n, p in model.named_parameters(): if "lora_" in n and self.adapter_name in n: if n not in self.ipt: self.ipt[n] = torch.zeros_like(p) self.exp_avg_ipt[n] = torch.zeros_like(p) self.exp_avg_unc[n] = torch.zeros_like(p) with torch.no_grad(): self.ipt[n] = (p * p.grad).abs().detach() # Sensitivity smoothing self.exp_avg_ipt[n] = self.beta1 * self.exp_avg_ipt[n] + (1 - self.beta1) * self.ipt[n] # Uncertainty quantification self.exp_avg_unc[n] = ( self.beta2 * self.exp_avg_unc[n] + (1 - self.beta2) * (self.ipt[n] - self.exp_avg_ipt[n]).abs() ) def _element_score(self, n): return self.exp_avg_ipt[n] * self.exp_avg_unc[n] def _combine_ipt(self, ipt_E, ipt_AB): ipt_AB = ipt_AB.sum(dim=1, keepdim=False) sum_ipt = ipt_E.view(-1) + ipt_AB.view(-1) return sum_ipt def mask_to_budget(self, model, budget): value_ipt = {} vector_ipt = {} triplet_ipt = {} # Get the importance score for A, E, B for n, p in model.named_parameters(): if f"lora_A.{self.adapter_name}" in n: entry_ipt = self._element_score(n) comb_ipt = torch.mean(entry_ipt, dim=1, keepdim=True) name_m = n.replace("lora_A", "%s") if name_m not in vector_ipt: vector_ipt[name_m] = [comb_ipt] else: vector_ipt[name_m].append(comb_ipt) if f"lora_B.{self.adapter_name}" in n: entry_ipt = self._element_score(n) comb_ipt = torch.mean(entry_ipt, dim=0, keepdim=False).view(-1, 1) name_m = n.replace("lora_B", "%s") if name_m not in vector_ipt: vector_ipt[name_m] = [comb_ipt] else: vector_ipt[name_m].append(comb_ipt) if f"lora_E.{self.adapter_name}" in n: entry_ipt = self._element_score(n) name_m = n.replace("lora_E", "%s") value_ipt[name_m] = entry_ipt all_score = [] # Calculate the score for each triplet for name_m in vector_ipt: ipt_E = value_ipt[name_m] ipt_AB = torch.cat(vector_ipt[name_m], dim=1) sum_ipt = self._combine_ipt(ipt_E, ipt_AB) name_E = name_m % "lora_E" triplet_ipt[name_E] = sum_ipt.view(-1, 1) all_score.append(sum_ipt.view(-1)) # Get the threshold by ranking ipt mask_threshold = torch.kthvalue( torch.cat(all_score), k=self.init_bgt - budget, )[0].item() rank_pattern = {} # Mask the unimportant triplets with torch.no_grad(): for n, p in model.named_parameters(): if f"lora_E.{self.adapter_name}" in n: p.masked_fill_(triplet_ipt[n] <= mask_threshold, 0.0) rank_pattern[n] = (~(triplet_ipt[n] <= mask_threshold)).view(-1).tolist() return rank_pattern def update_and_allocate(self, model, global_step, force_mask=False): # # Update the importance score and allocate the budget if global_step < self.peft_config.total_step - self.peft_config.tfinal: self.update_ipt(model) budget, mask_ind = self.budget_schedule(global_step) # Allocate the budget according to importance scores if mask_ind or force_mask: rank_pattern = self.mask_to_budget(model, budget) else: rank_pattern = None return budget, rank_pattern def mask_using_rank_pattern(self, model, rank_pattern): # Mask the unimportant triplets is_adapter_name_truncated = False if self.adapter_name not in next(iter(rank_pattern.keys())): is_adapter_name_truncated = True with torch.no_grad(): for n, p in model.named_parameters(): if f"lora_E.{self.adapter_name}" in n: key = n if not is_adapter_name_truncated else n.replace(f".{self.adapter_name}", "") mask = torch.Tensor(rank_pattern[key]).unsqueeze(-1).to(p.device) p.masked_fill_(~mask.bool(), 0.0)
peft/src/peft/tuners/adalora/layer.py/0
{ "file_path": "peft/src/peft/tuners/adalora/layer.py", "repo_id": "peft", "token_count": 6986 }
174
# Copyright 2023-present the HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from dataclasses import dataclass, field from peft.config import PromptLearningConfig from peft.utils import PeftType @dataclass class PrefixTuningConfig(PromptLearningConfig): """ This is the configuration class to store the configuration of a [`PrefixEncoder`]. Args: encoder_hidden_size (`int`): The hidden size of the prompt encoder. prefix_projection (`bool`): Whether to project the prefix embeddings. """ encoder_hidden_size: int = field( default=None, metadata={"help": "The hidden size of the encoder"}, ) prefix_projection: bool = field( default=False, metadata={"help": "Whether to project the prefix tokens"}, ) def __post_init__(self): self.peft_type = PeftType.PREFIX_TUNING
peft/src/peft/tuners/prefix_tuning/config.py/0
{ "file_path": "peft/src/peft/tuners/prefix_tuning/config.py", "repo_id": "peft", "token_count": 447 }
175
# Copyright 2023-present the HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # Regression testing: check that checkpoints from previous PEFT versions still return the same values. # # For normal regression testing, just run: # # `pytest tests/regression/test_regression.py -s --regression` # # Add `-s` to show potentially useful debugging information. `--regression` is a custom marker that is required for # regression tests not to be skipped. # # To create new regression tests, run: # `HF_TOKEN=<token> REGRESSION_CREATION_MODE=True pytest tests/regression/test_regression.py -s --regression` # # This will *fail* if: # # 1. the git worktree is dirty # 2. the git commit is not tagged # # Note: A Hugging Face Hub token is required to upload the regression artifacts to our # https://huggingface.co/peft-internal-testing repo. This can be done by anyone with write access to the repo but # apparently it is not possible to create a technical token with write access. # # This is important to ensure that the regression artifacts correspond to a specific released version of PEFT. # Therefore, it is recommended to checkout the tag before running the regression tests, e.g. by running: # # `git checkout v0.1.0` # # To override these checks, run: # ``HF_TOKEN=<token> REGRESSION_CREATION_MODE=True REGRESSION_FORCE_MODE=True pytest tests/regression/test_regression.py -s --regression` # # In REGRESSION_CREATION_MODE, one directory will be created in tests/regression/<TEST_NAME>/<PEFT_VERSION>/ for each # test. This will contain the saved adapter, as well as the output of the test of the model for that version. # # In normal testing mode, the saved adapter and output for each version found in the directory # tests/regression/<TEST_NAME>/ will be loaded and compared to the current output. # # When implementing new tests, check the existing ones as well as the description in the docstring of RegressionTester. import os import shutil import subprocess import sys import tempfile import unittest import pytest import torch from huggingface_hub import snapshot_download, upload_folder from torch import nn from transformers import AutoModelForCausalLM, BitsAndBytesConfig from transformers.pytorch_utils import Conv1D import peft from peft import AdaLoraConfig, IA3Config, LoHaConfig, LoKrConfig, LoraConfig, PeftModel, get_peft_model from peft.utils import infer_device PEFT_VERSION = peft.__version__ REGRESSION_DIR = tempfile.mkdtemp(prefix="peft_regression_") HF_TOKEN = os.environ.get("HF_TOKEN") # the repo has to be created manually once, it is not automatically created HF_REPO = "peft-internal-testing/regression-tests" @pytest.fixture(scope="session", autouse=True) def setup_tearndown(): # Use a pytest session-scoped fixture to setup and teardown exactly once per session. AFAICT, unittest does not # provide such a feature # download regression artifacts from Hugging Face Hub at the start snapshot_download( repo_id=HF_REPO, local_dir=REGRESSION_DIR, # Don't use symlink, because this prevents us from properly cleaning up the files once finished local_dir_use_symlinks=False, ) yield # delete regression artifacts at the end of the test session; optionally, upload them first if in creation mode creation_mode = strtobool(os.environ.get("REGRESSION_CREATION_MODE", "False")) if creation_mode: # upload the regression directory to Hugging Face Hub, will overwrite by default upload_folder( repo_id=HF_REPO, folder_path=REGRESSION_DIR, token=HF_TOKEN, ) shutil.rmtree(REGRESSION_DIR) def strtobool(val): """Copied from distutils.util""" val = val.lower() if val in ("y", "yes", "t", "true", "on", "1"): return 1 elif val in ("n", "no", "f", "false", "off", "0"): return 0 else: raise ValueError(f"invalid truth value {val!r}") # same as in ..testing_utils.py but cannot be imported def require_torch_gpu(test_case): """ Decorator marking a test that requires a GPU. Will be skipped when no GPU is available. Copies from tsting_utils.py. """ if not torch.cuda.is_available(): return unittest.skip("test requires GPU")(test_case) else: return test_case # same as in ..testing_utils.py but cannot be imported def require_bitsandbytes(test_case): """ Decorator marking a test that requires the bitsandbytes library. Will be skipped when the library is not installed. Copies from tsting_utils.py. """ try: import bitsandbytes # noqa: F401 except ImportError: return unittest.skip("test requires bitsandbytes")(test_case) else: return test_case def save_output(output, name, force=False): path = os.path.join(REGRESSION_DIR, name, PEFT_VERSION) filename = os.path.join(path, "output.pt") if os.path.exists(filename) and not force: return if not os.path.exists(path): os.makedirs(path) if os.path.exists(filename) and force: print(f"Overriding existing output in {filename}", file=sys.stderr) torch.save(output, filename) def save_model(model, name, force=False): path = os.path.join(REGRESSION_DIR, name, PEFT_VERSION) filename = os.path.join(path, peft.utils.SAFETENSORS_WEIGHTS_NAME) if os.path.exists(filename) and not force: return if not os.path.exists(path): os.makedirs(path) if os.path.exists(filename) and force: print(f"Overriding existing model in {path}", file=sys.stderr) model.save_pretrained(path) def load_output(name): filename = os.path.join(REGRESSION_DIR, name, "output.pt") return torch.load(filename) @pytest.mark.regression class RegressionTester(unittest.TestCase): """Base class for regression testing Child classes must call assert_results_equal_or_store and pass the model outtput, as well as a unique name that describes the setting (e.g. "lora_opt-350m_bnb_4bit"). They also need to implement get_output(model) to get the model output, and load_base_model(name) to load the base model. Don't forget to fix the seed in load_base_model. """ torch_device = infer_device() def setUp(self): self.tol = 1e-4 self.creation_mode = strtobool(os.environ.get("REGRESSION_CREATION_MODE", "False")) self.force_mode = strtobool(os.environ.get("REGRESSION_FORCE_MODE", "False")) if self.force_mode and not self.creation_mode: raise RuntimeError("REGRESSION_FORCE_MODE can only be used together with REGRESSION_CREATION_MODE") if self.creation_mode: self.check_clean_git_status(self.force_mode) if HF_TOKEN is None: raise RuntimeError("HF_TOKEN environment variable must be set in creation mode") def fix_seed(self): torch.manual_seed(0) def check_clean_git_status(self, force): """Ensure that worktree is not dirty and version tag is checked out""" # check that the worktree is clean try: subprocess.check_output(["git", "diff", "--quiet", "HEAD"]) except subprocess.CalledProcessError as exc: if force: print("Overriding despite dirty git worktree", file=sys.stderr) else: raise RuntimeError("Git worktree is dirty") from exc # check that the commit is tagged try: subprocess.check_output(["git", "describe", "--exact-match", "HEAD"]) except subprocess.CalledProcessError as exc: if force: print("Overriding despite non-tagged commit", file=sys.stderr) else: raise RuntimeError("Git commit is not tagged") from exc def assert_results_equal_or_store(self, model, name): """Check if the outputs are the same or save the outputs if in creation mode.""" if not self.creation_mode: # normal regression testing mode self._assert_results_equal(name) else: output = self.get_output(model) if not torch.isfinite(output).all(): raise RuntimeError(f"Model output for {name} is not finite") output2 = self.get_output(model) if not torch.allclose(output, output2): raise RuntimeError(f"Model output for {name} is not deterministic") save_output(output, name, force=self.force_mode) save_model(model, name, force=self.force_mode) def _assert_results_equal(self, name): path = os.path.join(REGRESSION_DIR, name) versions = os.listdir(path) for version in versions: # each directory corresponds to a version output_loaded = load_output(os.path.join(name, version)) base_model = self.load_base_model() model = PeftModel.from_pretrained(base_model, os.path.join(path, version)) output = self.get_output(model) assert torch.allclose(output_loaded, output, atol=self.tol, rtol=self.tol) def get_output(self, model): raise NotImplementedError def load_base_model(self): raise NotImplementedError ############## # TEST CASES # ############## class TestMlp(RegressionTester): def get_output(self, model): input = torch.arange(90).reshape(9, 10).to(self.torch_device) with torch.inference_mode(): output = model(input) return output def load_base_model(self): class MLP(nn.Module): def __init__(self, bias=True): super().__init__() self.lin0 = nn.Linear(10, 20, bias=bias) self.relu = nn.ReLU() self.lin1 = nn.Linear(20, 2, bias=bias) self.sm = nn.LogSoftmax(dim=-1) def forward(self, X): X = X.float() X = self.lin0(X) X = self.relu(X) X = self.lin1(X) X = self.sm(X) return X self.fix_seed() return MLP().to(self.torch_device) def test_lora(self): base_model = self.load_base_model() config = LoraConfig( r=8, init_lora_weights=False, target_modules=["lin0"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lora_mlp") def test_adalora(self): base_model = self.load_base_model() config = AdaLoraConfig( r=8, init_lora_weights=False, target_modules=["lin0"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "adalora_mlp") def test_ia3(self): base_model = self.load_base_model() config = IA3Config( init_ia3_weights=False, target_modules=["lin0"], feedforward_modules=["lin0"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "ia3_mlp") def test_ia3_no_ff(self): base_model = self.load_base_model() config = IA3Config( init_ia3_weights=False, target_modules=["lin0"], feedforward_modules=[], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "ia3_no_ff_mlp") def test_loha(self): # TODO self.skipTest("Skipping LoHa for now because init is not seedable") base_model = self.load_base_model() config = LoHaConfig( r=8, init_weights=False, target_modules=["lin0"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "loha_mlp") def test_lokr(self): # TODO self.skipTest("Skipping LoKr for now because init is not seedable") base_model = self.load_base_model() config = LoKrConfig( r=8, target_modules=["lin0"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lokr_mlp") def test_lora_modules_to_save(self): base_model = self.load_base_model() config = LoraConfig( r=8, init_lora_weights=False, target_modules=["lin0"], modules_to_save=["lin1"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lora_mlp_modules_to_save") class TestLoraEmbConv1D(RegressionTester): def get_output(self, model): input = torch.arange(90).reshape(9, 10).to(self.torch_device) with torch.inference_mode(): output = model(input) return output def load_base_model(self): class ModelEmbConv1D(nn.Module): def __init__(self): super().__init__() self.emb = nn.Embedding(100, 5) self.conv1d = Conv1D(1, 5) self.relu = nn.ReLU() self.flat = nn.Flatten() self.lin0 = nn.Linear(10, 2) self.sm = nn.LogSoftmax(dim=-1) def forward(self, X): X = self.emb(X) X = self.conv1d(X) X = self.relu(X) X = self.flat(X) X = self.lin0(X) X = self.sm(X) return X self.fix_seed() return ModelEmbConv1D().to(self.torch_device) def test_lora(self): base_model = self.load_base_model() config = LoraConfig( r=8, init_lora_weights=False, target_modules=["emb", "conv1d"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lora_emb_conv1d") class TestLoraConv2D(RegressionTester): def get_output(self, model): input = torch.arange(90).reshape(9, 10).to(self.torch_device) with torch.inference_mode(): output = model(input) return output def load_base_model(self): class ModelConv2D(nn.Module): def __init__(self): super().__init__() self.conv2d = nn.Conv2d(5, 10, 3) self.relu = nn.ReLU() self.flat = nn.Flatten() self.lin0 = nn.Linear(10, 2) self.sm = nn.LogSoftmax(dim=-1) def forward(self, X): X = X.float().reshape(2, 5, 3, 3) X = self.conv2d(X) X = self.relu(X) X = self.flat(X) X = self.lin0(X) X = self.sm(X) return X self.fix_seed() return ModelConv2D().to(self.torch_device) def test_lora(self): base_model = self.load_base_model() config = LoraConfig( r=8, init_lora_weights=False, target_modules=["conv2d"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lora_conv2d") def test_ia3(self): base_model = self.load_base_model() config = IA3Config( init_ia3_weights=False, target_modules=["conv2d"], feedforward_modules=["conv2d"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "ia3_conv2d") def test_loha(self): # TODO self.skipTest("Skipping LoHa for now because init is not seedable") base_model = self.load_base_model() config = LoHaConfig( r=8, init_weights=False, target_modules=["conv2d"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "loha_conv2d") def test_lokr(self): # TODO self.skipTest("Skipping LoKr for now because init is not seedable") base_model = self.load_base_model() config = LoKrConfig( r=8, init_weights=False, target_modules=["conv2d"], ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lokr_conv2d") class TestOpt(RegressionTester): def get_output(self, model): input = torch.LongTensor([[1, 0, 1, 0, 1, 2]]).to(self.torch_device) with torch.inference_mode(): output = model(input).logits return output def load_base_model(self): self.fix_seed() return AutoModelForCausalLM.from_pretrained("facebook/opt-350m").to(self.torch_device) def test_lora(self): base_model = self.load_base_model() config = LoraConfig( r=8, init_lora_weights=False, ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lora_opt-350m") def test_adalora(self): base_model = self.load_base_model() config = AdaLoraConfig( r=8, init_lora_weights=False, ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "adalora_opt-350m") def test_ia3(self): base_model = self.load_base_model() config = IA3Config(init_ia3_weights=False) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "ia3_opt-350m") @require_torch_gpu @require_bitsandbytes class TestOpt8bitBnb(RegressionTester): def get_output(self, model): input = torch.LongTensor([[1, 0, 1, 0, 1, 2]]).to(self.torch_device) with torch.inference_mode(): output = model(input).logits return output def load_base_model(self): self.fix_seed() model = AutoModelForCausalLM.from_pretrained( "facebook/opt-350m", quantization_config=BitsAndBytesConfig(load_in_8bit=True), ) return model def test_lora_8bit(self): base_model = self.load_base_model() config = LoraConfig( r=8, init_lora_weights=False, ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lora_opt-350m_bnb_8bit") def test_adalora(self): # TODO self.skipTest( "Skipping AdaLora for now, getting TypeError: unsupported operand type(s) for +=: 'dict' and 'Tensor'" ) base_model = self.load_base_model() config = AdaLoraConfig( init_r=6, target_r=4, tinit=50, tfinal=100, deltaT=5, beta1=0.3, beta2=0.3, orth_reg_weight=0.2, lora_alpha=32, lora_dropout=0.05, bias="none", task_type="CAUSAL_LM", ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "adalora_opt-350m_8bit") @require_torch_gpu @require_bitsandbytes class TestOpt4bitBnb(RegressionTester): def get_output(self, model): input = torch.LongTensor([[1, 0, 1, 0, 1, 2]]).to(self.torch_device) with torch.inference_mode(): output = model(input).logits return output def load_base_model(self): self.fix_seed() bnb_config = BitsAndBytesConfig( load_in_4bit=True, bnb_4bit_use_double_quant=False, bnb_4bit_compute_dtype=torch.float32, ) model = AutoModelForCausalLM.from_pretrained( "facebook/opt-350m", quantization_config=bnb_config, torch_dtype=torch.float32, ) return model def test_lora_4bit(self): base_model = self.load_base_model() config = LoraConfig( r=8, init_lora_weights=False, ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "lora_opt-350m_bnb_4bit") def test_adalora(self): # TODO self.skipTest("Skipping AdaLora for now because of a bug, see #1113") base_model = self.load_base_model() config = AdaLoraConfig( init_r=6, target_r=4, tinit=50, tfinal=100, deltaT=5, beta1=0.3, beta2=0.3, orth_reg_weight=0.2, lora_alpha=32, lora_dropout=0.05, bias="none", task_type="CAUSAL_LM", ) model = get_peft_model(base_model, config) self.assert_results_equal_or_store(model, "adalora_opt-350m_4bit")
peft/tests/regression/test_regression.py/0
{ "file_path": "peft/tests/regression/test_regression.py", "repo_id": "peft", "token_count": 9656 }
176
# Copyright 2023-present the HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import pytest import torch from torch import nn from peft import LoraConfig, get_peft_model class ModelWithModuleDict(nn.Module): def __init__(self): super().__init__() self.other_layer = nn.Linear(10, 10) self.module = nn.ModuleDict({"foo": nn.Linear(10, 10)}) def forward(self): return self.module["foo"](torch.rand(1, 10)) class ModelWithModuleList(nn.Module): def __init__(self): super().__init__() self.other_layer = nn.Linear(10, 10) self.module = nn.ModuleList([nn.Linear(10, 10)]) def forward(self): return self.module[0](torch.rand(1, 10)) class ModelWithParameterDict(nn.Module): def __init__(self): super().__init__() self.other_layer = nn.Linear(10, 10) self.module = nn.ParameterDict({"foo": nn.Parameter(torch.rand(10, 10))}) def forward(self): return self.module["foo"] class ModelWithParameterList(nn.Module): def __init__(self): super().__init__() self.other_layer = nn.Linear(10, 10) self.module = nn.ParameterList([nn.Parameter(torch.rand(10, 10))]) def forward(self): return self.module[0] @pytest.mark.parametrize( "cls", [ModelWithModuleDict, ModelWithModuleList, ModelWithParameterDict, ModelWithParameterList] ) def test_modules_to_save_targets_module_dict_raises(cls): model = cls() peft_config = LoraConfig( target_modules=["other_layer"], modules_to_save=["module"], ) model() # sanity check that the model would normally work msg = "modules_to_save cannot be applied to modules of type" with pytest.raises(TypeError, match=msg): get_peft_model(model=model, peft_config=peft_config)
peft/tests/test_other.py/0
{ "file_path": "peft/tests/test_other.py", "repo_id": "peft", "token_count": 892 }
177
#!/usr/bin/env python3 """ Bulk Model Script Runner Run validation or benchmark script in separate process for each model Benchmark all 'vit*' models: python bulk_runner.py --model-list 'vit*' --results-file vit_bench.csv benchmark.py --amp -b 512 Validate all models: python bulk_runner.py --model-list all --results-file val.csv --pretrained validate.py /imagenet/validation/ --amp -b 512 --retry Hacked together by Ross Wightman (https://github.com/rwightman) """ import argparse import os import sys import csv import json import subprocess import time from typing import Callable, List, Tuple, Union from timm.models import is_model, list_models, get_pretrained_cfg parser = argparse.ArgumentParser(description='Per-model process launcher') # model and results args parser.add_argument( '--model-list', metavar='NAME', default='', help='txt file based list of model names to benchmark') parser.add_argument( '--results-file', default='', type=str, metavar='FILENAME', help='Output csv file for validation results (summary)') parser.add_argument( '--sort-key', default='', type=str, metavar='COL', help='Specify sort key for results csv') parser.add_argument( "--pretrained", action='store_true', help="only run models with pretrained weights") parser.add_argument( "--delay", type=float, default=0, help="Interval, in seconds, to delay between model invocations.", ) parser.add_argument( "--start_method", type=str, default="spawn", choices=["spawn", "fork", "forkserver"], help="Multiprocessing start method to use when creating workers.", ) parser.add_argument( "--no_python", help="Skip prepending the script with 'python' - just execute it directly. Useful " "when the script is not a Python script.", ) parser.add_argument( "-m", "--module", help="Change each process to interpret the launch script as a Python module, executing " "with the same behavior as 'python -m'.", ) # positional parser.add_argument( "script", type=str, help="Full path to the program/script to be launched for each model config.", ) parser.add_argument("script_args", nargs=argparse.REMAINDER) def cmd_from_args(args) -> Tuple[Union[Callable, str], List[str]]: # If ``args`` not passed, defaults to ``sys.argv[:1]`` with_python = not args.no_python cmd: Union[Callable, str] cmd_args = [] if with_python: cmd = os.getenv("PYTHON_EXEC", sys.executable) cmd_args.append("-u") if args.module: cmd_args.append("-m") cmd_args.append(args.script) else: if args.module: raise ValueError( "Don't use both the '--no_python' flag" " and the '--module' flag at the same time." ) cmd = args.script cmd_args.extend(args.script_args) return cmd, cmd_args def main(): args = parser.parse_args() cmd, cmd_args = cmd_from_args(args) model_cfgs = [] if args.model_list == 'all': model_names = list_models( pretrained=args.pretrained, # only include models w/ pretrained checkpoints if set ) model_cfgs = [(n, None) for n in model_names] elif args.model_list == 'all_in1k': model_names = list_models(pretrained=True) model_cfgs = [] for n in model_names: pt_cfg = get_pretrained_cfg(n) if getattr(pt_cfg, 'num_classes', 0) == 1000: print(n, pt_cfg.num_classes) model_cfgs.append((n, None)) elif args.model_list == 'all_res': model_names = list_models() model_names += list_models(pretrained=True) model_cfgs = set() for n in model_names: pt_cfg = get_pretrained_cfg(n) if pt_cfg is None: print(f'Model {n} is missing pretrained cfg, skipping.') continue n = n.split('.')[0] model_cfgs.add((n, pt_cfg.input_size[-1])) if pt_cfg.test_input_size is not None: model_cfgs.add((n, pt_cfg.test_input_size[-1])) model_cfgs = [(n, {'img-size': r}) for n, r in sorted(model_cfgs)] elif not is_model(args.model_list): # model name doesn't exist, try as wildcard filter model_names = list_models(args.model_list) model_cfgs = [(n, None) for n in model_names] if not model_cfgs and os.path.exists(args.model_list): with open(args.model_list) as f: model_names = [line.rstrip() for line in f] model_cfgs = [(n, None) for n in model_names] if len(model_cfgs): results_file = args.results_file or './results.csv' results = [] errors = [] model_strings = '\n'.join([f'{x[0]}, {x[1]}' for x in model_cfgs]) print(f"Running script on these models:\n {model_strings}") if not args.sort_key: if 'benchmark' in args.script: if any(['train' in a for a in args.script_args]): sort_key = 'train_samples_per_sec' else: sort_key = 'infer_samples_per_sec' else: sort_key = 'top1' else: sort_key = args.sort_key print(f'Script: {args.script}, Args: {args.script_args}, Sort key: {sort_key}') try: for m, ax in model_cfgs: if not m: continue args_str = (cmd, *[str(e) for e in cmd_args], '--model', m) if ax is not None: extra_args = [(f'--{k}', str(v)) for k, v in ax.items()] extra_args = [i for t in extra_args for i in t] args_str += tuple(extra_args) try: o = subprocess.check_output(args=args_str).decode('utf-8').split('--result')[-1] r = json.loads(o) results.append(r) except Exception as e: # FIXME batch_size retry loop is currently done in either validation.py or benchmark.py # for further robustness (but more overhead), we may want to manage that by looping here... errors.append(dict(model=m, error=str(e))) if args.delay: time.sleep(args.delay) except KeyboardInterrupt as e: pass errors.extend(list(filter(lambda x: 'error' in x, results))) if errors: print(f'{len(errors)} models had errors during run.') for e in errors: if 'model' in e: print(f"\t {e['model']} ({e.get('error', 'Unknown')})") else: print(e) results = list(filter(lambda x: 'error' not in x, results)) no_sortkey = list(filter(lambda x: sort_key not in x, results)) if no_sortkey: print(f'{len(no_sortkey)} results missing sort key, skipping sort.') else: results = sorted(results, key=lambda x: x[sort_key], reverse=True) if len(results): print(f'{len(results)} models run successfully. Saving results to {results_file}.') write_results(results_file, results) def write_results(results_file, results): with open(results_file, mode='w') as cf: dw = csv.DictWriter(cf, fieldnames=results[0].keys()) dw.writeheader() for r in results: dw.writerow(r) cf.flush() if __name__ == '__main__': main()
pytorch-image-models/bulk_runner.py/0
{ "file_path": "pytorch-image-models/bulk_runner.py", "repo_id": "pytorch-image-models", "token_count": 3409 }
178
# Big Transfer (BiT) **Big Transfer (BiT)** is a type of pretraining recipe that pre-trains on a large supervised source dataset, and fine-tunes the weights on the target task. Models are trained on the JFT-300M dataset. The finetuned models contained in this collection are finetuned on ImageNet. {% include 'code_snippets.md' %} ## How do I train this model? You can follow the [timm recipe scripts](https://rwightman.github.io/pytorch-image-models/scripts/) for training a new model afresh. ## Citation ```BibTeX @misc{kolesnikov2020big, title={Big Transfer (BiT): General Visual Representation Learning}, author={Alexander Kolesnikov and Lucas Beyer and Xiaohua Zhai and Joan Puigcerver and Jessica Yung and Sylvain Gelly and Neil Houlsby}, year={2020}, eprint={1912.11370}, archivePrefix={arXiv}, primaryClass={cs.CV} } ``` <!-- Type: model-index Collections: - Name: Big Transfer Paper: Title: 'Big Transfer (BiT): General Visual Representation Learning' URL: https://paperswithcode.com/paper/large-scale-learning-of-general-visual Models: - Name: resnetv2_101x1_bitm In Collection: Big Transfer Metadata: FLOPs: 5330896 Parameters: 44540000 File Size: 178256468 Architecture: - 1x1 Convolution - Bottleneck Residual Block - Convolution - Global Average Pooling - Group Normalization - Max Pooling - ReLU - Residual Block - Residual Connection - Softmax - Weight Standardization Tasks: - Image Classification Training Techniques: - Mixup - SGD with Momentum - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPUv3-512 ID: resnetv2_101x1_bitm LR: 0.03 Epochs: 90 Layers: 101 Crop Pct: '1.0' Momentum: 0.9 Batch Size: 4096 Image Size: '480' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/b9843f954b0457af2db4f9dea41a8538f51f5d78/timm/models/resnetv2.py#L444 Weights: https://storage.googleapis.com/bit_models/BiT-M-R101x1-ILSVRC2012.npz Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 82.21% Top 5 Accuracy: 96.47% - Name: resnetv2_101x3_bitm In Collection: Big Transfer Metadata: FLOPs: 15988688 Parameters: 387930000 File Size: 1551830100 Architecture: - 1x1 Convolution - Bottleneck Residual Block - Convolution - Global Average Pooling - Group Normalization - Max Pooling - ReLU - Residual Block - Residual Connection - Softmax - Weight Standardization Tasks: - Image Classification Training Techniques: - Mixup - SGD with Momentum - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPUv3-512 ID: resnetv2_101x3_bitm LR: 0.03 Epochs: 90 Layers: 101 Crop Pct: '1.0' Momentum: 0.9 Batch Size: 4096 Image Size: '480' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/b9843f954b0457af2db4f9dea41a8538f51f5d78/timm/models/resnetv2.py#L451 Weights: https://storage.googleapis.com/bit_models/BiT-M-R101x3-ILSVRC2012.npz Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 84.38% Top 5 Accuracy: 97.37% - Name: resnetv2_152x2_bitm In Collection: Big Transfer Metadata: FLOPs: 10659792 Parameters: 236340000 File Size: 945476668 Architecture: - 1x1 Convolution - Bottleneck Residual Block - Convolution - Global Average Pooling - Group Normalization - Max Pooling - ReLU - Residual Block - Residual Connection - Softmax - Weight Standardization Tasks: - Image Classification Training Techniques: - Mixup - SGD with Momentum - Weight Decay Training Data: - ImageNet - JFT-300M ID: resnetv2_152x2_bitm Crop Pct: '1.0' Image Size: '480' Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/b9843f954b0457af2db4f9dea41a8538f51f5d78/timm/models/resnetv2.py#L458 Weights: https://storage.googleapis.com/bit_models/BiT-M-R152x2-ILSVRC2012.npz Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 84.4% Top 5 Accuracy: 97.43% - Name: resnetv2_152x4_bitm In Collection: Big Transfer Metadata: FLOPs: 21317584 Parameters: 936530000 File Size: 3746270104 Architecture: - 1x1 Convolution - Bottleneck Residual Block - Convolution - Global Average Pooling - Group Normalization - Max Pooling - ReLU - Residual Block - Residual Connection - Softmax - Weight Standardization Tasks: - Image Classification Training Techniques: - Mixup - SGD with Momentum - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPUv3-512 ID: resnetv2_152x4_bitm Crop Pct: '1.0' Image Size: '480' Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/b9843f954b0457af2db4f9dea41a8538f51f5d78/timm/models/resnetv2.py#L465 Weights: https://storage.googleapis.com/bit_models/BiT-M-R152x4-ILSVRC2012.npz Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 84.95% Top 5 Accuracy: 97.45% - Name: resnetv2_50x1_bitm In Collection: Big Transfer Metadata: FLOPs: 5330896 Parameters: 25550000 File Size: 102242668 Architecture: - 1x1 Convolution - Bottleneck Residual Block - Convolution - Global Average Pooling - Group Normalization - Max Pooling - ReLU - Residual Block - Residual Connection - Softmax - Weight Standardization Tasks: - Image Classification Training Techniques: - Mixup - SGD with Momentum - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPUv3-512 ID: resnetv2_50x1_bitm LR: 0.03 Epochs: 90 Layers: 50 Crop Pct: '1.0' Momentum: 0.9 Batch Size: 4096 Image Size: '480' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/b9843f954b0457af2db4f9dea41a8538f51f5d78/timm/models/resnetv2.py#L430 Weights: https://storage.googleapis.com/bit_models/BiT-M-R50x1-ILSVRC2012.npz Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 80.19% Top 5 Accuracy: 95.63% - Name: resnetv2_50x3_bitm In Collection: Big Transfer Metadata: FLOPs: 15988688 Parameters: 217320000 File Size: 869321580 Architecture: - 1x1 Convolution - Bottleneck Residual Block - Convolution - Global Average Pooling - Group Normalization - Max Pooling - ReLU - Residual Block - Residual Connection - Softmax - Weight Standardization Tasks: - Image Classification Training Techniques: - Mixup - SGD with Momentum - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPUv3-512 ID: resnetv2_50x3_bitm LR: 0.03 Epochs: 90 Layers: 50 Crop Pct: '1.0' Momentum: 0.9 Batch Size: 4096 Image Size: '480' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/b9843f954b0457af2db4f9dea41a8538f51f5d78/timm/models/resnetv2.py#L437 Weights: https://storage.googleapis.com/bit_models/BiT-M-R50x3-ILSVRC2012.npz Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 83.75% Top 5 Accuracy: 97.12% -->
pytorch-image-models/docs/models/.templates/models/big-transfer.md/0
{ "file_path": "pytorch-image-models/docs/models/.templates/models/big-transfer.md", "repo_id": "pytorch-image-models", "token_count": 3274 }
179
# (Gluon) SENet A **SENet** is a convolutional neural network architecture that employs [squeeze-and-excitation blocks](https://paperswithcode.com/method/squeeze-and-excitation-block) to enable the network to perform dynamic channel-wise feature recalibration. The weights from this model were ported from [Gluon](https://cv.gluon.ai/model_zoo/classification.html). {% include 'code_snippets.md' %} ## How do I train this model? You can follow the [timm recipe scripts](https://rwightman.github.io/pytorch-image-models/scripts/) for training a new model afresh. ## Citation ```BibTeX @misc{hu2019squeezeandexcitation, title={Squeeze-and-Excitation Networks}, author={Jie Hu and Li Shen and Samuel Albanie and Gang Sun and Enhua Wu}, year={2019}, eprint={1709.01507}, archivePrefix={arXiv}, primaryClass={cs.CV} } ``` <!-- Type: model-index Collections: - Name: Gloun SENet Paper: Title: Squeeze-and-Excitation Networks URL: https://paperswithcode.com/paper/squeeze-and-excitation-networks Models: - Name: gluon_senet154 In Collection: Gloun SENet Metadata: FLOPs: 26681705136 Parameters: 115090000 File Size: 461546622 Architecture: - Convolution - Dense Connections - Global Average Pooling - Max Pooling - Softmax - Squeeze-and-Excitation Block Tasks: - Image Classification Training Data: - ImageNet ID: gluon_senet154 Crop Pct: '0.875' Image Size: '224' Interpolation: bicubic Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/gluon_resnet.py#L239 Weights: https://github.com/rwightman/pytorch-pretrained-gluonresnet/releases/download/v0.1/gluon_senet154-70a1a3c0.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 81.23% Top 5 Accuracy: 95.35% -->
pytorch-image-models/docs/models/.templates/models/gloun-senet.md/0
{ "file_path": "pytorch-image-models/docs/models/.templates/models/gloun-senet.md", "repo_id": "pytorch-image-models", "token_count": 747 }
180
# Noisy Student (EfficientNet) **Noisy Student Training** is a semi-supervised learning approach. It extends the idea of self-training and distillation with the use of equal-or-larger student models and noise added to the student during learning. It has three main steps: 1. train a teacher model on labeled images 2. use the teacher to generate pseudo labels on unlabeled images 3. train a student model on the combination of labeled images and pseudo labeled images. The algorithm is iterated a few times by treating the student as a teacher to relabel the unlabeled data and training a new student. Noisy Student Training seeks to improve on self-training and distillation in two ways. First, it makes the student larger than, or at least equal to, the teacher so the student can better learn from a larger dataset. Second, it adds noise to the student so the noised student is forced to learn harder from the pseudo labels. To noise the student, it uses input noise such as RandAugment data augmentation, and model noise such as dropout and stochastic depth during training. {% include 'code_snippets.md' %} ## How do I train this model? You can follow the [timm recipe scripts](https://rwightman.github.io/pytorch-image-models/scripts/) for training a new model afresh. ## Citation ```BibTeX @misc{xie2020selftraining, title={Self-training with Noisy Student improves ImageNet classification}, author={Qizhe Xie and Minh-Thang Luong and Eduard Hovy and Quoc V. Le}, year={2020}, eprint={1911.04252}, archivePrefix={arXiv}, primaryClass={cs.LG} } ``` <!-- Type: model-index Collections: - Name: Noisy Student Paper: Title: Self-training with Noisy Student improves ImageNet classification URL: https://paperswithcode.com/paper/self-training-with-noisy-student-improves Models: - Name: tf_efficientnet_b0_ns In Collection: Noisy Student Metadata: FLOPs: 488688572 Parameters: 5290000 File Size: 21386709 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b0_ns LR: 0.128 Epochs: 700 Dropout: 0.5 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 2048 Image Size: '224' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1427 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b0_ns-c0e6a31c.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 78.66% Top 5 Accuracy: 94.37% - Name: tf_efficientnet_b1_ns In Collection: Noisy Student Metadata: FLOPs: 883633200 Parameters: 7790000 File Size: 31516408 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b1_ns LR: 0.128 Epochs: 700 Dropout: 0.5 Crop Pct: '0.882' Momentum: 0.9 Batch Size: 2048 Image Size: '240' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1437 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b1_ns-99dd0c41.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 81.39% Top 5 Accuracy: 95.74% - Name: tf_efficientnet_b2_ns In Collection: Noisy Student Metadata: FLOPs: 1234321170 Parameters: 9110000 File Size: 36801803 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b2_ns LR: 0.128 Epochs: 700 Dropout: 0.5 Crop Pct: '0.89' Momentum: 0.9 Batch Size: 2048 Image Size: '260' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1447 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b2_ns-00306e48.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 82.39% Top 5 Accuracy: 96.24% - Name: tf_efficientnet_b3_ns In Collection: Noisy Student Metadata: FLOPs: 2275247568 Parameters: 12230000 File Size: 49385734 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b3_ns LR: 0.128 Epochs: 700 Dropout: 0.5 Crop Pct: '0.904' Momentum: 0.9 Batch Size: 2048 Image Size: '300' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1457 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b3_ns-9d44bf68.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 84.04% Top 5 Accuracy: 96.91% - Name: tf_efficientnet_b4_ns In Collection: Noisy Student Metadata: FLOPs: 5749638672 Parameters: 19340000 File Size: 77995057 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b4_ns LR: 0.128 Epochs: 700 Dropout: 0.5 Crop Pct: '0.922' Momentum: 0.9 Batch Size: 2048 Image Size: '380' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1467 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b4_ns-d6313a46.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 85.15% Top 5 Accuracy: 97.47% - Name: tf_efficientnet_b5_ns In Collection: Noisy Student Metadata: FLOPs: 13176501888 Parameters: 30390000 File Size: 122404944 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b5_ns LR: 0.128 Epochs: 350 Dropout: 0.5 Crop Pct: '0.934' Momentum: 0.9 Batch Size: 2048 Image Size: '456' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1477 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b5_ns-6f26d0cf.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 86.08% Top 5 Accuracy: 97.75% - Name: tf_efficientnet_b6_ns In Collection: Noisy Student Metadata: FLOPs: 24180518488 Parameters: 43040000 File Size: 173239537 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b6_ns LR: 0.128 Epochs: 350 Dropout: 0.5 Crop Pct: '0.942' Momentum: 0.9 Batch Size: 2048 Image Size: '528' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1487 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b6_ns-51548356.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 86.45% Top 5 Accuracy: 97.88% - Name: tf_efficientnet_b7_ns In Collection: Noisy Student Metadata: FLOPs: 48205304880 Parameters: 66349999 File Size: 266853140 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod ID: tf_efficientnet_b7_ns LR: 0.128 Epochs: 350 Dropout: 0.5 Crop Pct: '0.949' Momentum: 0.9 Batch Size: 2048 Image Size: '600' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1498 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_b7_ns-1dbc32de.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 86.83% Top 5 Accuracy: 98.08% - Name: tf_efficientnet_l2_ns In Collection: Noisy Student Metadata: FLOPs: 611646113804 Parameters: 480310000 File Size: 1925950424 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - FixRes - Label Smoothing - Noisy Student - RMSProp - RandAugment - Weight Decay Training Data: - ImageNet - JFT-300M Training Resources: Cloud TPU v3 Pod Training Time: 6 days ID: tf_efficientnet_l2_ns LR: 0.128 Epochs: 350 Dropout: 0.5 Crop Pct: '0.96' Momentum: 0.9 Batch Size: 2048 Image Size: '800' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Stochastic Depth Survival: 0.8 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1520 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_l2_ns-df73bb44.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 88.35% Top 5 Accuracy: 98.66% -->
pytorch-image-models/docs/models/.templates/models/noisy-student.md/0
{ "file_path": "pytorch-image-models/docs/models/.templates/models/noisy-student.md", "repo_id": "pytorch-image-models", "token_count": 5862 }
181
# SPNASNet **Single-Path NAS** is a novel differentiable NAS method for designing hardware-efficient ConvNets in less than 4 hours. {% include 'code_snippets.md' %} ## How do I train this model? You can follow the [timm recipe scripts](https://rwightman.github.io/pytorch-image-models/scripts/) for training a new model afresh. ## Citation ```BibTeX @misc{stamoulis2019singlepath, title={Single-Path NAS: Designing Hardware-Efficient ConvNets in less than 4 Hours}, author={Dimitrios Stamoulis and Ruizhou Ding and Di Wang and Dimitrios Lymberopoulos and Bodhi Priyantha and Jie Liu and Diana Marculescu}, year={2019}, eprint={1904.02877}, archivePrefix={arXiv}, primaryClass={cs.LG} } ``` <!-- Type: model-index Collections: - Name: SPNASNet Paper: Title: 'Single-Path NAS: Designing Hardware-Efficient ConvNets in less than 4 Hours' URL: https://paperswithcode.com/paper/single-path-nas-designing-hardware-efficient Models: - Name: spnasnet_100 In Collection: SPNASNet Metadata: FLOPs: 442385600 Parameters: 4420000 File Size: 17902337 Architecture: - Average Pooling - Batch Normalization - Convolution - Depthwise Separable Convolution - Dropout - ReLU Tasks: - Image Classification Training Data: - ImageNet ID: spnasnet_100 Crop Pct: '0.875' Image Size: '224' Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L995 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/spnasnet_100-048bc3f4.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 74.08% Top 5 Accuracy: 91.82% -->
pytorch-image-models/docs/models/.templates/models/spnasnet.md/0
{ "file_path": "pytorch-image-models/docs/models/.templates/models/spnasnet.md", "repo_id": "pytorch-image-models", "token_count": 699 }
182
# DenseNet **DenseNet** is a type of convolutional neural network that utilises dense connections between layers, through [Dense Blocks](http://www.paperswithcode.com/method/dense-block), where we connect *all layers* (with matching feature-map sizes) directly with each other. To preserve the feed-forward nature, each layer obtains additional inputs from all preceding layers and passes on its own feature-maps to all subsequent layers. The **DenseNet Blur** variant in this collection by Ross Wightman employs [Blur Pooling](http://www.paperswithcode.com/method/blur-pooling) ## How do I use this model on an image? To load a pretrained model: ```py >>> import timm >>> model = timm.create_model('densenet121', pretrained=True) >>> model.eval() ``` To load and preprocess the image: ```py >>> import urllib >>> from PIL import Image >>> from timm.data import resolve_data_config >>> from timm.data.transforms_factory import create_transform >>> config = resolve_data_config({}, model=model) >>> transform = create_transform(**config) >>> url, filename = ("https://github.com/pytorch/hub/raw/master/images/dog.jpg", "dog.jpg") >>> urllib.request.urlretrieve(url, filename) >>> img = Image.open(filename).convert('RGB') >>> tensor = transform(img).unsqueeze(0) # transform and add batch dimension ``` To get the model predictions: ```py >>> import torch >>> with torch.no_grad(): ... out = model(tensor) >>> probabilities = torch.nn.functional.softmax(out[0], dim=0) >>> print(probabilities.shape) >>> # prints: torch.Size([1000]) ``` To get the top-5 predictions class names: ```py >>> # Get imagenet class mappings >>> url, filename = ("https://raw.githubusercontent.com/pytorch/hub/master/imagenet_classes.txt", "imagenet_classes.txt") >>> urllib.request.urlretrieve(url, filename) >>> with open("imagenet_classes.txt", "r") as f: ... categories = [s.strip() for s in f.readlines()] >>> # Print top categories per image >>> top5_prob, top5_catid = torch.topk(probabilities, 5) >>> for i in range(top5_prob.size(0)): ... print(categories[top5_catid[i]], top5_prob[i].item()) >>> # prints class names and probabilities like: >>> # [('Samoyed', 0.6425196528434753), ('Pomeranian', 0.04062102362513542), ('keeshond', 0.03186424449086189), ('white wolf', 0.01739676296710968), ('Eskimo dog', 0.011717947199940681)] ``` Replace the model name with the variant you want to use, e.g. `densenet121`. You can find the IDs in the model summaries at the top of this page. To extract image features with this model, follow the [timm feature extraction examples](../feature_extraction), just change the name of the model you want to use. ## How do I finetune this model? You can finetune any of the pre-trained models just by changing the classifier (the last layer). ```py >>> model = timm.create_model('densenet121', pretrained=True, num_classes=NUM_FINETUNE_CLASSES) ``` To finetune on your own dataset, you have to write a training loop or adapt [timm's training script](https://github.com/rwightman/pytorch-image-models/blob/master/train.py) to use your dataset. ## How do I train this model? You can follow the [timm recipe scripts](../scripts) for training a new model afresh. ## Citation ```BibTeX @article{DBLP:journals/corr/HuangLW16a, author = {Gao Huang and Zhuang Liu and Kilian Q. Weinberger}, title = {Densely Connected Convolutional Networks}, journal = {CoRR}, volume = {abs/1608.06993}, year = {2016}, url = {http://arxiv.org/abs/1608.06993}, archivePrefix = {arXiv}, eprint = {1608.06993}, timestamp = {Mon, 10 Sep 2018 15:49:32 +0200}, biburl = {https://dblp.org/rec/journals/corr/HuangLW16a.bib}, bibsource = {dblp computer science bibliography, https://dblp.org} } ``` ``` @misc{rw2019timm, author = {Ross Wightman}, title = {PyTorch Image Models}, year = {2019}, publisher = {GitHub}, journal = {GitHub repository}, doi = {10.5281/zenodo.4414861}, howpublished = {\url{https://github.com/rwightman/pytorch-image-models}} } ``` <!-- Type: model-index Collections: - Name: DenseNet Paper: Title: Densely Connected Convolutional Networks URL: https://paperswithcode.com/paper/densely-connected-convolutional-networks Models: - Name: densenet121 In Collection: DenseNet Metadata: FLOPs: 3641843200 Parameters: 7980000 File Size: 32376726 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Block - Dense Connections - Dropout - Max Pooling - ReLU - Softmax Tasks: - Image Classification Training Techniques: - Kaiming Initialization - Nesterov Accelerated Gradient - Weight Decay Training Data: - ImageNet ID: densenet121 LR: 0.1 Epochs: 90 Layers: 121 Dropout: 0.2 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bicubic Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/densenet.py#L295 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/densenet121_ra-50efcf5c.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 75.56% Top 5 Accuracy: 92.65% - Name: densenet161 In Collection: DenseNet Metadata: FLOPs: 9931959264 Parameters: 28680000 File Size: 115730790 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Block - Dense Connections - Dropout - Max Pooling - ReLU - Softmax Tasks: - Image Classification Training Techniques: - Kaiming Initialization - Nesterov Accelerated Gradient - Weight Decay Training Data: - ImageNet ID: densenet161 LR: 0.1 Epochs: 90 Layers: 161 Dropout: 0.2 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bicubic Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/densenet.py#L347 Weights: https://download.pytorch.org/models/densenet161-8d451a50.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 77.36% Top 5 Accuracy: 93.63% - Name: densenet169 In Collection: DenseNet Metadata: FLOPs: 4316945792 Parameters: 14150000 File Size: 57365526 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Block - Dense Connections - Dropout - Max Pooling - ReLU - Softmax Tasks: - Image Classification Training Techniques: - Kaiming Initialization - Nesterov Accelerated Gradient - Weight Decay Training Data: - ImageNet ID: densenet169 LR: 0.1 Epochs: 90 Layers: 169 Dropout: 0.2 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bicubic Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/densenet.py#L327 Weights: https://download.pytorch.org/models/densenet169-b2777c0a.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 75.9% Top 5 Accuracy: 93.02% - Name: densenet201 In Collection: DenseNet Metadata: FLOPs: 5514321024 Parameters: 20010000 File Size: 81131730 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Block - Dense Connections - Dropout - Max Pooling - ReLU - Softmax Tasks: - Image Classification Training Techniques: - Kaiming Initialization - Nesterov Accelerated Gradient - Weight Decay Training Data: - ImageNet ID: densenet201 LR: 0.1 Epochs: 90 Layers: 201 Dropout: 0.2 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bicubic Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/densenet.py#L337 Weights: https://download.pytorch.org/models/densenet201-c1103571.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 77.29% Top 5 Accuracy: 93.48% - Name: densenetblur121d In Collection: DenseNet Metadata: FLOPs: 3947812864 Parameters: 8000000 File Size: 32456500 Architecture: - 1x1 Convolution - Batch Normalization - Blur Pooling - Convolution - Dense Block - Dense Connections - Dropout - Max Pooling - ReLU - Softmax Tasks: - Image Classification Training Data: - ImageNet ID: densenetblur121d Crop Pct: '0.875' Image Size: '224' Interpolation: bicubic Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/densenet.py#L305 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/densenetblur121d_ra-100dcfbc.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 76.59% Top 5 Accuracy: 93.2% - Name: tv_densenet121 In Collection: DenseNet Metadata: FLOPs: 3641843200 Parameters: 7980000 File Size: 32342954 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - Convolution - Dense Block - Dense Connections - Dropout - Max Pooling - ReLU - Softmax Tasks: - Image Classification Training Techniques: - SGD with Momentum - Weight Decay Training Data: - ImageNet ID: tv_densenet121 LR: 0.1 Epochs: 90 Crop Pct: '0.875' LR Gamma: 0.1 Momentum: 0.9 Batch Size: 32 Image Size: '224' LR Step Size: 30 Weight Decay: 0.0001 Interpolation: bicubic Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/densenet.py#L379 Weights: https://download.pytorch.org/models/densenet121-a639ec97.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 74.74% Top 5 Accuracy: 92.15% -->
pytorch-image-models/hfdocs/source/models/densenet.mdx/0
{ "file_path": "pytorch-image-models/hfdocs/source/models/densenet.mdx", "repo_id": "pytorch-image-models", "token_count": 4188 }
183
# Instagram ResNeXt WSL A **ResNeXt** repeats a [building block](https://paperswithcode.com/method/resnext-block) that aggregates a set of transformations with the same topology. Compared to a [ResNet](https://paperswithcode.com/method/resnet), it exposes a new dimension, *cardinality* (the size of the set of transformations) \\( C \\), as an essential factor in addition to the dimensions of depth and width. This model was trained on billions of Instagram images using thousands of distinct hashtags as labels exhibit excellent transfer learning performance. Please note the CC-BY-NC 4.0 license on theses weights, non-commercial use only. ## How do I use this model on an image? To load a pretrained model: ```py >>> import timm >>> model = timm.create_model('ig_resnext101_32x16d', pretrained=True) >>> model.eval() ``` To load and preprocess the image: ```py >>> import urllib >>> from PIL import Image >>> from timm.data import resolve_data_config >>> from timm.data.transforms_factory import create_transform >>> config = resolve_data_config({}, model=model) >>> transform = create_transform(**config) >>> url, filename = ("https://github.com/pytorch/hub/raw/master/images/dog.jpg", "dog.jpg") >>> urllib.request.urlretrieve(url, filename) >>> img = Image.open(filename).convert('RGB') >>> tensor = transform(img).unsqueeze(0) # transform and add batch dimension ``` To get the model predictions: ```py >>> import torch >>> with torch.no_grad(): ... out = model(tensor) >>> probabilities = torch.nn.functional.softmax(out[0], dim=0) >>> print(probabilities.shape) >>> # prints: torch.Size([1000]) ``` To get the top-5 predictions class names: ```py >>> # Get imagenet class mappings >>> url, filename = ("https://raw.githubusercontent.com/pytorch/hub/master/imagenet_classes.txt", "imagenet_classes.txt") >>> urllib.request.urlretrieve(url, filename) >>> with open("imagenet_classes.txt", "r") as f: ... categories = [s.strip() for s in f.readlines()] >>> # Print top categories per image >>> top5_prob, top5_catid = torch.topk(probabilities, 5) >>> for i in range(top5_prob.size(0)): ... print(categories[top5_catid[i]], top5_prob[i].item()) >>> # prints class names and probabilities like: >>> # [('Samoyed', 0.6425196528434753), ('Pomeranian', 0.04062102362513542), ('keeshond', 0.03186424449086189), ('white wolf', 0.01739676296710968), ('Eskimo dog', 0.011717947199940681)] ``` Replace the model name with the variant you want to use, e.g. `ig_resnext101_32x16d`. You can find the IDs in the model summaries at the top of this page. To extract image features with this model, follow the [timm feature extraction examples](../feature_extraction), just change the name of the model you want to use. ## How do I finetune this model? You can finetune any of the pre-trained models just by changing the classifier (the last layer). ```py >>> model = timm.create_model('ig_resnext101_32x16d', pretrained=True, num_classes=NUM_FINETUNE_CLASSES) ``` To finetune on your own dataset, you have to write a training loop or adapt [timm's training script](https://github.com/rwightman/pytorch-image-models/blob/master/train.py) to use your dataset. ## How do I train this model? You can follow the [timm recipe scripts](../scripts) for training a new model afresh. ## Citation ```BibTeX @misc{mahajan2018exploring, title={Exploring the Limits of Weakly Supervised Pretraining}, author={Dhruv Mahajan and Ross Girshick and Vignesh Ramanathan and Kaiming He and Manohar Paluri and Yixuan Li and Ashwin Bharambe and Laurens van der Maaten}, year={2018}, eprint={1805.00932}, archivePrefix={arXiv}, primaryClass={cs.CV} } ``` <!-- Type: model-index Collections: - Name: IG ResNeXt Paper: Title: Exploring the Limits of Weakly Supervised Pretraining URL: https://paperswithcode.com/paper/exploring-the-limits-of-weakly-supervised Models: - Name: ig_resnext101_32x16d In Collection: IG ResNeXt Metadata: FLOPs: 46623691776 Parameters: 194030000 File Size: 777518664 Architecture: - 1x1 Convolution - Batch Normalization - Convolution - Global Average Pooling - Grouped Convolution - Max Pooling - ReLU - ResNeXt Block - Residual Connection - Softmax Tasks: - Image Classification Training Techniques: - Nesterov Accelerated Gradient - Weight Decay Training Data: - IG-3.5B-17k - ImageNet Training Resources: 336x GPUs ID: ig_resnext101_32x16d Epochs: 100 Layers: 101 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 8064 Image Size: '224' Weight Decay: 0.001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/resnet.py#L874 Weights: https://download.pytorch.org/models/ig_resnext101_32x16-c6f796b0.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 84.16% Top 5 Accuracy: 97.19% - Name: ig_resnext101_32x32d In Collection: IG ResNeXt Metadata: FLOPs: 112225170432 Parameters: 468530000 File Size: 1876573776 Architecture: - 1x1 Convolution - Batch Normalization - Convolution - Global Average Pooling - Grouped Convolution - Max Pooling - ReLU - ResNeXt Block - Residual Connection - Softmax Tasks: - Image Classification Training Techniques: - Nesterov Accelerated Gradient - Weight Decay Training Data: - IG-3.5B-17k - ImageNet Training Resources: 336x GPUs ID: ig_resnext101_32x32d Epochs: 100 Layers: 101 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 8064 Image Size: '224' Weight Decay: 0.001 Interpolation: bilinear Minibatch Size: 8064 Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/resnet.py#L885 Weights: https://download.pytorch.org/models/ig_resnext101_32x32-e4b90b00.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 85.09% Top 5 Accuracy: 97.44% - Name: ig_resnext101_32x48d In Collection: IG ResNeXt Metadata: FLOPs: 197446554624 Parameters: 828410000 File Size: 3317136976 Architecture: - 1x1 Convolution - Batch Normalization - Convolution - Global Average Pooling - Grouped Convolution - Max Pooling - ReLU - ResNeXt Block - Residual Connection - Softmax Tasks: - Image Classification Training Techniques: - Nesterov Accelerated Gradient - Weight Decay Training Data: - IG-3.5B-17k - ImageNet Training Resources: 336x GPUs ID: ig_resnext101_32x48d Epochs: 100 Layers: 101 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 8064 Image Size: '224' Weight Decay: 0.001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/resnet.py#L896 Weights: https://download.pytorch.org/models/ig_resnext101_32x48-3e41cc8a.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 85.42% Top 5 Accuracy: 97.58% - Name: ig_resnext101_32x8d In Collection: IG ResNeXt Metadata: FLOPs: 21180417024 Parameters: 88790000 File Size: 356056638 Architecture: - 1x1 Convolution - Batch Normalization - Convolution - Global Average Pooling - Grouped Convolution - Max Pooling - ReLU - ResNeXt Block - Residual Connection - Softmax Tasks: - Image Classification Training Techniques: - Nesterov Accelerated Gradient - Weight Decay Training Data: - IG-3.5B-17k - ImageNet Training Resources: 336x GPUs ID: ig_resnext101_32x8d Epochs: 100 Layers: 101 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 8064 Image Size: '224' Weight Decay: 0.001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/resnet.py#L863 Weights: https://download.pytorch.org/models/ig_resnext101_32x8-c38310e5.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 82.7% Top 5 Accuracy: 96.64% -->
pytorch-image-models/hfdocs/source/models/ig-resnext.mdx/0
{ "file_path": "pytorch-image-models/hfdocs/source/models/ig-resnext.mdx", "repo_id": "pytorch-image-models", "token_count": 3231 }
184
# Res2Net **Res2Net** is an image model that employs a variation on bottleneck residual blocks, [Res2Net Blocks](https://paperswithcode.com/method/res2net-block). The motivation is to be able to represent features at multiple scales. This is achieved through a novel building block for CNNs that constructs hierarchical residual-like connections within one single residual block. This represents multi-scale features at a granular level and increases the range of receptive fields for each network layer. ## How do I use this model on an image? To load a pretrained model: ```py >>> import timm >>> model = timm.create_model('res2net101_26w_4s', pretrained=True) >>> model.eval() ``` To load and preprocess the image: ```py >>> import urllib >>> from PIL import Image >>> from timm.data import resolve_data_config >>> from timm.data.transforms_factory import create_transform >>> config = resolve_data_config({}, model=model) >>> transform = create_transform(**config) >>> url, filename = ("https://github.com/pytorch/hub/raw/master/images/dog.jpg", "dog.jpg") >>> urllib.request.urlretrieve(url, filename) >>> img = Image.open(filename).convert('RGB') >>> tensor = transform(img).unsqueeze(0) # transform and add batch dimension ``` To get the model predictions: ```py >>> import torch >>> with torch.no_grad(): ... out = model(tensor) >>> probabilities = torch.nn.functional.softmax(out[0], dim=0) >>> print(probabilities.shape) >>> # prints: torch.Size([1000]) ``` To get the top-5 predictions class names: ```py >>> # Get imagenet class mappings >>> url, filename = ("https://raw.githubusercontent.com/pytorch/hub/master/imagenet_classes.txt", "imagenet_classes.txt") >>> urllib.request.urlretrieve(url, filename) >>> with open("imagenet_classes.txt", "r") as f: ... categories = [s.strip() for s in f.readlines()] >>> # Print top categories per image >>> top5_prob, top5_catid = torch.topk(probabilities, 5) >>> for i in range(top5_prob.size(0)): ... print(categories[top5_catid[i]], top5_prob[i].item()) >>> # prints class names and probabilities like: >>> # [('Samoyed', 0.6425196528434753), ('Pomeranian', 0.04062102362513542), ('keeshond', 0.03186424449086189), ('white wolf', 0.01739676296710968), ('Eskimo dog', 0.011717947199940681)] ``` Replace the model name with the variant you want to use, e.g. `res2net101_26w_4s`. You can find the IDs in the model summaries at the top of this page. To extract image features with this model, follow the [timm feature extraction examples](../feature_extraction), just change the name of the model you want to use. ## How do I finetune this model? You can finetune any of the pre-trained models just by changing the classifier (the last layer). ```py >>> model = timm.create_model('res2net101_26w_4s', pretrained=True, num_classes=NUM_FINETUNE_CLASSES) ``` To finetune on your own dataset, you have to write a training loop or adapt [timm's training script](https://github.com/rwightman/pytorch-image-models/blob/master/train.py) to use your dataset. ## How do I train this model? You can follow the [timm recipe scripts](../scripts) for training a new model afresh. ## Citation ```BibTeX @article{Gao_2021, title={Res2Net: A New Multi-Scale Backbone Architecture}, volume={43}, ISSN={1939-3539}, url={http://dx.doi.org/10.1109/TPAMI.2019.2938758}, DOI={10.1109/tpami.2019.2938758}, number={2}, journal={IEEE Transactions on Pattern Analysis and Machine Intelligence}, publisher={Institute of Electrical and Electronics Engineers (IEEE)}, author={Gao, Shang-Hua and Cheng, Ming-Ming and Zhao, Kai and Zhang, Xin-Yu and Yang, Ming-Hsuan and Torr, Philip}, year={2021}, month={Feb}, pages={652–662} } ``` <!-- Type: model-index Collections: - Name: Res2Net Paper: Title: 'Res2Net: A New Multi-scale Backbone Architecture' URL: https://paperswithcode.com/paper/res2net-a-new-multi-scale-backbone Models: - Name: res2net101_26w_4s In Collection: Res2Net Metadata: FLOPs: 10415881200 Parameters: 45210000 File Size: 181456059 Architecture: - Batch Normalization - Convolution - Global Average Pooling - ReLU - Res2Net Block Tasks: - Image Classification Training Techniques: - SGD with Momentum - Weight Decay Training Data: - ImageNet Training Resources: 4x Titan Xp GPUs ID: res2net101_26w_4s LR: 0.1 Epochs: 100 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/res2net.py#L152 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-res2net/res2net101_26w_4s-02a759a1.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 79.19% Top 5 Accuracy: 94.43% - Name: res2net50_14w_8s In Collection: Res2Net Metadata: FLOPs: 5403546768 Parameters: 25060000 File Size: 100638543 Architecture: - Batch Normalization - Convolution - Global Average Pooling - ReLU - Res2Net Block Tasks: - Image Classification Training Techniques: - SGD with Momentum - Weight Decay Training Data: - ImageNet Training Resources: 4x Titan Xp GPUs ID: res2net50_14w_8s LR: 0.1 Epochs: 100 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/res2net.py#L196 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-res2net/res2net50_14w_8s-6527dddc.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 78.14% Top 5 Accuracy: 93.86% - Name: res2net50_26w_4s In Collection: Res2Net Metadata: FLOPs: 5499974064 Parameters: 25700000 File Size: 103110087 Architecture: - Batch Normalization - Convolution - Global Average Pooling - ReLU - Res2Net Block Tasks: - Image Classification Training Techniques: - SGD with Momentum - Weight Decay Training Data: - ImageNet Training Resources: 4x Titan Xp GPUs ID: res2net50_26w_4s LR: 0.1 Epochs: 100 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/res2net.py#L141 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-res2net/res2net50_26w_4s-06e79181.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 77.99% Top 5 Accuracy: 93.85% - Name: res2net50_26w_6s In Collection: Res2Net Metadata: FLOPs: 8130156528 Parameters: 37050000 File Size: 148603239 Architecture: - Batch Normalization - Convolution - Global Average Pooling - ReLU - Res2Net Block Tasks: - Image Classification Training Techniques: - SGD with Momentum - Weight Decay Training Data: - ImageNet Training Resources: 4x Titan Xp GPUs ID: res2net50_26w_6s LR: 0.1 Epochs: 100 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/res2net.py#L163 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-res2net/res2net50_26w_6s-19041792.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 78.57% Top 5 Accuracy: 94.12% - Name: res2net50_26w_8s In Collection: Res2Net Metadata: FLOPs: 10760338992 Parameters: 48400000 File Size: 194085165 Architecture: - Batch Normalization - Convolution - Global Average Pooling - ReLU - Res2Net Block Tasks: - Image Classification Training Techniques: - SGD with Momentum - Weight Decay Training Data: - ImageNet Training Resources: 4x Titan Xp GPUs ID: res2net50_26w_8s LR: 0.1 Epochs: 100 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/res2net.py#L174 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-res2net/res2net50_26w_8s-2c7c9f12.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 79.19% Top 5 Accuracy: 94.37% - Name: res2net50_48w_2s In Collection: Res2Net Metadata: FLOPs: 5375291520 Parameters: 25290000 File Size: 101421406 Architecture: - Batch Normalization - Convolution - Global Average Pooling - ReLU - Res2Net Block Tasks: - Image Classification Training Techniques: - SGD with Momentum - Weight Decay Training Data: - ImageNet Training Resources: 4x Titan Xp GPUs ID: res2net50_48w_2s LR: 0.1 Epochs: 100 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 256 Image Size: '224' Weight Decay: 0.0001 Interpolation: bilinear Code: https://github.com/rwightman/pytorch-image-models/blob/d8e69206be253892b2956341fea09fdebfaae4e3/timm/models/res2net.py#L185 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-res2net/res2net50_48w_2s-afed724a.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 77.53% Top 5 Accuracy: 93.56% -->
pytorch-image-models/hfdocs/source/models/res2net.mdx/0
{ "file_path": "pytorch-image-models/hfdocs/source/models/res2net.mdx", "repo_id": "pytorch-image-models", "token_count": 3950 }
185
# (Tensorflow) EfficientNet CondConv **EfficientNet** is a convolutional neural network architecture and scaling method that uniformly scales all dimensions of depth/width/resolution using a *compound coefficient*. Unlike conventional practice that arbitrary scales these factors, the EfficientNet scaling method uniformly scales network width, depth, and resolution with a set of fixed scaling coefficients. For example, if we want to use \\( 2^N \\) times more computational resources, then we can simply increase the network depth by \\( \alpha ^ N \\), width by \\( \beta ^ N \\), and image size by \\( \gamma ^ N \\), where \\( \alpha, \beta, \gamma \\) are constant coefficients determined by a small grid search on the original small model. EfficientNet uses a compound coefficient \\( \phi \\) to uniformly scales network width, depth, and resolution in a principled way. The compound scaling method is justified by the intuition that if the input image is bigger, then the network needs more layers to increase the receptive field and more channels to capture more fine-grained patterns on the bigger image. The base EfficientNet-B0 network is based on the inverted bottleneck residual blocks of [MobileNetV2](https://paperswithcode.com/method/mobilenetv2), in addition to squeeze-and-excitation blocks. This collection of models amends EfficientNet by adding [CondConv](https://paperswithcode.com/method/condconv) convolutions. The weights from this model were ported from [Tensorflow/TPU](https://github.com/tensorflow/tpu). ## How do I use this model on an image? To load a pretrained model: ```py >>> import timm >>> model = timm.create_model('tf_efficientnet_cc_b0_4e', pretrained=True) >>> model.eval() ``` To load and preprocess the image: ```py >>> import urllib >>> from PIL import Image >>> from timm.data import resolve_data_config >>> from timm.data.transforms_factory import create_transform >>> config = resolve_data_config({}, model=model) >>> transform = create_transform(**config) >>> url, filename = ("https://github.com/pytorch/hub/raw/master/images/dog.jpg", "dog.jpg") >>> urllib.request.urlretrieve(url, filename) >>> img = Image.open(filename).convert('RGB') >>> tensor = transform(img).unsqueeze(0) # transform and add batch dimension ``` To get the model predictions: ```py >>> import torch >>> with torch.no_grad(): ... out = model(tensor) >>> probabilities = torch.nn.functional.softmax(out[0], dim=0) >>> print(probabilities.shape) >>> # prints: torch.Size([1000]) ``` To get the top-5 predictions class names: ```py >>> # Get imagenet class mappings >>> url, filename = ("https://raw.githubusercontent.com/pytorch/hub/master/imagenet_classes.txt", "imagenet_classes.txt") >>> urllib.request.urlretrieve(url, filename) >>> with open("imagenet_classes.txt", "r") as f: ... categories = [s.strip() for s in f.readlines()] >>> # Print top categories per image >>> top5_prob, top5_catid = torch.topk(probabilities, 5) >>> for i in range(top5_prob.size(0)): ... print(categories[top5_catid[i]], top5_prob[i].item()) >>> # prints class names and probabilities like: >>> # [('Samoyed', 0.6425196528434753), ('Pomeranian', 0.04062102362513542), ('keeshond', 0.03186424449086189), ('white wolf', 0.01739676296710968), ('Eskimo dog', 0.011717947199940681)] ``` Replace the model name with the variant you want to use, e.g. `tf_efficientnet_cc_b0_4e`. You can find the IDs in the model summaries at the top of this page. To extract image features with this model, follow the [timm feature extraction examples](../feature_extraction), just change the name of the model you want to use. ## How do I finetune this model? You can finetune any of the pre-trained models just by changing the classifier (the last layer). ```py >>> model = timm.create_model('tf_efficientnet_cc_b0_4e', pretrained=True, num_classes=NUM_FINETUNE_CLASSES) ``` To finetune on your own dataset, you have to write a training loop or adapt [timm's training script](https://github.com/rwightman/pytorch-image-models/blob/master/train.py) to use your dataset. ## How do I train this model? You can follow the [timm recipe scripts](../scripts) for training a new model afresh. ## Citation ```BibTeX @article{DBLP:journals/corr/abs-1904-04971, author = {Brandon Yang and Gabriel Bender and Quoc V. Le and Jiquan Ngiam}, title = {Soft Conditional Computation}, journal = {CoRR}, volume = {abs/1904.04971}, year = {2019}, url = {http://arxiv.org/abs/1904.04971}, archivePrefix = {arXiv}, eprint = {1904.04971}, timestamp = {Thu, 25 Apr 2019 13:55:01 +0200}, biburl = {https://dblp.org/rec/journals/corr/abs-1904-04971.bib}, bibsource = {dblp computer science bibliography, https://dblp.org} } ``` <!-- Type: model-index Collections: - Name: TF EfficientNet CondConv Paper: Title: 'CondConv: Conditionally Parameterized Convolutions for Efficient Inference' URL: https://paperswithcode.com/paper/soft-conditional-computation Models: - Name: tf_efficientnet_cc_b0_4e In Collection: TF EfficientNet CondConv Metadata: FLOPs: 224153788 Parameters: 13310000 File Size: 53490940 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - CondConv - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - Label Smoothing - RMSProp - Stochastic Depth - Weight Decay Training Data: - ImageNet ID: tf_efficientnet_cc_b0_4e LR: 0.256 Epochs: 350 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 2048 Image Size: '224' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1561 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_cc_b0_4e-4362b6b2.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 77.32% Top 5 Accuracy: 93.32% - Name: tf_efficientnet_cc_b0_8e In Collection: TF EfficientNet CondConv Metadata: FLOPs: 224158524 Parameters: 24010000 File Size: 96287616 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - CondConv - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - Label Smoothing - RMSProp - Stochastic Depth - Weight Decay Training Data: - ImageNet ID: tf_efficientnet_cc_b0_8e LR: 0.256 Epochs: 350 Crop Pct: '0.875' Momentum: 0.9 Batch Size: 2048 Image Size: '224' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1572 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_cc_b0_8e-66184a25.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 77.91% Top 5 Accuracy: 93.65% - Name: tf_efficientnet_cc_b1_8e In Collection: TF EfficientNet CondConv Metadata: FLOPs: 370427824 Parameters: 39720000 File Size: 159206198 Architecture: - 1x1 Convolution - Average Pooling - Batch Normalization - CondConv - Convolution - Dense Connections - Dropout - Inverted Residual Block - Squeeze-and-Excitation Block - Swish Tasks: - Image Classification Training Techniques: - AutoAugment - Label Smoothing - RMSProp - Stochastic Depth - Weight Decay Training Data: - ImageNet ID: tf_efficientnet_cc_b1_8e LR: 0.256 Epochs: 350 Crop Pct: '0.882' Momentum: 0.9 Batch Size: 2048 Image Size: '240' Weight Decay: 1.0e-05 Interpolation: bicubic RMSProp Decay: 0.9 Label Smoothing: 0.1 BatchNorm Momentum: 0.99 Code: https://github.com/rwightman/pytorch-image-models/blob/9a25fdf3ad0414b4d66da443fe60ae0aa14edc84/timm/models/efficientnet.py#L1584 Weights: https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights/tf_efficientnet_cc_b1_8e-f7c79ae1.pth Results: - Task: Image Classification Dataset: ImageNet Metrics: Top 1 Accuracy: 79.33% Top 5 Accuracy: 94.37% -->
pytorch-image-models/hfdocs/source/models/tf-efficientnet-condconv.mdx/0
{ "file_path": "pytorch-image-models/hfdocs/source/models/tf-efficientnet-condconv.mdx", "repo_id": "pytorch-image-models", "token_count": 3303 }
186
dependencies = ['torch'] import timm globals().update(timm.models._registry._model_entrypoints)
pytorch-image-models/hubconf.py/0
{ "file_path": "pytorch-image-models/hubconf.py", "repo_id": "pytorch-image-models", "token_count": 32 }
187
""" Dataset Factory Hacked together by / Copyright 2021, Ross Wightman """ import os from typing import Optional from torchvision.datasets import CIFAR100, CIFAR10, MNIST, KMNIST, FashionMNIST, ImageFolder try: from torchvision.datasets import Places365 has_places365 = True except ImportError: has_places365 = False try: from torchvision.datasets import INaturalist has_inaturalist = True except ImportError: has_inaturalist = False try: from torchvision.datasets import QMNIST has_qmnist = True except ImportError: has_qmnist = False try: from torchvision.datasets import ImageNet has_imagenet = True except ImportError: has_imagenet = False from .dataset import IterableImageDataset, ImageDataset _TORCH_BASIC_DS = dict( cifar10=CIFAR10, cifar100=CIFAR100, mnist=MNIST, kmnist=KMNIST, fashion_mnist=FashionMNIST, ) _TRAIN_SYNONYM = dict(train=None, training=None) _EVAL_SYNONYM = dict(val=None, valid=None, validation=None, eval=None, evaluation=None) def _search_split(root, split): # look for sub-folder with name of split in root and use that if it exists split_name = split.split('[')[0] try_root = os.path.join(root, split_name) if os.path.exists(try_root): return try_root def _try(syn): for s in syn: try_root = os.path.join(root, s) if os.path.exists(try_root): return try_root return root if split_name in _TRAIN_SYNONYM: root = _try(_TRAIN_SYNONYM) elif split_name in _EVAL_SYNONYM: root = _try(_EVAL_SYNONYM) return root def create_dataset( name: str, root: Optional[str] = None, split: str = 'validation', search_split: bool = True, class_map: dict = None, load_bytes: bool = False, is_training: bool = False, download: bool = False, batch_size: int = 1, num_samples: Optional[int] = None, seed: int = 42, repeats: int = 0, input_img_mode: str = 'RGB', **kwargs, ): """ Dataset factory method In parentheses after each arg are the type of dataset supported for each arg, one of: * folder - default, timm folder (or tar) based ImageDataset * torch - torchvision based datasets * HFDS - Hugging Face Datasets * TFDS - Tensorflow-datasets wrapper in IterabeDataset interface via IterableImageDataset * WDS - Webdataset * all - any of the above Args: name: dataset name, empty is okay for folder based datasets root: root folder of dataset (all) split: dataset split (all) search_split: search for split specific child fold from root so one can specify `imagenet/` instead of `/imagenet/val`, etc on cmd line / config. (folder, torch/folder) class_map: specify class -> index mapping via text file or dict (folder) load_bytes: load data, return images as undecoded bytes (folder) download: download dataset if not present and supported (HFDS, TFDS, torch) is_training: create dataset in train mode, this is different from the split. For Iterable / TDFS it enables shuffle, ignored for other datasets. (TFDS, WDS) batch_size: batch size hint for (TFDS, WDS) seed: seed for iterable datasets (TFDS, WDS) repeats: dataset repeats per iteration i.e. epoch (TFDS, WDS) input_img_mode: Input image color conversion mode e.g. 'RGB', 'L' (folder, TFDS, WDS, HFDS) **kwargs: other args to pass to dataset Returns: Dataset object """ kwargs = {k: v for k, v in kwargs.items() if v is not None} name = name.lower() if name.startswith('torch/'): name = name.split('/', 2)[-1] torch_kwargs = dict(root=root, download=download, **kwargs) if name in _TORCH_BASIC_DS: ds_class = _TORCH_BASIC_DS[name] use_train = split in _TRAIN_SYNONYM ds = ds_class(train=use_train, **torch_kwargs) elif name == 'inaturalist' or name == 'inat': assert has_inaturalist, 'Please update to PyTorch 1.10, torchvision 0.11+ for Inaturalist' target_type = 'full' split_split = split.split('/') if len(split_split) > 1: target_type = split_split[0].split('_') if len(target_type) == 1: target_type = target_type[0] split = split_split[-1] if split in _TRAIN_SYNONYM: split = '2021_train' elif split in _EVAL_SYNONYM: split = '2021_valid' ds = INaturalist(version=split, target_type=target_type, **torch_kwargs) elif name == 'places365': assert has_places365, 'Please update to a newer PyTorch and torchvision for Places365 dataset.' if split in _TRAIN_SYNONYM: split = 'train-standard' elif split in _EVAL_SYNONYM: split = 'val' ds = Places365(split=split, **torch_kwargs) elif name == 'qmnist': assert has_qmnist, 'Please update to a newer PyTorch and torchvision for QMNIST dataset.' use_train = split in _TRAIN_SYNONYM ds = QMNIST(train=use_train, **torch_kwargs) elif name == 'imagenet': assert has_imagenet, 'Please update to a newer PyTorch and torchvision for ImageNet dataset.' if split in _EVAL_SYNONYM: split = 'val' ds = ImageNet(split=split, **torch_kwargs) elif name == 'image_folder' or name == 'folder': # in case torchvision ImageFolder is preferred over timm ImageDataset for some reason if search_split and os.path.isdir(root): # look for split specific sub-folder in root root = _search_split(root, split) ds = ImageFolder(root, **kwargs) else: assert False, f"Unknown torchvision dataset {name}" elif name.startswith('hfds/'): # NOTE right now, HF datasets default arrow format is a random-access Dataset, # There will be a IterableDataset variant too, TBD ds = ImageDataset( root, reader=name, split=split, class_map=class_map, input_img_mode=input_img_mode, **kwargs, ) elif name.startswith('hfids/'): ds = IterableImageDataset( root, reader=name, split=split, class_map=class_map, is_training=is_training, download=download, batch_size=batch_size, num_samples=num_samples, repeats=repeats, seed=seed, input_img_mode=input_img_mode, **kwargs ) elif name.startswith('tfds/'): ds = IterableImageDataset( root, reader=name, split=split, class_map=class_map, is_training=is_training, download=download, batch_size=batch_size, num_samples=num_samples, repeats=repeats, seed=seed, input_img_mode=input_img_mode, **kwargs ) elif name.startswith('wds/'): ds = IterableImageDataset( root, reader=name, split=split, class_map=class_map, is_training=is_training, batch_size=batch_size, num_samples=num_samples, repeats=repeats, seed=seed, input_img_mode=input_img_mode, **kwargs ) else: # FIXME support more advance split cfg for ImageFolder/Tar datasets in the future if search_split and os.path.isdir(root): # look for split specific sub-folder in root root = _search_split(root, split) ds = ImageDataset( root, reader=name, class_map=class_map, load_bytes=load_bytes, input_img_mode=input_img_mode, **kwargs, ) return ds
pytorch-image-models/timm/data/dataset_factory.py/0
{ "file_path": "pytorch-image-models/timm/data/dataset_factory.py", "repo_id": "pytorch-image-models", "token_count": 3864 }
188
""" A dataset reader that reads single tarfile based datasets This reader can read datasets consisting if a single tarfile containing images. I am planning to deprecated it in favour of ParerImageInTar. Hacked together by / Copyright 2020 Ross Wightman """ import os import tarfile from timm.utils.misc import natural_key from .class_map import load_class_map from .img_extensions import get_img_extensions from .reader import Reader def extract_tarinfo(tarfile, class_to_idx=None, sort=True): extensions = get_img_extensions(as_set=True) files = [] labels = [] for ti in tarfile.getmembers(): if not ti.isfile(): continue dirname, basename = os.path.split(ti.path) label = os.path.basename(dirname) ext = os.path.splitext(basename)[1] if ext.lower() in extensions: files.append(ti) labels.append(label) if class_to_idx is None: unique_labels = set(labels) sorted_labels = list(sorted(unique_labels, key=natural_key)) class_to_idx = {c: idx for idx, c in enumerate(sorted_labels)} tarinfo_and_targets = [(f, class_to_idx[l]) for f, l in zip(files, labels) if l in class_to_idx] if sort: tarinfo_and_targets = sorted(tarinfo_and_targets, key=lambda k: natural_key(k[0].path)) return tarinfo_and_targets, class_to_idx class ReaderImageTar(Reader): """ Single tarfile dataset where classes are mapped to folders within tar NOTE: This class is being deprecated in favour of the more capable ReaderImageInTar that can operate on folders of tars or tars in tars. """ def __init__(self, root, class_map=''): super().__init__() class_to_idx = None if class_map: class_to_idx = load_class_map(class_map, root) assert os.path.isfile(root) self.root = root with tarfile.open(root) as tf: # cannot keep this open across processes, reopen later self.samples, self.class_to_idx = extract_tarinfo(tf, class_to_idx) self.imgs = self.samples self.tarfile = None # lazy init in __getitem__ def __getitem__(self, index): if self.tarfile is None: self.tarfile = tarfile.open(self.root) tarinfo, target = self.samples[index] fileobj = self.tarfile.extractfile(tarinfo) return fileobj, target def __len__(self): return len(self.samples) def _filename(self, index, basename=False, absolute=False): filename = self.samples[index][0].name if basename: filename = os.path.basename(filename) return filename
pytorch-image-models/timm/data/readers/reader_image_tar.py/0
{ "file_path": "pytorch-image-models/timm/data/readers/reader_image_tar.py", "repo_id": "pytorch-image-models", "token_count": 1071 }
189
""" Bottleneck Self Attention (Bottleneck Transformers) Paper: `Bottleneck Transformers for Visual Recognition` - https://arxiv.org/abs/2101.11605 @misc{2101.11605, Author = {Aravind Srinivas and Tsung-Yi Lin and Niki Parmar and Jonathon Shlens and Pieter Abbeel and Ashish Vaswani}, Title = {Bottleneck Transformers for Visual Recognition}, Year = {2021}, } Based on ref gist at: https://gist.github.com/aravindsrinivas/56359b79f0ce4449bcb04ab4b56a57a2 This impl is a WIP but given that it is based on the ref gist likely not too far off. Hacked together by / Copyright 2021 Ross Wightman """ from typing import List import torch import torch.nn as nn import torch.nn.functional as F from .helpers import to_2tuple, make_divisible from .weight_init import trunc_normal_ from .trace_utils import _assert def rel_logits_1d(q, rel_k, permute_mask: List[int]): """ Compute relative logits along one dimension As per: https://gist.github.com/aravindsrinivas/56359b79f0ce4449bcb04ab4b56a57a2 Originally from: `Attention Augmented Convolutional Networks` - https://arxiv.org/abs/1904.09925 Args: q: (batch, heads, height, width, dim) rel_k: (2 * width - 1, dim) permute_mask: permute output dim according to this """ B, H, W, dim = q.shape x = (q @ rel_k.transpose(-1, -2)) x = x.reshape(-1, W, 2 * W -1) # pad to shift from relative to absolute indexing x_pad = F.pad(x, [0, 1]).flatten(1) x_pad = F.pad(x_pad, [0, W - 1]) # reshape and slice out the padded elements x_pad = x_pad.reshape(-1, W + 1, 2 * W - 1) x = x_pad[:, :W, W - 1:] # reshape and tile x = x.reshape(B, H, 1, W, W).expand(-1, -1, H, -1, -1) return x.permute(permute_mask) class PosEmbedRel(nn.Module): """ Relative Position Embedding As per: https://gist.github.com/aravindsrinivas/56359b79f0ce4449bcb04ab4b56a57a2 Originally from: `Attention Augmented Convolutional Networks` - https://arxiv.org/abs/1904.09925 """ def __init__(self, feat_size, dim_head, scale): super().__init__() self.height, self.width = to_2tuple(feat_size) self.dim_head = dim_head self.height_rel = nn.Parameter(torch.randn(self.height * 2 - 1, dim_head) * scale) self.width_rel = nn.Parameter(torch.randn(self.width * 2 - 1, dim_head) * scale) def forward(self, q): B, HW, _ = q.shape # relative logits in width dimension. q = q.reshape(B, self.height, self.width, -1) rel_logits_w = rel_logits_1d(q, self.width_rel, permute_mask=(0, 1, 3, 2, 4)) # relative logits in height dimension. q = q.transpose(1, 2) rel_logits_h = rel_logits_1d(q, self.height_rel, permute_mask=(0, 3, 1, 4, 2)) rel_logits = rel_logits_h + rel_logits_w rel_logits = rel_logits.reshape(B, HW, HW) return rel_logits class BottleneckAttn(nn.Module): """ Bottleneck Attention Paper: `Bottleneck Transformers for Visual Recognition` - https://arxiv.org/abs/2101.11605 The internal dimensions of the attention module are controlled by the interaction of several arguments. * the output dimension of the module is specified by dim_out, which falls back to input dim if not set * the value (v) dimension is set to dim_out // num_heads, the v projection determines the output dim * the query and key (qk) dimensions are determined by * num_heads * dim_head if dim_head is not None * num_heads * (dim_out * attn_ratio // num_heads) if dim_head is None * as seen above, attn_ratio determines the ratio of q and k relative to the output if dim_head not used Args: dim (int): input dimension to the module dim_out (int): output dimension of the module, same as dim if not set stride (int): output stride of the module, avg pool used if stride == 2 (default: 1). num_heads (int): parallel attention heads (default: 4) dim_head (int): dimension of query and key heads, calculated from dim_out * attn_ratio // num_heads if not set qk_ratio (float): ratio of q and k dimensions to output dimension when dim_head not set. (default: 1.0) qkv_bias (bool): add bias to q, k, and v projections scale_pos_embed (bool): scale the position embedding as well as Q @ K """ def __init__( self, dim, dim_out=None, feat_size=None, stride=1, num_heads=4, dim_head=None, qk_ratio=1.0, qkv_bias=False, scale_pos_embed=False): super().__init__() assert feat_size is not None, 'A concrete feature size matching expected input (H, W) is required' dim_out = dim_out or dim assert dim_out % num_heads == 0 self.num_heads = num_heads self.dim_head_qk = dim_head or make_divisible(dim_out * qk_ratio, divisor=8) // num_heads self.dim_head_v = dim_out // self.num_heads self.dim_out_qk = num_heads * self.dim_head_qk self.dim_out_v = num_heads * self.dim_head_v self.scale = self.dim_head_qk ** -0.5 self.scale_pos_embed = scale_pos_embed self.qkv = nn.Conv2d(dim, self.dim_out_qk * 2 + self.dim_out_v, 1, bias=qkv_bias) # NOTE I'm only supporting relative pos embedding for now self.pos_embed = PosEmbedRel(feat_size, dim_head=self.dim_head_qk, scale=self.scale) self.pool = nn.AvgPool2d(2, 2) if stride == 2 else nn.Identity() self.reset_parameters() def reset_parameters(self): trunc_normal_(self.qkv.weight, std=self.qkv.weight.shape[1] ** -0.5) # fan-in trunc_normal_(self.pos_embed.height_rel, std=self.scale) trunc_normal_(self.pos_embed.width_rel, std=self.scale) def forward(self, x): B, C, H, W = x.shape _assert(H == self.pos_embed.height, '') _assert(W == self.pos_embed.width, '') x = self.qkv(x) # B, (2 * dim_head_qk + dim_head_v) * num_heads, H, W # NOTE head vs channel split ordering in qkv projection was decided before I allowed qk to differ from v # So, this is more verbose than if heads were before qkv splits, but throughput is not impacted. q, k, v = torch.split(x, [self.dim_out_qk, self.dim_out_qk, self.dim_out_v], dim=1) q = q.reshape(B * self.num_heads, self.dim_head_qk, -1).transpose(-1, -2) k = k.reshape(B * self.num_heads, self.dim_head_qk, -1) # no transpose, for q @ k v = v.reshape(B * self.num_heads, self.dim_head_v, -1).transpose(-1, -2) if self.scale_pos_embed: attn = (q @ k + self.pos_embed(q)) * self.scale # B * num_heads, H * W, H * W else: attn = (q @ k) * self.scale + self.pos_embed(q) attn = attn.softmax(dim=-1) out = (attn @ v).transpose(-1, -2).reshape(B, self.dim_out_v, H, W) # B, dim_out, H, W out = self.pool(out) return out
pytorch-image-models/timm/layers/bottleneck_attn.py/0
{ "file_path": "pytorch-image-models/timm/layers/bottleneck_attn.py", "repo_id": "pytorch-image-models", "token_count": 2907 }
190
""" Filter Response Norm in PyTorch Based on `Filter Response Normalization Layer` - https://arxiv.org/abs/1911.09737 Hacked together by / Copyright 2021 Ross Wightman """ import torch import torch.nn as nn from .create_act import create_act_layer from .trace_utils import _assert def inv_instance_rms(x, eps: float = 1e-5): rms = x.square().float().mean(dim=(2, 3), keepdim=True).add(eps).rsqrt().to(x.dtype) return rms.expand(x.shape) class FilterResponseNormTlu2d(nn.Module): def __init__(self, num_features, apply_act=True, eps=1e-5, rms=True, **_): super(FilterResponseNormTlu2d, self).__init__() self.apply_act = apply_act # apply activation (non-linearity) self.rms = rms self.eps = eps self.weight = nn.Parameter(torch.ones(num_features)) self.bias = nn.Parameter(torch.zeros(num_features)) self.tau = nn.Parameter(torch.zeros(num_features)) if apply_act else None self.reset_parameters() def reset_parameters(self): nn.init.ones_(self.weight) nn.init.zeros_(self.bias) if self.tau is not None: nn.init.zeros_(self.tau) def forward(self, x): _assert(x.dim() == 4, 'expected 4D input') x_dtype = x.dtype v_shape = (1, -1, 1, 1) x = x * inv_instance_rms(x, self.eps) x = x * self.weight.view(v_shape).to(dtype=x_dtype) + self.bias.view(v_shape).to(dtype=x_dtype) return torch.maximum(x, self.tau.reshape(v_shape).to(dtype=x_dtype)) if self.tau is not None else x class FilterResponseNormAct2d(nn.Module): def __init__(self, num_features, apply_act=True, act_layer=nn.ReLU, inplace=None, rms=True, eps=1e-5, **_): super(FilterResponseNormAct2d, self).__init__() if act_layer is not None and apply_act: self.act = create_act_layer(act_layer, inplace=inplace) else: self.act = nn.Identity() self.rms = rms self.eps = eps self.weight = nn.Parameter(torch.ones(num_features)) self.bias = nn.Parameter(torch.zeros(num_features)) self.reset_parameters() def reset_parameters(self): nn.init.ones_(self.weight) nn.init.zeros_(self.bias) def forward(self, x): _assert(x.dim() == 4, 'expected 4D input') x_dtype = x.dtype v_shape = (1, -1, 1, 1) x = x * inv_instance_rms(x, self.eps) x = x * self.weight.view(v_shape).to(dtype=x_dtype) + self.bias.view(v_shape).to(dtype=x_dtype) return self.act(x)
pytorch-image-models/timm/layers/filter_response_norm.py/0
{ "file_path": "pytorch-image-models/timm/layers/filter_response_norm.py", "repo_id": "pytorch-image-models", "token_count": 1182 }
191
""" Bilinear-Attention-Transform and Non-Local Attention Paper: `Non-Local Neural Networks With Grouped Bilinear Attentional Transforms` - https://openaccess.thecvf.com/content_CVPR_2020/html/Chi_Non-Local_Neural_Networks_With_Grouped_Bilinear_Attentional_Transforms_CVPR_2020_paper.html Adapted from original code: https://github.com/BA-Transform/BAT-Image-Classification """ import torch from torch import nn from torch.nn import functional as F from .conv_bn_act import ConvNormAct from .helpers import make_divisible from .trace_utils import _assert class NonLocalAttn(nn.Module): """Spatial NL block for image classification. This was adapted from https://github.com/BA-Transform/BAT-Image-Classification Their NonLocal impl inspired by https://github.com/facebookresearch/video-nonlocal-net. """ def __init__(self, in_channels, use_scale=True, rd_ratio=1/8, rd_channels=None, rd_divisor=8, **kwargs): super(NonLocalAttn, self).__init__() if rd_channels is None: rd_channels = make_divisible(in_channels * rd_ratio, divisor=rd_divisor) self.scale = in_channels ** -0.5 if use_scale else 1.0 self.t = nn.Conv2d(in_channels, rd_channels, kernel_size=1, stride=1, bias=True) self.p = nn.Conv2d(in_channels, rd_channels, kernel_size=1, stride=1, bias=True) self.g = nn.Conv2d(in_channels, rd_channels, kernel_size=1, stride=1, bias=True) self.z = nn.Conv2d(rd_channels, in_channels, kernel_size=1, stride=1, bias=True) self.norm = nn.BatchNorm2d(in_channels) self.reset_parameters() def forward(self, x): shortcut = x t = self.t(x) p = self.p(x) g = self.g(x) B, C, H, W = t.size() t = t.view(B, C, -1).permute(0, 2, 1) p = p.view(B, C, -1) g = g.view(B, C, -1).permute(0, 2, 1) att = torch.bmm(t, p) * self.scale att = F.softmax(att, dim=2) x = torch.bmm(att, g) x = x.permute(0, 2, 1).reshape(B, C, H, W) x = self.z(x) x = self.norm(x) + shortcut return x def reset_parameters(self): for name, m in self.named_modules(): if isinstance(m, nn.Conv2d): nn.init.kaiming_normal_( m.weight, mode='fan_out', nonlinearity='relu') if len(list(m.parameters())) > 1: nn.init.constant_(m.bias, 0.0) elif isinstance(m, nn.BatchNorm2d): nn.init.constant_(m.weight, 0) nn.init.constant_(m.bias, 0) elif isinstance(m, nn.GroupNorm): nn.init.constant_(m.weight, 0) nn.init.constant_(m.bias, 0) class BilinearAttnTransform(nn.Module): def __init__(self, in_channels, block_size, groups, act_layer=nn.ReLU, norm_layer=nn.BatchNorm2d): super(BilinearAttnTransform, self).__init__() self.conv1 = ConvNormAct(in_channels, groups, 1, act_layer=act_layer, norm_layer=norm_layer) self.conv_p = nn.Conv2d(groups, block_size * block_size * groups, kernel_size=(block_size, 1)) self.conv_q = nn.Conv2d(groups, block_size * block_size * groups, kernel_size=(1, block_size)) self.conv2 = ConvNormAct(in_channels, in_channels, 1, act_layer=act_layer, norm_layer=norm_layer) self.block_size = block_size self.groups = groups self.in_channels = in_channels def resize_mat(self, x, t: int): B, C, block_size, block_size1 = x.shape _assert(block_size == block_size1, '') if t <= 1: return x x = x.view(B * C, -1, 1, 1) x = x * torch.eye(t, t, dtype=x.dtype, device=x.device) x = x.view(B * C, block_size, block_size, t, t) x = torch.cat(torch.split(x, 1, dim=1), dim=3) x = torch.cat(torch.split(x, 1, dim=2), dim=4) x = x.view(B, C, block_size * t, block_size * t) return x def forward(self, x): _assert(x.shape[-1] % self.block_size == 0, '') _assert(x.shape[-2] % self.block_size == 0, '') B, C, H, W = x.shape out = self.conv1(x) rp = F.adaptive_max_pool2d(out, (self.block_size, 1)) cp = F.adaptive_max_pool2d(out, (1, self.block_size)) p = self.conv_p(rp).view(B, self.groups, self.block_size, self.block_size).sigmoid() q = self.conv_q(cp).view(B, self.groups, self.block_size, self.block_size).sigmoid() p = p / p.sum(dim=3, keepdim=True) q = q / q.sum(dim=2, keepdim=True) p = p.view(B, self.groups, 1, self.block_size, self.block_size).expand(x.size( 0), self.groups, C // self.groups, self.block_size, self.block_size).contiguous() p = p.view(B, C, self.block_size, self.block_size) q = q.view(B, self.groups, 1, self.block_size, self.block_size).expand(x.size( 0), self.groups, C // self.groups, self.block_size, self.block_size).contiguous() q = q.view(B, C, self.block_size, self.block_size) p = self.resize_mat(p, H // self.block_size) q = self.resize_mat(q, W // self.block_size) y = p.matmul(x) y = y.matmul(q) y = self.conv2(y) return y class BatNonLocalAttn(nn.Module): """ BAT Adapted from: https://github.com/BA-Transform/BAT-Image-Classification """ def __init__( self, in_channels, block_size=7, groups=2, rd_ratio=0.25, rd_channels=None, rd_divisor=8, drop_rate=0.2, act_layer=nn.ReLU, norm_layer=nn.BatchNorm2d, **_): super().__init__() if rd_channels is None: rd_channels = make_divisible(in_channels * rd_ratio, divisor=rd_divisor) self.conv1 = ConvNormAct(in_channels, rd_channels, 1, act_layer=act_layer, norm_layer=norm_layer) self.ba = BilinearAttnTransform(rd_channels, block_size, groups, act_layer=act_layer, norm_layer=norm_layer) self.conv2 = ConvNormAct(rd_channels, in_channels, 1, act_layer=act_layer, norm_layer=norm_layer) self.dropout = nn.Dropout2d(p=drop_rate) def forward(self, x): xl = self.conv1(x) y = self.ba(xl) y = self.conv2(y) y = self.dropout(y) return y + x
pytorch-image-models/timm/layers/non_local_attn.py/0
{ "file_path": "pytorch-image-models/timm/layers/non_local_attn.py", "repo_id": "pytorch-image-models", "token_count": 3028 }
192
""" Convolution with Weight Standardization (StdConv and ScaledStdConv) StdConv: @article{weightstandardization, author = {Siyuan Qiao and Huiyu Wang and Chenxi Liu and Wei Shen and Alan Yuille}, title = {Weight Standardization}, journal = {arXiv preprint arXiv:1903.10520}, year = {2019}, } Code: https://github.com/joe-siyuan-qiao/WeightStandardization ScaledStdConv: Paper: `Characterizing signal propagation to close the performance gap in unnormalized ResNets` - https://arxiv.org/abs/2101.08692 Official Deepmind JAX code: https://github.com/deepmind/deepmind-research/tree/master/nfnets Hacked together by / copyright Ross Wightman, 2021. """ import torch import torch.nn as nn import torch.nn.functional as F from .padding import get_padding, get_padding_value, pad_same class StdConv2d(nn.Conv2d): """Conv2d with Weight Standardization. Used for BiT ResNet-V2 models. Paper: `Micro-Batch Training with Batch-Channel Normalization and Weight Standardization` - https://arxiv.org/abs/1903.10520v2 """ def __init__( self, in_channel, out_channels, kernel_size, stride=1, padding=None, dilation=1, groups=1, bias=False, eps=1e-6): if padding is None: padding = get_padding(kernel_size, stride, dilation) super().__init__( in_channel, out_channels, kernel_size, stride=stride, padding=padding, dilation=dilation, groups=groups, bias=bias) self.eps = eps def forward(self, x): weight = F.batch_norm( self.weight.reshape(1, self.out_channels, -1), None, None, training=True, momentum=0., eps=self.eps).reshape_as(self.weight) x = F.conv2d(x, weight, self.bias, self.stride, self.padding, self.dilation, self.groups) return x class StdConv2dSame(nn.Conv2d): """Conv2d with Weight Standardization. TF compatible SAME padding. Used for ViT Hybrid model. Paper: `Micro-Batch Training with Batch-Channel Normalization and Weight Standardization` - https://arxiv.org/abs/1903.10520v2 """ def __init__( self, in_channel, out_channels, kernel_size, stride=1, padding='SAME', dilation=1, groups=1, bias=False, eps=1e-6): padding, is_dynamic = get_padding_value(padding, kernel_size, stride=stride, dilation=dilation) super().__init__( in_channel, out_channels, kernel_size, stride=stride, padding=padding, dilation=dilation, groups=groups, bias=bias) self.same_pad = is_dynamic self.eps = eps def forward(self, x): if self.same_pad: x = pad_same(x, self.kernel_size, self.stride, self.dilation) weight = F.batch_norm( self.weight.reshape(1, self.out_channels, -1), None, None, training=True, momentum=0., eps=self.eps).reshape_as(self.weight) x = F.conv2d(x, weight, self.bias, self.stride, self.padding, self.dilation, self.groups) return x class ScaledStdConv2d(nn.Conv2d): """Conv2d layer with Scaled Weight Standardization. Paper: `Characterizing signal propagation to close the performance gap in unnormalized ResNets` - https://arxiv.org/abs/2101.08692 NOTE: the operations used in this impl differ slightly from the DeepMind Haiku impl. The impact is minor. """ def __init__( self, in_channels, out_channels, kernel_size, stride=1, padding=None, dilation=1, groups=1, bias=True, gamma=1.0, eps=1e-6, gain_init=1.0): if padding is None: padding = get_padding(kernel_size, stride, dilation) super().__init__( in_channels, out_channels, kernel_size, stride=stride, padding=padding, dilation=dilation, groups=groups, bias=bias) self.gain = nn.Parameter(torch.full((self.out_channels, 1, 1, 1), gain_init)) self.scale = gamma * self.weight[0].numel() ** -0.5 # gamma * 1 / sqrt(fan-in) self.eps = eps def forward(self, x): weight = F.batch_norm( self.weight.reshape(1, self.out_channels, -1), None, None, weight=(self.gain * self.scale).view(-1), training=True, momentum=0., eps=self.eps).reshape_as(self.weight) return F.conv2d(x, weight, self.bias, self.stride, self.padding, self.dilation, self.groups) class ScaledStdConv2dSame(nn.Conv2d): """Conv2d layer with Scaled Weight Standardization and Tensorflow-like SAME padding support Paper: `Characterizing signal propagation to close the performance gap in unnormalized ResNets` - https://arxiv.org/abs/2101.08692 NOTE: the operations used in this impl differ slightly from the DeepMind Haiku impl. The impact is minor. """ def __init__( self, in_channels, out_channels, kernel_size, stride=1, padding='SAME', dilation=1, groups=1, bias=True, gamma=1.0, eps=1e-6, gain_init=1.0): padding, is_dynamic = get_padding_value(padding, kernel_size, stride=stride, dilation=dilation) super().__init__( in_channels, out_channels, kernel_size, stride=stride, padding=padding, dilation=dilation, groups=groups, bias=bias) self.gain = nn.Parameter(torch.full((self.out_channels, 1, 1, 1), gain_init)) self.scale = gamma * self.weight[0].numel() ** -0.5 self.same_pad = is_dynamic self.eps = eps def forward(self, x): if self.same_pad: x = pad_same(x, self.kernel_size, self.stride, self.dilation) weight = F.batch_norm( self.weight.reshape(1, self.out_channels, -1), None, None, weight=(self.gain * self.scale).view(-1), training=True, momentum=0., eps=self.eps).reshape_as(self.weight) return F.conv2d(x, weight, self.bias, self.stride, self.padding, self.dilation, self.groups)
pytorch-image-models/timm/layers/std_conv.py/0
{ "file_path": "pytorch-image-models/timm/layers/std_conv.py", "repo_id": "pytorch-image-models", "token_count": 2483 }
193
""" PyTorch FX Based Feature Extraction Helpers Using https://pytorch.org/vision/stable/feature_extraction.html """ from typing import Callable, List, Dict, Union, Type import torch from torch import nn from ._features import _get_feature_info, _get_return_layers try: from torchvision.models.feature_extraction import create_feature_extractor as _create_feature_extractor has_fx_feature_extraction = True except ImportError: has_fx_feature_extraction = False # Layers we went to treat as leaf modules from timm.layers import Conv2dSame, ScaledStdConv2dSame, CondConv2d, StdConv2dSame from timm.layers.non_local_attn import BilinearAttnTransform from timm.layers.pool2d_same import MaxPool2dSame, AvgPool2dSame from timm.layers.norm_act import ( BatchNormAct2d, SyncBatchNormAct, FrozenBatchNormAct2d, GroupNormAct, GroupNorm1Act, LayerNormAct, LayerNormAct2d ) __all__ = ['register_notrace_module', 'is_notrace_module', 'get_notrace_modules', 'register_notrace_function', 'is_notrace_function', 'get_notrace_functions', 'create_feature_extractor', 'FeatureGraphNet', 'GraphExtractNet'] # NOTE: By default, any modules from timm.models.layers that we want to treat as leaf modules go here # BUT modules from timm.models should use the registration mechanism below _leaf_modules = { BilinearAttnTransform, # reason: flow control t <= 1 # Reason: get_same_padding has a max which raises a control flow error Conv2dSame, MaxPool2dSame, ScaledStdConv2dSame, StdConv2dSame, AvgPool2dSame, CondConv2d, # reason: TypeError: F.conv2d received Proxy in groups=self.groups * B (because B = x.shape[0]), BatchNormAct2d, SyncBatchNormAct, FrozenBatchNormAct2d, GroupNormAct, GroupNorm1Act, LayerNormAct, LayerNormAct2d, } try: from timm.layers import InplaceAbn _leaf_modules.add(InplaceAbn) except ImportError: pass def register_notrace_module(module: Type[nn.Module]): """ Any module not under timm.models.layers should get this decorator if we don't want to trace through it. """ _leaf_modules.add(module) return module def is_notrace_module(module: Type[nn.Module]): return module in _leaf_modules def get_notrace_modules(): return list(_leaf_modules) # Functions we want to autowrap (treat them as leaves) _autowrap_functions = set() def register_notrace_function(func: Callable): """ Decorator for functions which ought not to be traced through """ _autowrap_functions.add(func) return func def is_notrace_function(func: Callable): return func in _autowrap_functions def get_notrace_functions(): return list(_autowrap_functions) def create_feature_extractor(model: nn.Module, return_nodes: Union[Dict[str, str], List[str]]): assert has_fx_feature_extraction, 'Please update to PyTorch 1.10+, torchvision 0.11+ for FX feature extraction' return _create_feature_extractor( model, return_nodes, tracer_kwargs={'leaf_modules': list(_leaf_modules), 'autowrap_functions': list(_autowrap_functions)} ) class FeatureGraphNet(nn.Module): """ A FX Graph based feature extractor that works with the model feature_info metadata """ def __init__(self, model, out_indices, out_map=None): super().__init__() assert has_fx_feature_extraction, 'Please update to PyTorch 1.10+, torchvision 0.11+ for FX feature extraction' self.feature_info = _get_feature_info(model, out_indices) if out_map is not None: assert len(out_map) == len(out_indices) return_nodes = _get_return_layers(self.feature_info, out_map) self.graph_module = create_feature_extractor(model, return_nodes) def forward(self, x): return list(self.graph_module(x).values()) class GraphExtractNet(nn.Module): """ A standalone feature extraction wrapper that maps dict -> list or single tensor NOTE: * one can use feature_extractor directly if dictionary output is desired * unlike FeatureGraphNet, this is intended to be used standalone and not with model feature_info metadata for builtin feature extraction mode * create_feature_extractor can be used directly if dictionary output is acceptable Args: model: model to extract features from return_nodes: node names to return features from (dict or list) squeeze_out: if only one output, and output in list format, flatten to single tensor """ def __init__(self, model, return_nodes: Union[Dict[str, str], List[str]], squeeze_out: bool = True): super().__init__() self.squeeze_out = squeeze_out self.graph_module = create_feature_extractor(model, return_nodes) def forward(self, x) -> Union[List[torch.Tensor], torch.Tensor]: out = list(self.graph_module(x).values()) if self.squeeze_out and len(out) == 1: return out[0] return out
pytorch-image-models/timm/models/_features_fx.py/0
{ "file_path": "pytorch-image-models/timm/models/_features_fx.py", "repo_id": "pytorch-image-models", "token_count": 1801 }
194
""" CoaT architecture. Paper: Co-Scale Conv-Attentional Image Transformers - https://arxiv.org/abs/2104.06399 Official CoaT code at: https://github.com/mlpc-ucsd/CoaT Modified from timm/models/vision_transformer.py """ from functools import partial from typing import Tuple, List, Union import torch import torch.nn as nn import torch.nn.functional as F from timm.data import IMAGENET_DEFAULT_MEAN, IMAGENET_DEFAULT_STD from timm.layers import PatchEmbed, Mlp, DropPath, to_2tuple, trunc_normal_, _assert, LayerNorm from ._builder import build_model_with_cfg from ._registry import register_model, generate_default_cfgs __all__ = ['CoaT'] class ConvRelPosEnc(nn.Module): """ Convolutional relative position encoding. """ def __init__(self, head_chs, num_heads, window): """ Initialization. Ch: Channels per head. h: Number of heads. window: Window size(s) in convolutional relative positional encoding. It can have two forms: 1. An integer of window size, which assigns all attention heads with the same window s size in ConvRelPosEnc. 2. A dict mapping window size to #attention head splits ( e.g. {window size 1: #attention head split 1, window size 2: #attention head split 2}) It will apply different window size to the attention head splits. """ super().__init__() if isinstance(window, int): # Set the same window size for all attention heads. window = {window: num_heads} self.window = window elif isinstance(window, dict): self.window = window else: raise ValueError() self.conv_list = nn.ModuleList() self.head_splits = [] for cur_window, cur_head_split in window.items(): dilation = 1 # Determine padding size. # Ref: https://discuss.pytorch.org/t/how-to-keep-the-shape-of-input-and-output-same-when-dilation-conv/14338 padding_size = (cur_window + (cur_window - 1) * (dilation - 1)) // 2 cur_conv = nn.Conv2d( cur_head_split * head_chs, cur_head_split * head_chs, kernel_size=(cur_window, cur_window), padding=(padding_size, padding_size), dilation=(dilation, dilation), groups=cur_head_split * head_chs, ) self.conv_list.append(cur_conv) self.head_splits.append(cur_head_split) self.channel_splits = [x * head_chs for x in self.head_splits] def forward(self, q, v, size: Tuple[int, int]): B, num_heads, N, C = q.shape H, W = size _assert(N == 1 + H * W, '') # Convolutional relative position encoding. q_img = q[:, :, 1:, :] # [B, h, H*W, Ch] v_img = v[:, :, 1:, :] # [B, h, H*W, Ch] v_img = v_img.transpose(-1, -2).reshape(B, num_heads * C, H, W) v_img_list = torch.split(v_img, self.channel_splits, dim=1) # Split according to channels conv_v_img_list = [] for i, conv in enumerate(self.conv_list): conv_v_img_list.append(conv(v_img_list[i])) conv_v_img = torch.cat(conv_v_img_list, dim=1) conv_v_img = conv_v_img.reshape(B, num_heads, C, H * W).transpose(-1, -2) EV_hat = q_img * conv_v_img EV_hat = F.pad(EV_hat, (0, 0, 1, 0, 0, 0)) # [B, h, N, Ch]. return EV_hat class FactorAttnConvRelPosEnc(nn.Module): """ Factorized attention with convolutional relative position encoding class. """ def __init__( self, dim, num_heads=8, qkv_bias=False, attn_drop=0., proj_drop=0., shared_crpe=None, ): super().__init__() self.num_heads = num_heads head_dim = dim // num_heads self.scale = head_dim ** -0.5 self.qkv = nn.Linear(dim, dim * 3, bias=qkv_bias) self.attn_drop = nn.Dropout(attn_drop) # Note: attn_drop is actually not used. self.proj = nn.Linear(dim, dim) self.proj_drop = nn.Dropout(proj_drop) # Shared convolutional relative position encoding. self.crpe = shared_crpe def forward(self, x, size: Tuple[int, int]): B, N, C = x.shape # Generate Q, K, V. qkv = self.qkv(x).reshape(B, N, 3, self.num_heads, C // self.num_heads).permute(2, 0, 3, 1, 4) q, k, v = qkv.unbind(0) # [B, h, N, Ch] # Factorized attention. k_softmax = k.softmax(dim=2) factor_att = k_softmax.transpose(-1, -2) @ v factor_att = q @ factor_att # Convolutional relative position encoding. crpe = self.crpe(q, v, size=size) # [B, h, N, Ch] # Merge and reshape. x = self.scale * factor_att + crpe x = x.transpose(1, 2).reshape(B, N, C) # [B, h, N, Ch] -> [B, N, h, Ch] -> [B, N, C] # Output projection. x = self.proj(x) x = self.proj_drop(x) return x class ConvPosEnc(nn.Module): """ Convolutional Position Encoding. Note: This module is similar to the conditional position encoding in CPVT. """ def __init__(self, dim, k=3): super(ConvPosEnc, self).__init__() self.proj = nn.Conv2d(dim, dim, k, 1, k//2, groups=dim) def forward(self, x, size: Tuple[int, int]): B, N, C = x.shape H, W = size _assert(N == 1 + H * W, '') # Extract CLS token and image tokens. cls_token, img_tokens = x[:, :1], x[:, 1:] # [B, 1, C], [B, H*W, C] # Depthwise convolution. feat = img_tokens.transpose(1, 2).view(B, C, H, W) x = self.proj(feat) + feat x = x.flatten(2).transpose(1, 2) # Combine with CLS token. x = torch.cat((cls_token, x), dim=1) return x class SerialBlock(nn.Module): """ Serial block class. Note: In this implementation, each serial block only contains a conv-attention and a FFN (MLP) module. """ def __init__( self, dim, num_heads, mlp_ratio=4., qkv_bias=False, proj_drop=0., attn_drop=0., drop_path=0., act_layer=nn.GELU, norm_layer=nn.LayerNorm, shared_cpe=None, shared_crpe=None, ): super().__init__() # Conv-Attention. self.cpe = shared_cpe self.norm1 = norm_layer(dim) self.factoratt_crpe = FactorAttnConvRelPosEnc( dim, num_heads=num_heads, qkv_bias=qkv_bias, attn_drop=attn_drop, proj_drop=proj_drop, shared_crpe=shared_crpe, ) self.drop_path = DropPath(drop_path) if drop_path > 0. else nn.Identity() # MLP. self.norm2 = norm_layer(dim) mlp_hidden_dim = int(dim * mlp_ratio) self.mlp = Mlp( in_features=dim, hidden_features=mlp_hidden_dim, act_layer=act_layer, drop=proj_drop, ) def forward(self, x, size: Tuple[int, int]): # Conv-Attention. x = self.cpe(x, size) cur = self.norm1(x) cur = self.factoratt_crpe(cur, size) x = x + self.drop_path(cur) # MLP. cur = self.norm2(x) cur = self.mlp(cur) x = x + self.drop_path(cur) return x class ParallelBlock(nn.Module): """ Parallel block class. """ def __init__( self, dims, num_heads, mlp_ratios=[], qkv_bias=False, proj_drop=0., attn_drop=0., drop_path=0., act_layer=nn.GELU, norm_layer=nn.LayerNorm, shared_crpes=None, ): super().__init__() # Conv-Attention. self.norm12 = norm_layer(dims[1]) self.norm13 = norm_layer(dims[2]) self.norm14 = norm_layer(dims[3]) self.factoratt_crpe2 = FactorAttnConvRelPosEnc( dims[1], num_heads=num_heads, qkv_bias=qkv_bias, attn_drop=attn_drop, proj_drop=proj_drop, shared_crpe=shared_crpes[1], ) self.factoratt_crpe3 = FactorAttnConvRelPosEnc( dims[2], num_heads=num_heads, qkv_bias=qkv_bias, attn_drop=attn_drop, proj_drop=proj_drop, shared_crpe=shared_crpes[2], ) self.factoratt_crpe4 = FactorAttnConvRelPosEnc( dims[3], num_heads=num_heads, qkv_bias=qkv_bias, attn_drop=attn_drop, proj_drop=proj_drop, shared_crpe=shared_crpes[3], ) self.drop_path = DropPath(drop_path) if drop_path > 0. else nn.Identity() # MLP. self.norm22 = norm_layer(dims[1]) self.norm23 = norm_layer(dims[2]) self.norm24 = norm_layer(dims[3]) # In parallel block, we assume dimensions are the same and share the linear transformation. assert dims[1] == dims[2] == dims[3] assert mlp_ratios[1] == mlp_ratios[2] == mlp_ratios[3] mlp_hidden_dim = int(dims[1] * mlp_ratios[1]) self.mlp2 = self.mlp3 = self.mlp4 = Mlp( in_features=dims[1], hidden_features=mlp_hidden_dim, act_layer=act_layer, drop=proj_drop, ) def upsample(self, x, factor: float, size: Tuple[int, int]): """ Feature map up-sampling. """ return self.interpolate(x, scale_factor=factor, size=size) def downsample(self, x, factor: float, size: Tuple[int, int]): """ Feature map down-sampling. """ return self.interpolate(x, scale_factor=1.0/factor, size=size) def interpolate(self, x, scale_factor: float, size: Tuple[int, int]): """ Feature map interpolation. """ B, N, C = x.shape H, W = size _assert(N == 1 + H * W, '') cls_token = x[:, :1, :] img_tokens = x[:, 1:, :] img_tokens = img_tokens.transpose(1, 2).reshape(B, C, H, W) img_tokens = F.interpolate( img_tokens, scale_factor=scale_factor, recompute_scale_factor=False, mode='bilinear', align_corners=False, ) img_tokens = img_tokens.reshape(B, C, -1).transpose(1, 2) out = torch.cat((cls_token, img_tokens), dim=1) return out def forward(self, x1, x2, x3, x4, sizes: List[Tuple[int, int]]): _, S2, S3, S4 = sizes cur2 = self.norm12(x2) cur3 = self.norm13(x3) cur4 = self.norm14(x4) cur2 = self.factoratt_crpe2(cur2, size=S2) cur3 = self.factoratt_crpe3(cur3, size=S3) cur4 = self.factoratt_crpe4(cur4, size=S4) upsample3_2 = self.upsample(cur3, factor=2., size=S3) upsample4_3 = self.upsample(cur4, factor=2., size=S4) upsample4_2 = self.upsample(cur4, factor=4., size=S4) downsample2_3 = self.downsample(cur2, factor=2., size=S2) downsample3_4 = self.downsample(cur3, factor=2., size=S3) downsample2_4 = self.downsample(cur2, factor=4., size=S2) cur2 = cur2 + upsample3_2 + upsample4_2 cur3 = cur3 + upsample4_3 + downsample2_3 cur4 = cur4 + downsample3_4 + downsample2_4 x2 = x2 + self.drop_path(cur2) x3 = x3 + self.drop_path(cur3) x4 = x4 + self.drop_path(cur4) # MLP. cur2 = self.norm22(x2) cur3 = self.norm23(x3) cur4 = self.norm24(x4) cur2 = self.mlp2(cur2) cur3 = self.mlp3(cur3) cur4 = self.mlp4(cur4) x2 = x2 + self.drop_path(cur2) x3 = x3 + self.drop_path(cur3) x4 = x4 + self.drop_path(cur4) return x1, x2, x3, x4 class CoaT(nn.Module): """ CoaT class. """ def __init__( self, img_size=224, patch_size=16, in_chans=3, num_classes=1000, embed_dims=(64, 128, 320, 512), serial_depths=(3, 4, 6, 3), parallel_depth=0, num_heads=8, mlp_ratios=(4, 4, 4, 4), qkv_bias=True, drop_rate=0., proj_drop_rate=0., attn_drop_rate=0., drop_path_rate=0., norm_layer=LayerNorm, return_interm_layers=False, out_features=None, crpe_window=None, global_pool='token', ): super().__init__() assert global_pool in ('token', 'avg') crpe_window = crpe_window or {3: 2, 5: 3, 7: 3} self.return_interm_layers = return_interm_layers self.out_features = out_features self.embed_dims = embed_dims self.num_features = embed_dims[-1] self.num_classes = num_classes self.global_pool = global_pool # Patch embeddings. img_size = to_2tuple(img_size) self.patch_embed1 = PatchEmbed( img_size=img_size, patch_size=patch_size, in_chans=in_chans, embed_dim=embed_dims[0], norm_layer=nn.LayerNorm) self.patch_embed2 = PatchEmbed( img_size=[x // 4 for x in img_size], patch_size=2, in_chans=embed_dims[0], embed_dim=embed_dims[1], norm_layer=nn.LayerNorm) self.patch_embed3 = PatchEmbed( img_size=[x // 8 for x in img_size], patch_size=2, in_chans=embed_dims[1], embed_dim=embed_dims[2], norm_layer=nn.LayerNorm) self.patch_embed4 = PatchEmbed( img_size=[x // 16 for x in img_size], patch_size=2, in_chans=embed_dims[2], embed_dim=embed_dims[3], norm_layer=nn.LayerNorm) # Class tokens. self.cls_token1 = nn.Parameter(torch.zeros(1, 1, embed_dims[0])) self.cls_token2 = nn.Parameter(torch.zeros(1, 1, embed_dims[1])) self.cls_token3 = nn.Parameter(torch.zeros(1, 1, embed_dims[2])) self.cls_token4 = nn.Parameter(torch.zeros(1, 1, embed_dims[3])) # Convolutional position encodings. self.cpe1 = ConvPosEnc(dim=embed_dims[0], k=3) self.cpe2 = ConvPosEnc(dim=embed_dims[1], k=3) self.cpe3 = ConvPosEnc(dim=embed_dims[2], k=3) self.cpe4 = ConvPosEnc(dim=embed_dims[3], k=3) # Convolutional relative position encodings. self.crpe1 = ConvRelPosEnc(head_chs=embed_dims[0] // num_heads, num_heads=num_heads, window=crpe_window) self.crpe2 = ConvRelPosEnc(head_chs=embed_dims[1] // num_heads, num_heads=num_heads, window=crpe_window) self.crpe3 = ConvRelPosEnc(head_chs=embed_dims[2] // num_heads, num_heads=num_heads, window=crpe_window) self.crpe4 = ConvRelPosEnc(head_chs=embed_dims[3] // num_heads, num_heads=num_heads, window=crpe_window) # Disable stochastic depth. dpr = drop_path_rate assert dpr == 0.0 skwargs = dict( num_heads=num_heads, qkv_bias=qkv_bias, proj_drop=proj_drop_rate, attn_drop=attn_drop_rate, drop_path=dpr, norm_layer=norm_layer, ) # Serial blocks 1. self.serial_blocks1 = nn.ModuleList([ SerialBlock( dim=embed_dims[0], mlp_ratio=mlp_ratios[0], shared_cpe=self.cpe1, shared_crpe=self.crpe1, **skwargs, ) for _ in range(serial_depths[0])] ) # Serial blocks 2. self.serial_blocks2 = nn.ModuleList([ SerialBlock( dim=embed_dims[1], mlp_ratio=mlp_ratios[1], shared_cpe=self.cpe2, shared_crpe=self.crpe2, **skwargs, ) for _ in range(serial_depths[1])] ) # Serial blocks 3. self.serial_blocks3 = nn.ModuleList([ SerialBlock( dim=embed_dims[2], mlp_ratio=mlp_ratios[2], shared_cpe=self.cpe3, shared_crpe=self.crpe3, **skwargs, ) for _ in range(serial_depths[2])] ) # Serial blocks 4. self.serial_blocks4 = nn.ModuleList([ SerialBlock( dim=embed_dims[3], mlp_ratio=mlp_ratios[3], shared_cpe=self.cpe4, shared_crpe=self.crpe4, **skwargs, ) for _ in range(serial_depths[3])] ) # Parallel blocks. self.parallel_depth = parallel_depth if self.parallel_depth > 0: self.parallel_blocks = nn.ModuleList([ ParallelBlock( dims=embed_dims, mlp_ratios=mlp_ratios, shared_crpes=(self.crpe1, self.crpe2, self.crpe3, self.crpe4), **skwargs, ) for _ in range(parallel_depth)] ) else: self.parallel_blocks = None # Classification head(s). if not self.return_interm_layers: if self.parallel_blocks is not None: self.norm2 = norm_layer(embed_dims[1]) self.norm3 = norm_layer(embed_dims[2]) else: self.norm2 = self.norm3 = None self.norm4 = norm_layer(embed_dims[3]) if self.parallel_depth > 0: # CoaT series: Aggregate features of last three scales for classification. assert embed_dims[1] == embed_dims[2] == embed_dims[3] self.aggregate = torch.nn.Conv1d(in_channels=3, out_channels=1, kernel_size=1) self.head_drop = nn.Dropout(drop_rate) self.head = nn.Linear(self.num_features, num_classes) if num_classes > 0 else nn.Identity() else: # CoaT-Lite series: Use feature of last scale for classification. self.aggregate = None self.head_drop = nn.Dropout(drop_rate) self.head = nn.Linear(self.num_features, num_classes) if num_classes > 0 else nn.Identity() # Initialize weights. trunc_normal_(self.cls_token1, std=.02) trunc_normal_(self.cls_token2, std=.02) trunc_normal_(self.cls_token3, std=.02) trunc_normal_(self.cls_token4, std=.02) self.apply(self._init_weights) def _init_weights(self, m): if isinstance(m, nn.Linear): trunc_normal_(m.weight, std=.02) if isinstance(m, nn.Linear) and m.bias is not None: nn.init.constant_(m.bias, 0) elif isinstance(m, nn.LayerNorm): nn.init.constant_(m.bias, 0) nn.init.constant_(m.weight, 1.0) @torch.jit.ignore def no_weight_decay(self): return {'cls_token1', 'cls_token2', 'cls_token3', 'cls_token4'} @torch.jit.ignore def set_grad_checkpointing(self, enable=True): assert not enable, 'gradient checkpointing not supported' @torch.jit.ignore def group_matcher(self, coarse=False): matcher = dict( stem1=r'^cls_token1|patch_embed1|crpe1|cpe1', serial_blocks1=r'^serial_blocks1\.(\d+)', stem2=r'^cls_token2|patch_embed2|crpe2|cpe2', serial_blocks2=r'^serial_blocks2\.(\d+)', stem3=r'^cls_token3|patch_embed3|crpe3|cpe3', serial_blocks3=r'^serial_blocks3\.(\d+)', stem4=r'^cls_token4|patch_embed4|crpe4|cpe4', serial_blocks4=r'^serial_blocks4\.(\d+)', parallel_blocks=[ # FIXME (partially?) overlap parallel w/ serial blocks?? (r'^parallel_blocks\.(\d+)', None), (r'^norm|aggregate', (99999,)), ] ) return matcher @torch.jit.ignore def get_classifier(self): return self.head def reset_classifier(self, num_classes, global_pool=None): self.num_classes = num_classes if global_pool is not None: assert global_pool in ('token', 'avg') self.global_pool = global_pool self.head = nn.Linear(self.num_features, num_classes) if num_classes > 0 else nn.Identity() def forward_features(self, x0): B = x0.shape[0] # Serial blocks 1. x1 = self.patch_embed1(x0) H1, W1 = self.patch_embed1.grid_size x1 = insert_cls(x1, self.cls_token1) for blk in self.serial_blocks1: x1 = blk(x1, size=(H1, W1)) x1_nocls = remove_cls(x1).reshape(B, H1, W1, -1).permute(0, 3, 1, 2).contiguous() # Serial blocks 2. x2 = self.patch_embed2(x1_nocls) H2, W2 = self.patch_embed2.grid_size x2 = insert_cls(x2, self.cls_token2) for blk in self.serial_blocks2: x2 = blk(x2, size=(H2, W2)) x2_nocls = remove_cls(x2).reshape(B, H2, W2, -1).permute(0, 3, 1, 2).contiguous() # Serial blocks 3. x3 = self.patch_embed3(x2_nocls) H3, W3 = self.patch_embed3.grid_size x3 = insert_cls(x3, self.cls_token3) for blk in self.serial_blocks3: x3 = blk(x3, size=(H3, W3)) x3_nocls = remove_cls(x3).reshape(B, H3, W3, -1).permute(0, 3, 1, 2).contiguous() # Serial blocks 4. x4 = self.patch_embed4(x3_nocls) H4, W4 = self.patch_embed4.grid_size x4 = insert_cls(x4, self.cls_token4) for blk in self.serial_blocks4: x4 = blk(x4, size=(H4, W4)) x4_nocls = remove_cls(x4).reshape(B, H4, W4, -1).permute(0, 3, 1, 2).contiguous() # Only serial blocks: Early return. if self.parallel_blocks is None: if not torch.jit.is_scripting() and self.return_interm_layers: # Return intermediate features for down-stream tasks (e.g. Deformable DETR and Detectron2). feat_out = {} if 'x1_nocls' in self.out_features: feat_out['x1_nocls'] = x1_nocls if 'x2_nocls' in self.out_features: feat_out['x2_nocls'] = x2_nocls if 'x3_nocls' in self.out_features: feat_out['x3_nocls'] = x3_nocls if 'x4_nocls' in self.out_features: feat_out['x4_nocls'] = x4_nocls return feat_out else: # Return features for classification. x4 = self.norm4(x4) return x4 # Parallel blocks. for blk in self.parallel_blocks: x2, x3, x4 = self.cpe2(x2, (H2, W2)), self.cpe3(x3, (H3, W3)), self.cpe4(x4, (H4, W4)) x1, x2, x3, x4 = blk(x1, x2, x3, x4, sizes=[(H1, W1), (H2, W2), (H3, W3), (H4, W4)]) if not torch.jit.is_scripting() and self.return_interm_layers: # Return intermediate features for down-stream tasks (e.g. Deformable DETR and Detectron2). feat_out = {} if 'x1_nocls' in self.out_features: x1_nocls = remove_cls(x1).reshape(B, H1, W1, -1).permute(0, 3, 1, 2).contiguous() feat_out['x1_nocls'] = x1_nocls if 'x2_nocls' in self.out_features: x2_nocls = remove_cls(x2).reshape(B, H2, W2, -1).permute(0, 3, 1, 2).contiguous() feat_out['x2_nocls'] = x2_nocls if 'x3_nocls' in self.out_features: x3_nocls = remove_cls(x3).reshape(B, H3, W3, -1).permute(0, 3, 1, 2).contiguous() feat_out['x3_nocls'] = x3_nocls if 'x4_nocls' in self.out_features: x4_nocls = remove_cls(x4).reshape(B, H4, W4, -1).permute(0, 3, 1, 2).contiguous() feat_out['x4_nocls'] = x4_nocls return feat_out else: x2 = self.norm2(x2) x3 = self.norm3(x3) x4 = self.norm4(x4) return [x2, x3, x4] def forward_head(self, x_feat: Union[torch.Tensor, List[torch.Tensor]], pre_logits: bool = False): if isinstance(x_feat, list): assert self.aggregate is not None if self.global_pool == 'avg': x = torch.cat([xl[:, 1:].mean(dim=1, keepdim=True) for xl in x_feat], dim=1) # [B, 3, C] else: x = torch.stack([xl[:, 0] for xl in x_feat], dim=1) # [B, 3, C] x = self.aggregate(x).squeeze(dim=1) # Shape: [B, C] else: x = x_feat[:, 1:].mean(dim=1) if self.global_pool == 'avg' else x_feat[:, 0] x = self.head_drop(x) return x if pre_logits else self.head(x) def forward(self, x) -> torch.Tensor: if not torch.jit.is_scripting() and self.return_interm_layers: # Return intermediate features (for down-stream tasks). return self.forward_features(x) else: # Return features for classification. x_feat = self.forward_features(x) x = self.forward_head(x_feat) return x def insert_cls(x, cls_token): """ Insert CLS token. """ cls_tokens = cls_token.expand(x.shape[0], -1, -1) x = torch.cat((cls_tokens, x), dim=1) return x def remove_cls(x): """ Remove CLS token. """ return x[:, 1:, :] def checkpoint_filter_fn(state_dict, model): out_dict = {} state_dict = state_dict.get('model', state_dict) for k, v in state_dict.items(): # original model had unused norm layers, removing them requires filtering pretrained checkpoints if k.startswith('norm1') or \ (k.startswith('norm2') and getattr(model, 'norm2', None) is None) or \ (k.startswith('norm3') and getattr(model, 'norm3', None) is None) or \ (k.startswith('norm4') and getattr(model, 'norm4', None) is None) or \ (k.startswith('aggregate') and getattr(model, 'aggregate', None) is None) or \ (k.startswith('head') and getattr(model, 'head', None) is None): continue out_dict[k] = v return out_dict def _create_coat(variant, pretrained=False, default_cfg=None, **kwargs): if kwargs.get('features_only', None): raise RuntimeError('features_only not implemented for Vision Transformer models.') model = build_model_with_cfg( CoaT, variant, pretrained, pretrained_filter_fn=checkpoint_filter_fn, **kwargs, ) return model def _cfg_coat(url='', **kwargs): return { 'url': url, 'num_classes': 1000, 'input_size': (3, 224, 224), 'pool_size': None, 'crop_pct': .9, 'interpolation': 'bicubic', 'fixed_input_size': True, 'mean': IMAGENET_DEFAULT_MEAN, 'std': IMAGENET_DEFAULT_STD, 'first_conv': 'patch_embed1.proj', 'classifier': 'head', **kwargs } default_cfgs = generate_default_cfgs({ 'coat_tiny.in1k': _cfg_coat(hf_hub_id='timm/'), 'coat_mini.in1k': _cfg_coat(hf_hub_id='timm/'), 'coat_small.in1k': _cfg_coat(hf_hub_id='timm/'), 'coat_lite_tiny.in1k': _cfg_coat(hf_hub_id='timm/'), 'coat_lite_mini.in1k': _cfg_coat(hf_hub_id='timm/'), 'coat_lite_small.in1k': _cfg_coat(hf_hub_id='timm/'), 'coat_lite_medium.in1k': _cfg_coat(hf_hub_id='timm/'), 'coat_lite_medium_384.in1k': _cfg_coat( hf_hub_id='timm/', input_size=(3, 384, 384), crop_pct=1.0, crop_mode='squash', ), }) @register_model def coat_tiny(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( patch_size=4, embed_dims=[152, 152, 152, 152], serial_depths=[2, 2, 2, 2], parallel_depth=6) model = _create_coat('coat_tiny', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model @register_model def coat_mini(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( patch_size=4, embed_dims=[152, 216, 216, 216], serial_depths=[2, 2, 2, 2], parallel_depth=6) model = _create_coat('coat_mini', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model @register_model def coat_small(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( patch_size=4, embed_dims=[152, 320, 320, 320], serial_depths=[2, 2, 2, 2], parallel_depth=6, **kwargs) model = _create_coat('coat_small', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model @register_model def coat_lite_tiny(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( patch_size=4, embed_dims=[64, 128, 256, 320], serial_depths=[2, 2, 2, 2], mlp_ratios=[8, 8, 4, 4]) model = _create_coat('coat_lite_tiny', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model @register_model def coat_lite_mini(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( patch_size=4, embed_dims=[64, 128, 320, 512], serial_depths=[2, 2, 2, 2], mlp_ratios=[8, 8, 4, 4]) model = _create_coat('coat_lite_mini', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model @register_model def coat_lite_small(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( patch_size=4, embed_dims=[64, 128, 320, 512], serial_depths=[3, 4, 6, 3], mlp_ratios=[8, 8, 4, 4]) model = _create_coat('coat_lite_small', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model @register_model def coat_lite_medium(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( patch_size=4, embed_dims=[128, 256, 320, 512], serial_depths=[3, 6, 10, 8]) model = _create_coat('coat_lite_medium', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model @register_model def coat_lite_medium_384(pretrained=False, **kwargs) -> CoaT: model_cfg = dict( img_size=384, patch_size=4, embed_dims=[128, 256, 320, 512], serial_depths=[3, 6, 10, 8]) model = _create_coat('coat_lite_medium_384', pretrained=pretrained, **dict(model_cfg, **kwargs)) return model
pytorch-image-models/timm/models/coat.py/0
{ "file_path": "pytorch-image-models/timm/models/coat.py", "repo_id": "pytorch-image-models", "token_count": 15685 }
195
""" EfficientViT (by MSRA) Paper: `EfficientViT: Memory Efficient Vision Transformer with Cascaded Group Attention` - https://arxiv.org/abs/2305.07027 Adapted from official impl at https://github.com/microsoft/Cream/tree/main/EfficientViT """ __all__ = ['EfficientVitMsra'] import itertools from collections import OrderedDict from typing import Dict import torch import torch.nn as nn from timm.data import IMAGENET_DEFAULT_MEAN, IMAGENET_DEFAULT_STD from timm.layers import SqueezeExcite, SelectAdaptivePool2d, trunc_normal_, _assert from ._builder import build_model_with_cfg from ._manipulate import checkpoint_seq from ._registry import register_model, generate_default_cfgs class ConvNorm(torch.nn.Sequential): def __init__(self, in_chs, out_chs, ks=1, stride=1, pad=0, dilation=1, groups=1, bn_weight_init=1): super().__init__() self.conv = nn.Conv2d(in_chs, out_chs, ks, stride, pad, dilation, groups, bias=False) self.bn = nn.BatchNorm2d(out_chs) torch.nn.init.constant_(self.bn.weight, bn_weight_init) torch.nn.init.constant_(self.bn.bias, 0) @torch.no_grad() def fuse(self): c, bn = self.conv, self.bn w = bn.weight / (bn.running_var + bn.eps)**0.5 w = c.weight * w[:, None, None, None] b = bn.bias - bn.running_mean * bn.weight / \ (bn.running_var + bn.eps)**0.5 m = torch.nn.Conv2d( w.size(1) * self.conv.groups, w.size(0), w.shape[2:], stride=self.conv.stride, padding=self.conv.padding, dilation=self.conv.dilation, groups=self.conv.groups) m.weight.data.copy_(w) m.bias.data.copy_(b) return m class NormLinear(torch.nn.Sequential): def __init__(self, in_features, out_features, bias=True, std=0.02, drop=0.): super().__init__() self.bn = nn.BatchNorm1d(in_features) self.drop = nn.Dropout(drop) self.linear = nn.Linear(in_features, out_features, bias=bias) trunc_normal_(self.linear.weight, std=std) if self.linear.bias is not None: nn.init.constant_(self.linear.bias, 0) @torch.no_grad() def fuse(self): bn, linear = self.bn, self.linear w = bn.weight / (bn.running_var + bn.eps)**0.5 b = bn.bias - self.bn.running_mean * \ self.bn.weight / (bn.running_var + bn.eps)**0.5 w = linear.weight * w[None, :] if linear.bias is None: b = b @ self.linear.weight.T else: b = (linear.weight @ b[:, None]).view(-1) + self.linear.bias m = torch.nn.Linear(w.size(1), w.size(0)) m.weight.data.copy_(w) m.bias.data.copy_(b) return m class PatchMerging(torch.nn.Module): def __init__(self, dim, out_dim): super().__init__() hid_dim = int(dim * 4) self.conv1 = ConvNorm(dim, hid_dim, 1, 1, 0) self.act = torch.nn.ReLU() self.conv2 = ConvNorm(hid_dim, hid_dim, 3, 2, 1, groups=hid_dim) self.se = SqueezeExcite(hid_dim, .25) self.conv3 = ConvNorm(hid_dim, out_dim, 1, 1, 0) def forward(self, x): x = self.conv3(self.se(self.act(self.conv2(self.act(self.conv1(x)))))) return x class ResidualDrop(torch.nn.Module): def __init__(self, m, drop=0.): super().__init__() self.m = m self.drop = drop def forward(self, x): if self.training and self.drop > 0: return x + self.m(x) * torch.rand( x.size(0), 1, 1, 1, device=x.device).ge_(self.drop).div(1 - self.drop).detach() else: return x + self.m(x) class ConvMlp(torch.nn.Module): def __init__(self, ed, h): super().__init__() self.pw1 = ConvNorm(ed, h) self.act = torch.nn.ReLU() self.pw2 = ConvNorm(h, ed, bn_weight_init=0) def forward(self, x): x = self.pw2(self.act(self.pw1(x))) return x class CascadedGroupAttention(torch.nn.Module): attention_bias_cache: Dict[str, torch.Tensor] r""" Cascaded Group Attention. Args: dim (int): Number of input channels. key_dim (int): The dimension for query and key. num_heads (int): Number of attention heads. attn_ratio (int): Multiplier for the query dim for value dimension. resolution (int): Input resolution, correspond to the window size. kernels (List[int]): The kernel size of the dw conv on query. """ def __init__( self, dim, key_dim, num_heads=8, attn_ratio=4, resolution=14, kernels=(5, 5, 5, 5), ): super().__init__() self.num_heads = num_heads self.scale = key_dim ** -0.5 self.key_dim = key_dim self.val_dim = int(attn_ratio * key_dim) self.attn_ratio = attn_ratio qkvs = [] dws = [] for i in range(num_heads): qkvs.append(ConvNorm(dim // (num_heads), self.key_dim * 2 + self.val_dim)) dws.append(ConvNorm(self.key_dim, self.key_dim, kernels[i], 1, kernels[i] // 2, groups=self.key_dim)) self.qkvs = torch.nn.ModuleList(qkvs) self.dws = torch.nn.ModuleList(dws) self.proj = torch.nn.Sequential( torch.nn.ReLU(), ConvNorm(self.val_dim * num_heads, dim, bn_weight_init=0) ) points = list(itertools.product(range(resolution), range(resolution))) N = len(points) attention_offsets = {} idxs = [] for p1 in points: for p2 in points: offset = (abs(p1[0] - p2[0]), abs(p1[1] - p2[1])) if offset not in attention_offsets: attention_offsets[offset] = len(attention_offsets) idxs.append(attention_offsets[offset]) self.attention_biases = torch.nn.Parameter(torch.zeros(num_heads, len(attention_offsets))) self.register_buffer('attention_bias_idxs', torch.LongTensor(idxs).view(N, N), persistent=False) self.attention_bias_cache = {} @torch.no_grad() def train(self, mode=True): super().train(mode) if mode and self.attention_bias_cache: self.attention_bias_cache = {} # clear ab cache def get_attention_biases(self, device: torch.device) -> torch.Tensor: if torch.jit.is_tracing() or self.training: return self.attention_biases[:, self.attention_bias_idxs] else: device_key = str(device) if device_key not in self.attention_bias_cache: self.attention_bias_cache[device_key] = self.attention_biases[:, self.attention_bias_idxs] return self.attention_bias_cache[device_key] def forward(self, x): B, C, H, W = x.shape feats_in = x.chunk(len(self.qkvs), dim=1) feats_out = [] feat = feats_in[0] attn_bias = self.get_attention_biases(x.device) for head_idx, (qkv, dws) in enumerate(zip(self.qkvs, self.dws)): if head_idx > 0: feat = feat + feats_in[head_idx] feat = qkv(feat) q, k, v = feat.view(B, -1, H, W).split([self.key_dim, self.key_dim, self.val_dim], dim=1) q = dws(q) q, k, v = q.flatten(2), k.flatten(2), v.flatten(2) q = q * self.scale attn = q.transpose(-2, -1) @ k attn = attn + attn_bias[head_idx] attn = attn.softmax(dim=-1) feat = v @ attn.transpose(-2, -1) feat = feat.view(B, self.val_dim, H, W) feats_out.append(feat) x = self.proj(torch.cat(feats_out, 1)) return x class LocalWindowAttention(torch.nn.Module): r""" Local Window Attention. Args: dim (int): Number of input channels. key_dim (int): The dimension for query and key. num_heads (int): Number of attention heads. attn_ratio (int): Multiplier for the query dim for value dimension. resolution (int): Input resolution. window_resolution (int): Local window resolution. kernels (List[int]): The kernel size of the dw conv on query. """ def __init__( self, dim, key_dim, num_heads=8, attn_ratio=4, resolution=14, window_resolution=7, kernels=(5, 5, 5, 5), ): super().__init__() self.dim = dim self.num_heads = num_heads self.resolution = resolution assert window_resolution > 0, 'window_size must be greater than 0' self.window_resolution = window_resolution window_resolution = min(window_resolution, resolution) self.attn = CascadedGroupAttention( dim, key_dim, num_heads, attn_ratio=attn_ratio, resolution=window_resolution, kernels=kernels, ) def forward(self, x): H = W = self.resolution B, C, H_, W_ = x.shape # Only check this for classifcation models _assert(H == H_, f'input feature has wrong size, expect {(H, W)}, got {(H_, W_)}') _assert(W == W_, f'input feature has wrong size, expect {(H, W)}, got {(H_, W_)}') if H <= self.window_resolution and W <= self.window_resolution: x = self.attn(x) else: x = x.permute(0, 2, 3, 1) pad_b = (self.window_resolution - H % self.window_resolution) % self.window_resolution pad_r = (self.window_resolution - W % self.window_resolution) % self.window_resolution x = torch.nn.functional.pad(x, (0, 0, 0, pad_r, 0, pad_b)) pH, pW = H + pad_b, W + pad_r nH = pH // self.window_resolution nW = pW // self.window_resolution # window partition, BHWC -> B(nHh)(nWw)C -> BnHnWhwC -> (BnHnW)hwC -> (BnHnW)Chw x = x.view(B, nH, self.window_resolution, nW, self.window_resolution, C).transpose(2, 3) x = x.reshape(B * nH * nW, self.window_resolution, self.window_resolution, C).permute(0, 3, 1, 2) x = self.attn(x) # window reverse, (BnHnW)Chw -> (BnHnW)hwC -> BnHnWhwC -> B(nHh)(nWw)C -> BHWC x = x.permute(0, 2, 3, 1).view(B, nH, nW, self.window_resolution, self.window_resolution, C) x = x.transpose(2, 3).reshape(B, pH, pW, C) x = x[:, :H, :W].contiguous() x = x.permute(0, 3, 1, 2) return x class EfficientVitBlock(torch.nn.Module): """ A basic EfficientVit building block. Args: dim (int): Number of input channels. key_dim (int): Dimension for query and key in the token mixer. num_heads (int): Number of attention heads. attn_ratio (int): Multiplier for the query dim for value dimension. resolution (int): Input resolution. window_resolution (int): Local window resolution. kernels (List[int]): The kernel size of the dw conv on query. """ def __init__( self, dim, key_dim, num_heads=8, attn_ratio=4, resolution=14, window_resolution=7, kernels=[5, 5, 5, 5], ): super().__init__() self.dw0 = ResidualDrop(ConvNorm(dim, dim, 3, 1, 1, groups=dim, bn_weight_init=0.)) self.ffn0 = ResidualDrop(ConvMlp(dim, int(dim * 2))) self.mixer = ResidualDrop( LocalWindowAttention( dim, key_dim, num_heads, attn_ratio=attn_ratio, resolution=resolution, window_resolution=window_resolution, kernels=kernels, ) ) self.dw1 = ResidualDrop(ConvNorm(dim, dim, 3, 1, 1, groups=dim, bn_weight_init=0.)) self.ffn1 = ResidualDrop(ConvMlp(dim, int(dim * 2))) def forward(self, x): return self.ffn1(self.dw1(self.mixer(self.ffn0(self.dw0(x))))) class EfficientVitStage(torch.nn.Module): def __init__( self, in_dim, out_dim, key_dim, downsample=('', 1), num_heads=8, attn_ratio=4, resolution=14, window_resolution=7, kernels=[5, 5, 5, 5], depth=1, ): super().__init__() if downsample[0] == 'subsample': self.resolution = (resolution - 1) // downsample[1] + 1 down_blocks = [] down_blocks.append(( 'res1', torch.nn.Sequential( ResidualDrop(ConvNorm(in_dim, in_dim, 3, 1, 1, groups=in_dim)), ResidualDrop(ConvMlp(in_dim, int(in_dim * 2))), ) )) down_blocks.append(('patchmerge', PatchMerging(in_dim, out_dim))) down_blocks.append(( 'res2', torch.nn.Sequential( ResidualDrop(ConvNorm(out_dim, out_dim, 3, 1, 1, groups=out_dim)), ResidualDrop(ConvMlp(out_dim, int(out_dim * 2))), ) )) self.downsample = nn.Sequential(OrderedDict(down_blocks)) else: assert in_dim == out_dim self.downsample = nn.Identity() self.resolution = resolution blocks = [] for d in range(depth): blocks.append(EfficientVitBlock(out_dim, key_dim, num_heads, attn_ratio, self.resolution, window_resolution, kernels)) self.blocks = nn.Sequential(*blocks) def forward(self, x): x = self.downsample(x) x = self.blocks(x) return x class PatchEmbedding(torch.nn.Sequential): def __init__(self, in_chans, dim): super().__init__() self.add_module('conv1', ConvNorm(in_chans, dim // 8, 3, 2, 1)) self.add_module('relu1', torch.nn.ReLU()) self.add_module('conv2', ConvNorm(dim // 8, dim // 4, 3, 2, 1)) self.add_module('relu2', torch.nn.ReLU()) self.add_module('conv3', ConvNorm(dim // 4, dim // 2, 3, 2, 1)) self.add_module('relu3', torch.nn.ReLU()) self.add_module('conv4', ConvNorm(dim // 2, dim, 3, 2, 1)) self.patch_size = 16 class EfficientVitMsra(nn.Module): def __init__( self, img_size=224, in_chans=3, num_classes=1000, embed_dim=(64, 128, 192), key_dim=(16, 16, 16), depth=(1, 2, 3), num_heads=(4, 4, 4), window_size=(7, 7, 7), kernels=(5, 5, 5, 5), down_ops=(('', 1), ('subsample', 2), ('subsample', 2)), global_pool='avg', drop_rate=0., ): super(EfficientVitMsra, self).__init__() self.grad_checkpointing = False self.num_classes = num_classes self.drop_rate = drop_rate # Patch embedding self.patch_embed = PatchEmbedding(in_chans, embed_dim[0]) stride = self.patch_embed.patch_size resolution = img_size // self.patch_embed.patch_size attn_ratio = [embed_dim[i] / (key_dim[i] * num_heads[i]) for i in range(len(embed_dim))] # Build EfficientVit blocks self.feature_info = [] stages = [] pre_ed = embed_dim[0] for i, (ed, kd, dpth, nh, ar, wd, do) in enumerate( zip(embed_dim, key_dim, depth, num_heads, attn_ratio, window_size, down_ops)): stage = EfficientVitStage( in_dim=pre_ed, out_dim=ed, key_dim=kd, downsample=do, num_heads=nh, attn_ratio=ar, resolution=resolution, window_resolution=wd, kernels=kernels, depth=dpth, ) pre_ed = ed if do[0] == 'subsample' and i != 0: stride *= do[1] resolution = stage.resolution stages.append(stage) self.feature_info += [dict(num_chs=ed, reduction=stride, module=f'stages.{i}')] self.stages = nn.Sequential(*stages) if global_pool == 'avg': self.global_pool = SelectAdaptivePool2d(pool_type=global_pool, flatten=True) else: assert num_classes == 0 self.global_pool = nn.Identity() self.num_features = embed_dim[-1] self.head = NormLinear( self.num_features, num_classes, drop=self.drop_rate) if num_classes > 0 else torch.nn.Identity() @torch.jit.ignore def no_weight_decay(self): return {x for x in self.state_dict().keys() if 'attention_biases' in x} @torch.jit.ignore def group_matcher(self, coarse=False): matcher = dict( stem=r'^patch_embed', blocks=r'^stages\.(\d+)' if coarse else [ (r'^stages\.(\d+).downsample', (0,)), (r'^stages\.(\d+)\.\w+\.(\d+)', None), ] ) return matcher @torch.jit.ignore def set_grad_checkpointing(self, enable=True): self.grad_checkpointing = enable @torch.jit.ignore def get_classifier(self): return self.head.linear def reset_classifier(self, num_classes, global_pool=None): self.num_classes = num_classes if global_pool is not None: if global_pool == 'avg': self.global_pool = SelectAdaptivePool2d(pool_type=global_pool, flatten=True) else: assert num_classes == 0 self.global_pool = nn.Identity() self.head = NormLinear( self.num_features, num_classes, drop=self.drop_rate) if num_classes > 0 else torch.nn.Identity() def forward_features(self, x): x = self.patch_embed(x) if self.grad_checkpointing and not torch.jit.is_scripting(): x = checkpoint_seq(self.stages, x) else: x = self.stages(x) return x def forward_head(self, x, pre_logits: bool = False): x = self.global_pool(x) return x if pre_logits else self.head(x) def forward(self, x): x = self.forward_features(x) x = self.forward_head(x) return x # def checkpoint_filter_fn(state_dict, model): # if 'model' in state_dict.keys(): # state_dict = state_dict['model'] # tmp_dict = {} # out_dict = {} # target_keys = model.state_dict().keys() # target_keys = [k for k in target_keys if k.startswith('stages.')] # # for k, v in state_dict.items(): # if 'attention_bias_idxs' in k: # continue # k = k.split('.') # if k[-2] == 'c': # k[-2] = 'conv' # if k[-2] == 'l': # k[-2] = 'linear' # k = '.'.join(k) # tmp_dict[k] = v # # for k, v in tmp_dict.items(): # if k.startswith('patch_embed'): # k = k.split('.') # k[1] = 'conv' + str(int(k[1]) // 2 + 1) # k = '.'.join(k) # elif k.startswith('blocks'): # kw = '.'.join(k.split('.')[2:]) # find_kw = [a for a in list(sorted(tmp_dict.keys())) if kw in a] # idx = find_kw.index(k) # k = [a for a in target_keys if kw in a][idx] # out_dict[k] = v # # return out_dict def _cfg(url='', **kwargs): return { 'url': url, 'num_classes': 1000, 'mean': IMAGENET_DEFAULT_MEAN, 'std': IMAGENET_DEFAULT_STD, 'first_conv': 'patch_embed.conv1.conv', 'classifier': 'head.linear', 'fixed_input_size': True, 'pool_size': (4, 4), **kwargs, } default_cfgs = generate_default_cfgs({ 'efficientvit_m0.r224_in1k': _cfg( hf_hub_id='timm/', #url='https://github.com/xinyuliu-jeffrey/EfficientVit_Model_Zoo/releases/download/v1.0/efficientvit_m0.pth' ), 'efficientvit_m1.r224_in1k': _cfg( hf_hub_id='timm/', #url='https://github.com/xinyuliu-jeffrey/EfficientVit_Model_Zoo/releases/download/v1.0/efficientvit_m1.pth' ), 'efficientvit_m2.r224_in1k': _cfg( hf_hub_id='timm/', #url='https://github.com/xinyuliu-jeffrey/EfficientVit_Model_Zoo/releases/download/v1.0/efficientvit_m2.pth' ), 'efficientvit_m3.r224_in1k': _cfg( hf_hub_id='timm/', #url='https://github.com/xinyuliu-jeffrey/EfficientVit_Model_Zoo/releases/download/v1.0/efficientvit_m3.pth' ), 'efficientvit_m4.r224_in1k': _cfg( hf_hub_id='timm/', #url='https://github.com/xinyuliu-jeffrey/EfficientVit_Model_Zoo/releases/download/v1.0/efficientvit_m4.pth' ), 'efficientvit_m5.r224_in1k': _cfg( hf_hub_id='timm/', #url='https://github.com/xinyuliu-jeffrey/EfficientVit_Model_Zoo/releases/download/v1.0/efficientvit_m5.pth' ), }) def _create_efficientvit_msra(variant, pretrained=False, **kwargs): out_indices = kwargs.pop('out_indices', (0, 1, 2)) model = build_model_with_cfg( EfficientVitMsra, variant, pretrained, feature_cfg=dict(flatten_sequential=True, out_indices=out_indices), **kwargs ) return model @register_model def efficientvit_m0(pretrained=False, **kwargs): model_args = dict( img_size=224, embed_dim=[64, 128, 192], depth=[1, 2, 3], num_heads=[4, 4, 4], window_size=[7, 7, 7], kernels=[5, 5, 5, 5] ) return _create_efficientvit_msra('efficientvit_m0', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def efficientvit_m1(pretrained=False, **kwargs): model_args = dict( img_size=224, embed_dim=[128, 144, 192], depth=[1, 2, 3], num_heads=[2, 3, 3], window_size=[7, 7, 7], kernels=[7, 5, 3, 3] ) return _create_efficientvit_msra('efficientvit_m1', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def efficientvit_m2(pretrained=False, **kwargs): model_args = dict( img_size=224, embed_dim=[128, 192, 224], depth=[1, 2, 3], num_heads=[4, 3, 2], window_size=[7, 7, 7], kernels=[7, 5, 3, 3] ) return _create_efficientvit_msra('efficientvit_m2', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def efficientvit_m3(pretrained=False, **kwargs): model_args = dict( img_size=224, embed_dim=[128, 240, 320], depth=[1, 2, 3], num_heads=[4, 3, 4], window_size=[7, 7, 7], kernels=[5, 5, 5, 5] ) return _create_efficientvit_msra('efficientvit_m3', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def efficientvit_m4(pretrained=False, **kwargs): model_args = dict( img_size=224, embed_dim=[128, 256, 384], depth=[1, 2, 3], num_heads=[4, 4, 4], window_size=[7, 7, 7], kernels=[7, 5, 3, 3] ) return _create_efficientvit_msra('efficientvit_m4', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def efficientvit_m5(pretrained=False, **kwargs): model_args = dict( img_size=224, embed_dim=[192, 288, 384], depth=[1, 3, 4], num_heads=[3, 3, 4], window_size=[7, 7, 7], kernels=[7, 5, 3, 3] ) return _create_efficientvit_msra('efficientvit_m5', pretrained=pretrained, **dict(model_args, **kwargs))
pytorch-image-models/timm/models/efficientvit_msra.py/0
{ "file_path": "pytorch-image-models/timm/models/efficientvit_msra.py", "repo_id": "pytorch-image-models", "token_count": 11871 }
196
""" Inception-V3 Originally from torchvision Inception3 model Licensed BSD-Clause 3 https://github.com/pytorch/vision/blob/master/LICENSE """ from functools import partial import torch import torch.nn as nn import torch.nn.functional as F from timm.data import IMAGENET_DEFAULT_STD, IMAGENET_DEFAULT_MEAN, IMAGENET_INCEPTION_MEAN, IMAGENET_INCEPTION_STD from timm.layers import trunc_normal_, create_classifier, Linear, ConvNormAct from ._builder import build_model_with_cfg from ._builder import resolve_pretrained_cfg from ._manipulate import flatten_modules from ._registry import register_model, generate_default_cfgs, register_model_deprecations __all__ = ['InceptionV3'] # model_registry will add each entrypoint fn to this class InceptionA(nn.Module): def __init__(self, in_channels, pool_features, conv_block=None): super(InceptionA, self).__init__() conv_block = conv_block or ConvNormAct self.branch1x1 = conv_block(in_channels, 64, kernel_size=1) self.branch5x5_1 = conv_block(in_channels, 48, kernel_size=1) self.branch5x5_2 = conv_block(48, 64, kernel_size=5, padding=2) self.branch3x3dbl_1 = conv_block(in_channels, 64, kernel_size=1) self.branch3x3dbl_2 = conv_block(64, 96, kernel_size=3, padding=1) self.branch3x3dbl_3 = conv_block(96, 96, kernel_size=3, padding=1) self.branch_pool = conv_block(in_channels, pool_features, kernel_size=1) def _forward(self, x): branch1x1 = self.branch1x1(x) branch5x5 = self.branch5x5_1(x) branch5x5 = self.branch5x5_2(branch5x5) branch3x3dbl = self.branch3x3dbl_1(x) branch3x3dbl = self.branch3x3dbl_2(branch3x3dbl) branch3x3dbl = self.branch3x3dbl_3(branch3x3dbl) branch_pool = F.avg_pool2d(x, kernel_size=3, stride=1, padding=1) branch_pool = self.branch_pool(branch_pool) outputs = [branch1x1, branch5x5, branch3x3dbl, branch_pool] return outputs def forward(self, x): outputs = self._forward(x) return torch.cat(outputs, 1) class InceptionB(nn.Module): def __init__(self, in_channels, conv_block=None): super(InceptionB, self).__init__() conv_block = conv_block or ConvNormAct self.branch3x3 = conv_block(in_channels, 384, kernel_size=3, stride=2) self.branch3x3dbl_1 = conv_block(in_channels, 64, kernel_size=1) self.branch3x3dbl_2 = conv_block(64, 96, kernel_size=3, padding=1) self.branch3x3dbl_3 = conv_block(96, 96, kernel_size=3, stride=2) def _forward(self, x): branch3x3 = self.branch3x3(x) branch3x3dbl = self.branch3x3dbl_1(x) branch3x3dbl = self.branch3x3dbl_2(branch3x3dbl) branch3x3dbl = self.branch3x3dbl_3(branch3x3dbl) branch_pool = F.max_pool2d(x, kernel_size=3, stride=2) outputs = [branch3x3, branch3x3dbl, branch_pool] return outputs def forward(self, x): outputs = self._forward(x) return torch.cat(outputs, 1) class InceptionC(nn.Module): def __init__(self, in_channels, channels_7x7, conv_block=None): super(InceptionC, self).__init__() conv_block = conv_block or ConvNormAct self.branch1x1 = conv_block(in_channels, 192, kernel_size=1) c7 = channels_7x7 self.branch7x7_1 = conv_block(in_channels, c7, kernel_size=1) self.branch7x7_2 = conv_block(c7, c7, kernel_size=(1, 7), padding=(0, 3)) self.branch7x7_3 = conv_block(c7, 192, kernel_size=(7, 1), padding=(3, 0)) self.branch7x7dbl_1 = conv_block(in_channels, c7, kernel_size=1) self.branch7x7dbl_2 = conv_block(c7, c7, kernel_size=(7, 1), padding=(3, 0)) self.branch7x7dbl_3 = conv_block(c7, c7, kernel_size=(1, 7), padding=(0, 3)) self.branch7x7dbl_4 = conv_block(c7, c7, kernel_size=(7, 1), padding=(3, 0)) self.branch7x7dbl_5 = conv_block(c7, 192, kernel_size=(1, 7), padding=(0, 3)) self.branch_pool = conv_block(in_channels, 192, kernel_size=1) def _forward(self, x): branch1x1 = self.branch1x1(x) branch7x7 = self.branch7x7_1(x) branch7x7 = self.branch7x7_2(branch7x7) branch7x7 = self.branch7x7_3(branch7x7) branch7x7dbl = self.branch7x7dbl_1(x) branch7x7dbl = self.branch7x7dbl_2(branch7x7dbl) branch7x7dbl = self.branch7x7dbl_3(branch7x7dbl) branch7x7dbl = self.branch7x7dbl_4(branch7x7dbl) branch7x7dbl = self.branch7x7dbl_5(branch7x7dbl) branch_pool = F.avg_pool2d(x, kernel_size=3, stride=1, padding=1) branch_pool = self.branch_pool(branch_pool) outputs = [branch1x1, branch7x7, branch7x7dbl, branch_pool] return outputs def forward(self, x): outputs = self._forward(x) return torch.cat(outputs, 1) class InceptionD(nn.Module): def __init__(self, in_channels, conv_block=None): super(InceptionD, self).__init__() conv_block = conv_block or ConvNormAct self.branch3x3_1 = conv_block(in_channels, 192, kernel_size=1) self.branch3x3_2 = conv_block(192, 320, kernel_size=3, stride=2) self.branch7x7x3_1 = conv_block(in_channels, 192, kernel_size=1) self.branch7x7x3_2 = conv_block(192, 192, kernel_size=(1, 7), padding=(0, 3)) self.branch7x7x3_3 = conv_block(192, 192, kernel_size=(7, 1), padding=(3, 0)) self.branch7x7x3_4 = conv_block(192, 192, kernel_size=3, stride=2) def _forward(self, x): branch3x3 = self.branch3x3_1(x) branch3x3 = self.branch3x3_2(branch3x3) branch7x7x3 = self.branch7x7x3_1(x) branch7x7x3 = self.branch7x7x3_2(branch7x7x3) branch7x7x3 = self.branch7x7x3_3(branch7x7x3) branch7x7x3 = self.branch7x7x3_4(branch7x7x3) branch_pool = F.max_pool2d(x, kernel_size=3, stride=2) outputs = [branch3x3, branch7x7x3, branch_pool] return outputs def forward(self, x): outputs = self._forward(x) return torch.cat(outputs, 1) class InceptionE(nn.Module): def __init__(self, in_channels, conv_block=None): super(InceptionE, self).__init__() conv_block = conv_block or ConvNormAct self.branch1x1 = conv_block(in_channels, 320, kernel_size=1) self.branch3x3_1 = conv_block(in_channels, 384, kernel_size=1) self.branch3x3_2a = conv_block(384, 384, kernel_size=(1, 3), padding=(0, 1)) self.branch3x3_2b = conv_block(384, 384, kernel_size=(3, 1), padding=(1, 0)) self.branch3x3dbl_1 = conv_block(in_channels, 448, kernel_size=1) self.branch3x3dbl_2 = conv_block(448, 384, kernel_size=3, padding=1) self.branch3x3dbl_3a = conv_block(384, 384, kernel_size=(1, 3), padding=(0, 1)) self.branch3x3dbl_3b = conv_block(384, 384, kernel_size=(3, 1), padding=(1, 0)) self.branch_pool = conv_block(in_channels, 192, kernel_size=1) def _forward(self, x): branch1x1 = self.branch1x1(x) branch3x3 = self.branch3x3_1(x) branch3x3 = [ self.branch3x3_2a(branch3x3), self.branch3x3_2b(branch3x3), ] branch3x3 = torch.cat(branch3x3, 1) branch3x3dbl = self.branch3x3dbl_1(x) branch3x3dbl = self.branch3x3dbl_2(branch3x3dbl) branch3x3dbl = [ self.branch3x3dbl_3a(branch3x3dbl), self.branch3x3dbl_3b(branch3x3dbl), ] branch3x3dbl = torch.cat(branch3x3dbl, 1) branch_pool = F.avg_pool2d(x, kernel_size=3, stride=1, padding=1) branch_pool = self.branch_pool(branch_pool) outputs = [branch1x1, branch3x3, branch3x3dbl, branch_pool] return outputs def forward(self, x): outputs = self._forward(x) return torch.cat(outputs, 1) class InceptionAux(nn.Module): def __init__(self, in_channels, num_classes, conv_block=None): super(InceptionAux, self).__init__() conv_block = conv_block or ConvNormAct self.conv0 = conv_block(in_channels, 128, kernel_size=1) self.conv1 = conv_block(128, 768, kernel_size=5) self.conv1.stddev = 0.01 self.fc = Linear(768, num_classes) self.fc.stddev = 0.001 def forward(self, x): # N x 768 x 17 x 17 x = F.avg_pool2d(x, kernel_size=5, stride=3) # N x 768 x 5 x 5 x = self.conv0(x) # N x 128 x 5 x 5 x = self.conv1(x) # N x 768 x 1 x 1 # Adaptive average pooling x = F.adaptive_avg_pool2d(x, (1, 1)) # N x 768 x 1 x 1 x = torch.flatten(x, 1) # N x 768 x = self.fc(x) # N x 1000 return x class InceptionV3(nn.Module): """Inception-V3 """ aux_logits: torch.jit.Final[bool] def __init__( self, num_classes=1000, in_chans=3, drop_rate=0., global_pool='avg', aux_logits=False, norm_layer='batchnorm2d', norm_eps=1e-3, act_layer='relu', ): super(InceptionV3, self).__init__() self.num_classes = num_classes self.aux_logits = aux_logits conv_block = partial( ConvNormAct, padding=0, norm_layer=norm_layer, act_layer=act_layer, norm_kwargs=dict(eps=norm_eps), act_kwargs=dict(inplace=True), ) self.Conv2d_1a_3x3 = conv_block(in_chans, 32, kernel_size=3, stride=2) self.Conv2d_2a_3x3 = conv_block(32, 32, kernel_size=3) self.Conv2d_2b_3x3 = conv_block(32, 64, kernel_size=3, padding=1) self.Pool1 = nn.MaxPool2d(kernel_size=3, stride=2) self.Conv2d_3b_1x1 = conv_block(64, 80, kernel_size=1) self.Conv2d_4a_3x3 = conv_block(80, 192, kernel_size=3) self.Pool2 = nn.MaxPool2d(kernel_size=3, stride=2) self.Mixed_5b = InceptionA(192, pool_features=32, conv_block=conv_block) self.Mixed_5c = InceptionA(256, pool_features=64, conv_block=conv_block) self.Mixed_5d = InceptionA(288, pool_features=64, conv_block=conv_block) self.Mixed_6a = InceptionB(288, conv_block=conv_block) self.Mixed_6b = InceptionC(768, channels_7x7=128, conv_block=conv_block) self.Mixed_6c = InceptionC(768, channels_7x7=160, conv_block=conv_block) self.Mixed_6d = InceptionC(768, channels_7x7=160, conv_block=conv_block) self.Mixed_6e = InceptionC(768, channels_7x7=192, conv_block=conv_block) if aux_logits: self.AuxLogits = InceptionAux(768, num_classes, conv_block=conv_block) else: self.AuxLogits = None self.Mixed_7a = InceptionD(768, conv_block=conv_block) self.Mixed_7b = InceptionE(1280, conv_block=conv_block) self.Mixed_7c = InceptionE(2048, conv_block=conv_block) self.feature_info = [ dict(num_chs=64, reduction=2, module='Conv2d_2b_3x3'), dict(num_chs=192, reduction=4, module='Conv2d_4a_3x3'), dict(num_chs=288, reduction=8, module='Mixed_5d'), dict(num_chs=768, reduction=16, module='Mixed_6e'), dict(num_chs=2048, reduction=32, module='Mixed_7c'), ] self.num_features = 2048 self.global_pool, self.head_drop, self.fc = create_classifier( self.num_features, self.num_classes, pool_type=global_pool, drop_rate=drop_rate, ) for m in self.modules(): if isinstance(m, nn.Conv2d) or isinstance(m, nn.Linear): stddev = m.stddev if hasattr(m, 'stddev') else 0.1 trunc_normal_(m.weight, std=stddev) elif isinstance(m, nn.BatchNorm2d): nn.init.constant_(m.weight, 1) nn.init.constant_(m.bias, 0) @torch.jit.ignore def group_matcher(self, coarse=False): module_map = {k: i for i, (k, _) in enumerate(flatten_modules(self.named_children(), prefix=()))} module_map.pop(('fc',)) def _matcher(name): if any([name.startswith(n) for n in ('Conv2d_1', 'Conv2d_2')]): return 0 elif any([name.startswith(n) for n in ('Conv2d_3', 'Conv2d_4')]): return 1 else: for k in module_map.keys(): if k == tuple(name.split('.')[:len(k)]): return module_map[k] return float('inf') return _matcher @torch.jit.ignore def set_grad_checkpointing(self, enable=True): assert not enable, 'gradient checkpointing not supported' @torch.jit.ignore def get_classifier(self): return self.fc def reset_classifier(self, num_classes, global_pool='avg'): self.num_classes = num_classes self.global_pool, self.fc = create_classifier(self.num_features, self.num_classes, pool_type=global_pool) def forward_preaux(self, x): x = self.Conv2d_1a_3x3(x) # N x 32 x 149 x 149 x = self.Conv2d_2a_3x3(x) # N x 32 x 147 x 147 x = self.Conv2d_2b_3x3(x) # N x 64 x 147 x 147 x = self.Pool1(x) # N x 64 x 73 x 73 x = self.Conv2d_3b_1x1(x) # N x 80 x 73 x 73 x = self.Conv2d_4a_3x3(x) # N x 192 x 71 x 71 x = self.Pool2(x) # N x 192 x 35 x 35 x = self.Mixed_5b(x) # N x 256 x 35 x 35 x = self.Mixed_5c(x) # N x 288 x 35 x 35 x = self.Mixed_5d(x) # N x 288 x 35 x 35 x = self.Mixed_6a(x) # N x 768 x 17 x 17 x = self.Mixed_6b(x) # N x 768 x 17 x 17 x = self.Mixed_6c(x) # N x 768 x 17 x 17 x = self.Mixed_6d(x) # N x 768 x 17 x 17 x = self.Mixed_6e(x) # N x 768 x 17 x 17 return x def forward_postaux(self, x): x = self.Mixed_7a(x) # N x 1280 x 8 x 8 x = self.Mixed_7b(x) # N x 2048 x 8 x 8 x = self.Mixed_7c(x) # N x 2048 x 8 x 8 return x def forward_features(self, x): x = self.forward_preaux(x) if self.aux_logits: aux = self.AuxLogits(x) x = self.forward_postaux(x) return x, aux x = self.forward_postaux(x) return x def forward_head(self, x): x = self.global_pool(x) x = self.head_drop(x) x = self.fc(x) return x def forward(self, x): if self.aux_logits: x, aux = self.forward_features(x) x = self.forward_head(x) return x, aux x = self.forward_features(x) x = self.forward_head(x) return x def _create_inception_v3(variant, pretrained=False, **kwargs): pretrained_cfg = resolve_pretrained_cfg(variant, pretrained_cfg=kwargs.pop('pretrained_cfg', None)) aux_logits = kwargs.get('aux_logits', False) has_aux_logits = False if pretrained_cfg: # only torchvision pretrained weights have aux logits has_aux_logits = pretrained_cfg.tag == 'tv_in1k' if aux_logits: assert not kwargs.pop('features_only', False) load_strict = has_aux_logits else: load_strict = not has_aux_logits return build_model_with_cfg( InceptionV3, variant, pretrained, pretrained_cfg=pretrained_cfg, pretrained_strict=load_strict, **kwargs, ) def _cfg(url='', **kwargs): return { 'url': url, 'num_classes': 1000, 'input_size': (3, 299, 299), 'pool_size': (8, 8), 'crop_pct': 0.875, 'interpolation': 'bicubic', 'mean': IMAGENET_INCEPTION_MEAN, 'std': IMAGENET_INCEPTION_STD, 'first_conv': 'Conv2d_1a_3x3.conv', 'classifier': 'fc', **kwargs } default_cfgs = generate_default_cfgs({ # original PyTorch weights, ported from Tensorflow but modified 'inception_v3.tv_in1k': _cfg( # NOTE checkpoint has aux logit layer weights hf_hub_id='timm/', url='https://download.pytorch.org/models/inception_v3_google-1a9a5a14.pth'), # my port of Tensorflow SLIM weights (http://download.tensorflow.org/models/inception_v3_2016_08_28.tar.gz) 'inception_v3.tf_in1k': _cfg(hf_hub_id='timm/'), # my port of Tensorflow adversarially trained Inception V3 from # http://download.tensorflow.org/models/adv_inception_v3_2017_08_18.tar.gz 'inception_v3.tf_adv_in1k': _cfg(hf_hub_id='timm/'), # from gluon pretrained models, best performing in terms of accuracy/loss metrics # https://gluon-cv.mxnet.io/model_zoo/classification.html 'inception_v3.gluon_in1k': _cfg( hf_hub_id='timm/', mean=IMAGENET_DEFAULT_MEAN, # also works well with inception defaults std=IMAGENET_DEFAULT_STD, # also works well with inception defaults ) }) @register_model def inception_v3(pretrained=False, **kwargs) -> InceptionV3: model = _create_inception_v3('inception_v3', pretrained=pretrained, **kwargs) return model register_model_deprecations(__name__, { 'tf_inception_v3': 'inception_v3.tf_in1k', 'adv_inception_v3': 'inception_v3.tf_adv_in1k', 'gluon_inception_v3': 'inception_v3.gluon_in1k', })
pytorch-image-models/timm/models/inception_v3.py/0
{ "file_path": "pytorch-image-models/timm/models/inception_v3.py", "repo_id": "pytorch-image-models", "token_count": 8581 }
197
""" Pyramid Vision Transformer v2 @misc{wang2021pvtv2, title={PVTv2: Improved Baselines with Pyramid Vision Transformer}, author={Wenhai Wang and Enze Xie and Xiang Li and Deng-Ping Fan and Kaitao Song and Ding Liang and Tong Lu and Ping Luo and Ling Shao}, year={2021}, eprint={2106.13797}, archivePrefix={arXiv}, primaryClass={cs.CV} } Based on Apache 2.0 licensed code at https://github.com/whai362/PVT Modifications and timm support by / Copyright 2022, Ross Wightman """ import math from typing import Tuple, List, Callable, Union import torch import torch.nn as nn import torch.nn.functional as F import torch.utils.checkpoint as checkpoint from timm.data import IMAGENET_DEFAULT_MEAN, IMAGENET_DEFAULT_STD from timm.layers import DropPath, to_2tuple, to_ntuple, trunc_normal_, LayerNorm, use_fused_attn from ._builder import build_model_with_cfg from ._registry import register_model, generate_default_cfgs __all__ = ['PyramidVisionTransformerV2'] class MlpWithDepthwiseConv(nn.Module): def __init__( self, in_features, hidden_features=None, out_features=None, act_layer=nn.GELU, drop=0., extra_relu=False, ): super().__init__() out_features = out_features or in_features hidden_features = hidden_features or in_features self.fc1 = nn.Linear(in_features, hidden_features) self.relu = nn.ReLU() if extra_relu else nn.Identity() self.dwconv = nn.Conv2d(hidden_features, hidden_features, 3, 1, 1, bias=True, groups=hidden_features) self.act = act_layer() self.fc2 = nn.Linear(hidden_features, out_features) self.drop = nn.Dropout(drop) def forward(self, x, feat_size: List[int]): x = self.fc1(x) B, N, C = x.shape x = x.transpose(1, 2).view(B, C, feat_size[0], feat_size[1]) x = self.relu(x) x = self.dwconv(x) x = x.flatten(2).transpose(1, 2) x = self.act(x) x = self.drop(x) x = self.fc2(x) x = self.drop(x) return x class Attention(nn.Module): fused_attn: torch.jit.Final[bool] def __init__( self, dim, num_heads=8, sr_ratio=1, linear_attn=False, qkv_bias=True, attn_drop=0., proj_drop=0. ): super().__init__() assert dim % num_heads == 0, f"dim {dim} should be divided by num_heads {num_heads}." self.dim = dim self.num_heads = num_heads self.head_dim = dim // num_heads self.scale = self.head_dim ** -0.5 self.fused_attn = use_fused_attn() self.q = nn.Linear(dim, dim, bias=qkv_bias) self.kv = nn.Linear(dim, dim * 2, bias=qkv_bias) self.attn_drop = nn.Dropout(attn_drop) self.proj = nn.Linear(dim, dim) self.proj_drop = nn.Dropout(proj_drop) if not linear_attn: self.pool = None if sr_ratio > 1: self.sr = nn.Conv2d(dim, dim, kernel_size=sr_ratio, stride=sr_ratio) self.norm = nn.LayerNorm(dim) else: self.sr = None self.norm = None self.act = None else: self.pool = nn.AdaptiveAvgPool2d(7) self.sr = nn.Conv2d(dim, dim, kernel_size=1, stride=1) self.norm = nn.LayerNorm(dim) self.act = nn.GELU() def forward(self, x, feat_size: List[int]): B, N, C = x.shape H, W = feat_size q = self.q(x).reshape(B, N, self.num_heads, -1).permute(0, 2, 1, 3) if self.pool is not None: x = x.permute(0, 2, 1).reshape(B, C, H, W) x = self.sr(self.pool(x)).reshape(B, C, -1).permute(0, 2, 1) x = self.norm(x) x = self.act(x) kv = self.kv(x).reshape(B, -1, 2, self.num_heads, self.head_dim).permute(2, 0, 3, 1, 4) else: if self.sr is not None: x = x.permute(0, 2, 1).reshape(B, C, H, W) x = self.sr(x).reshape(B, C, -1).permute(0, 2, 1) x = self.norm(x) kv = self.kv(x).reshape(B, -1, 2, self.num_heads, self.head_dim).permute(2, 0, 3, 1, 4) else: kv = self.kv(x).reshape(B, -1, 2, self.num_heads, self.head_dim).permute(2, 0, 3, 1, 4) k, v = kv.unbind(0) if self.fused_attn: x = F.scaled_dot_product_attention(q, k, v, dropout_p=self.attn_drop.p if self.training else 0.) else: q = q * self.scale attn = q @ k.transpose(-2, -1) attn = attn.softmax(dim=-1) attn = self.attn_drop(attn) x = attn @ v x = x.transpose(1, 2).reshape(B, N, C) x = self.proj(x) x = self.proj_drop(x) return x class Block(nn.Module): def __init__( self, dim, num_heads, mlp_ratio=4., sr_ratio=1, linear_attn=False, qkv_bias=False, proj_drop=0., attn_drop=0., drop_path=0., act_layer=nn.GELU, norm_layer=LayerNorm, ): super().__init__() self.norm1 = norm_layer(dim) self.attn = Attention( dim, num_heads=num_heads, sr_ratio=sr_ratio, linear_attn=linear_attn, qkv_bias=qkv_bias, attn_drop=attn_drop, proj_drop=proj_drop, ) self.drop_path1 = DropPath(drop_path) if drop_path > 0. else nn.Identity() self.norm2 = norm_layer(dim) self.mlp = MlpWithDepthwiseConv( in_features=dim, hidden_features=int(dim * mlp_ratio), act_layer=act_layer, drop=proj_drop, extra_relu=linear_attn, ) self.drop_path2 = DropPath(drop_path) if drop_path > 0. else nn.Identity() def forward(self, x, feat_size: List[int]): x = x + self.drop_path1(self.attn(self.norm1(x), feat_size)) x = x + self.drop_path2(self.mlp(self.norm2(x), feat_size)) return x class OverlapPatchEmbed(nn.Module): """ Image to Patch Embedding """ def __init__(self, patch_size=7, stride=4, in_chans=3, embed_dim=768): super().__init__() patch_size = to_2tuple(patch_size) assert max(patch_size) > stride, "Set larger patch_size than stride" self.patch_size = patch_size self.proj = nn.Conv2d( in_chans, embed_dim, patch_size, stride=stride, padding=(patch_size[0] // 2, patch_size[1] // 2)) self.norm = nn.LayerNorm(embed_dim) def forward(self, x): x = self.proj(x) x = x.permute(0, 2, 3, 1) x = self.norm(x) return x class PyramidVisionTransformerStage(nn.Module): def __init__( self, dim: int, dim_out: int, depth: int, downsample: bool = True, num_heads: int = 8, sr_ratio: int = 1, linear_attn: bool = False, mlp_ratio: float = 4.0, qkv_bias: bool = True, proj_drop: float = 0., attn_drop: float = 0., drop_path: Union[List[float], float] = 0.0, norm_layer: Callable = LayerNorm, ): super().__init__() self.grad_checkpointing = False if downsample: self.downsample = OverlapPatchEmbed( patch_size=3, stride=2, in_chans=dim, embed_dim=dim_out, ) else: assert dim == dim_out self.downsample = None self.blocks = nn.ModuleList([Block( dim=dim_out, num_heads=num_heads, sr_ratio=sr_ratio, linear_attn=linear_attn, mlp_ratio=mlp_ratio, qkv_bias=qkv_bias, proj_drop=proj_drop, attn_drop=attn_drop, drop_path=drop_path[i] if isinstance(drop_path, list) else drop_path, norm_layer=norm_layer, ) for i in range(depth)]) self.norm = norm_layer(dim_out) def forward(self, x): # x is either B, C, H, W (if downsample) or B, H, W, C if not if self.downsample is not None: # input to downsample is B, C, H, W x = self.downsample(x) # output B, H, W, C B, H, W, C = x.shape feat_size = (H, W) x = x.reshape(B, -1, C) for blk in self.blocks: if self.grad_checkpointing and not torch.jit.is_scripting(): x = checkpoint.checkpoint(blk, x, feat_size) else: x = blk(x, feat_size) x = self.norm(x) x = x.reshape(B, feat_size[0], feat_size[1], -1).permute(0, 3, 1, 2).contiguous() return x class PyramidVisionTransformerV2(nn.Module): def __init__( self, in_chans=3, num_classes=1000, global_pool='avg', depths=(3, 4, 6, 3), embed_dims=(64, 128, 256, 512), num_heads=(1, 2, 4, 8), sr_ratios=(8, 4, 2, 1), mlp_ratios=(8., 8., 4., 4.), qkv_bias=True, linear=False, drop_rate=0., proj_drop_rate=0., attn_drop_rate=0., drop_path_rate=0., norm_layer=LayerNorm, ): super().__init__() self.num_classes = num_classes assert global_pool in ('avg', '') self.global_pool = global_pool self.depths = depths num_stages = len(depths) mlp_ratios = to_ntuple(num_stages)(mlp_ratios) num_heads = to_ntuple(num_stages)(num_heads) sr_ratios = to_ntuple(num_stages)(sr_ratios) assert(len(embed_dims)) == num_stages self.feature_info = [] self.patch_embed = OverlapPatchEmbed( patch_size=7, stride=4, in_chans=in_chans, embed_dim=embed_dims[0], ) dpr = [x.tolist() for x in torch.linspace(0, drop_path_rate, sum(depths)).split(depths)] cur = 0 prev_dim = embed_dims[0] stages = [] for i in range(num_stages): stages += [PyramidVisionTransformerStage( dim=prev_dim, dim_out=embed_dims[i], depth=depths[i], downsample=i > 0, num_heads=num_heads[i], sr_ratio=sr_ratios[i], mlp_ratio=mlp_ratios[i], linear_attn=linear, qkv_bias=qkv_bias, proj_drop=proj_drop_rate, attn_drop=attn_drop_rate, drop_path=dpr[i], norm_layer=norm_layer, )] prev_dim = embed_dims[i] cur += depths[i] self.feature_info += [dict(num_chs=prev_dim, reduction=4 * 2**i, module=f'stages.{i}')] self.stages = nn.Sequential(*stages) # classification head self.num_features = embed_dims[-1] self.head_drop = nn.Dropout(drop_rate) self.head = nn.Linear(embed_dims[-1], num_classes) if num_classes > 0 else nn.Identity() self.apply(self._init_weights) def _init_weights(self, m): if isinstance(m, nn.Linear): trunc_normal_(m.weight, std=.02) if isinstance(m, nn.Linear) and m.bias is not None: nn.init.constant_(m.bias, 0) elif isinstance(m, nn.Conv2d): fan_out = m.kernel_size[0] * m.kernel_size[1] * m.out_channels fan_out //= m.groups m.weight.data.normal_(0, math.sqrt(2.0 / fan_out)) if m.bias is not None: m.bias.data.zero_() def freeze_patch_emb(self): self.patch_embed.requires_grad = False @torch.jit.ignore def no_weight_decay(self): return {} @torch.jit.ignore def group_matcher(self, coarse=False): matcher = dict( stem=r'^patch_embed', # stem and embed blocks=r'^stages\.(\d+)' ) return matcher @torch.jit.ignore def set_grad_checkpointing(self, enable=True): for s in self.stages: s.grad_checkpointing = enable def get_classifier(self): return self.head def reset_classifier(self, num_classes, global_pool=None): self.num_classes = num_classes if global_pool is not None: assert global_pool in ('avg', '') self.global_pool = global_pool self.head = nn.Linear(self.embed_dim, num_classes) if num_classes > 0 else nn.Identity() def forward_features(self, x): x = self.patch_embed(x) x = self.stages(x) return x def forward_head(self, x, pre_logits: bool = False): if self.global_pool: x = x.mean(dim=(-1, -2)) x = self.head_drop(x) return x if pre_logits else self.head(x) def forward(self, x): x = self.forward_features(x) x = self.forward_head(x) return x def _checkpoint_filter_fn(state_dict, model): """ Remap original checkpoints -> timm """ if 'patch_embed.proj.weight' in state_dict: return state_dict # non-original checkpoint, no remapping needed out_dict = {} import re for k, v in state_dict.items(): if k.startswith('patch_embed'): k = k.replace('patch_embed1', 'patch_embed') k = k.replace('patch_embed2', 'stages.1.downsample') k = k.replace('patch_embed3', 'stages.2.downsample') k = k.replace('patch_embed4', 'stages.3.downsample') k = k.replace('dwconv.dwconv', 'dwconv') k = re.sub(r'block(\d+).(\d+)', lambda x: f'stages.{int(x.group(1)) - 1}.blocks.{x.group(2)}', k) k = re.sub(r'^norm(\d+)', lambda x: f'stages.{int(x.group(1)) - 1}.norm', k) out_dict[k] = v return out_dict def _create_pvt2(variant, pretrained=False, **kwargs): default_out_indices = tuple(range(4)) out_indices = kwargs.pop('out_indices', default_out_indices) model = build_model_with_cfg( PyramidVisionTransformerV2, variant, pretrained, pretrained_filter_fn=_checkpoint_filter_fn, feature_cfg=dict(flatten_sequential=True, out_indices=out_indices), **kwargs, ) return model def _cfg(url='', **kwargs): return { 'url': url, 'num_classes': 1000, 'input_size': (3, 224, 224), 'pool_size': (7, 7), 'crop_pct': 0.9, 'interpolation': 'bicubic', 'mean': IMAGENET_DEFAULT_MEAN, 'std': IMAGENET_DEFAULT_STD, 'first_conv': 'patch_embed.proj', 'classifier': 'head', 'fixed_input_size': False, **kwargs } default_cfgs = generate_default_cfgs({ 'pvt_v2_b0.in1k': _cfg(hf_hub_id='timm/'), 'pvt_v2_b1.in1k': _cfg(hf_hub_id='timm/'), 'pvt_v2_b2.in1k': _cfg(hf_hub_id='timm/'), 'pvt_v2_b3.in1k': _cfg(hf_hub_id='timm/'), 'pvt_v2_b4.in1k': _cfg(hf_hub_id='timm/'), 'pvt_v2_b5.in1k': _cfg(hf_hub_id='timm/'), 'pvt_v2_b2_li.in1k': _cfg(hf_hub_id='timm/'), }) @register_model def pvt_v2_b0(pretrained=False, **kwargs) -> PyramidVisionTransformerV2: model_args = dict(depths=(2, 2, 2, 2), embed_dims=(32, 64, 160, 256), num_heads=(1, 2, 5, 8)) return _create_pvt2('pvt_v2_b0', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def pvt_v2_b1(pretrained=False, **kwargs) -> PyramidVisionTransformerV2: model_args = dict(depths=(2, 2, 2, 2), embed_dims=(64, 128, 320, 512), num_heads=(1, 2, 5, 8)) return _create_pvt2('pvt_v2_b1', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def pvt_v2_b2(pretrained=False, **kwargs) -> PyramidVisionTransformerV2: model_args = dict(depths=(3, 4, 6, 3), embed_dims=(64, 128, 320, 512), num_heads=(1, 2, 5, 8)) return _create_pvt2('pvt_v2_b2', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def pvt_v2_b3(pretrained=False, **kwargs) -> PyramidVisionTransformerV2: model_args = dict(depths=(3, 4, 18, 3), embed_dims=(64, 128, 320, 512), num_heads=(1, 2, 5, 8)) return _create_pvt2('pvt_v2_b3', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def pvt_v2_b4(pretrained=False, **kwargs) -> PyramidVisionTransformerV2: model_args = dict(depths=(3, 8, 27, 3), embed_dims=(64, 128, 320, 512), num_heads=(1, 2, 5, 8)) return _create_pvt2('pvt_v2_b4', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def pvt_v2_b5(pretrained=False, **kwargs) -> PyramidVisionTransformerV2: model_args = dict( depths=(3, 6, 40, 3), embed_dims=(64, 128, 320, 512), num_heads=(1, 2, 5, 8), mlp_ratios=(4, 4, 4, 4)) return _create_pvt2('pvt_v2_b5', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def pvt_v2_b2_li(pretrained=False, **kwargs) -> PyramidVisionTransformerV2: model_args = dict( depths=(3, 4, 6, 3), embed_dims=(64, 128, 320, 512), num_heads=(1, 2, 5, 8), linear=True) return _create_pvt2('pvt_v2_b2_li', pretrained=pretrained, **dict(model_args, **kwargs))
pytorch-image-models/timm/models/pvt_v2.py/0
{ "file_path": "pytorch-image-models/timm/models/pvt_v2.py", "repo_id": "pytorch-image-models", "token_count": 9047 }
198
""" Swin Transformer V2 A PyTorch impl of : `Swin Transformer V2: Scaling Up Capacity and Resolution` - https://arxiv.org/pdf/2111.09883 Code adapted from https://github.com/ChristophReich1996/Swin-Transformer-V2, original copyright/license info below This implementation is experimental and subject to change in manners that will break weight compat: * Size of the pos embed MLP are not spelled out in paper in terms of dim, fixed for all models? vary with num_heads? * currently dim is fixed, I feel it may make sense to scale with num_heads (dim per head) * The specifics of the memory saving 'sequential attention' are not detailed, Christoph Reich has an impl at GitHub link above. It needs further investigation as throughput vs mem tradeoff doesn't appear beneficial. * num_heads per stage is not detailed for Huge and Giant model variants * 'Giant' is 3B params in paper but ~2.6B here despite matching paper dim + block counts * experiments are ongoing wrt to 'main branch' norm layer use and weight init scheme Noteworthy additions over official Swin v1: * MLP relative position embedding is looking promising and adapts to different image/window sizes * This impl has been designed to allow easy change of image size with matching window size changes * Non-square image size and window size are supported Modifications and additions for timm hacked together by / Copyright 2022, Ross Wightman """ # -------------------------------------------------------- # Swin Transformer V2 reimplementation # Copyright (c) 2021 Christoph Reich # Licensed under The MIT License [see LICENSE for details] # Written by Christoph Reich # -------------------------------------------------------- import logging import math from typing import Tuple, Optional, List, Union, Any, Type import torch import torch.nn as nn import torch.nn.functional as F import torch.utils.checkpoint as checkpoint from timm.data import IMAGENET_DEFAULT_MEAN, IMAGENET_DEFAULT_STD from timm.layers import DropPath, Mlp, ClassifierHead, to_2tuple, _assert, ndgrid from ._builder import build_model_with_cfg from ._features_fx import register_notrace_function from ._manipulate import named_apply from ._registry import generate_default_cfgs, register_model __all__ = ['SwinTransformerV2Cr'] # model_registry will add each entrypoint fn to this _logger = logging.getLogger(__name__) def bchw_to_bhwc(x: torch.Tensor) -> torch.Tensor: """Permutes a tensor from the shape (B, C, H, W) to (B, H, W, C). """ return x.permute(0, 2, 3, 1) def bhwc_to_bchw(x: torch.Tensor) -> torch.Tensor: """Permutes a tensor from the shape (B, H, W, C) to (B, C, H, W). """ return x.permute(0, 3, 1, 2) def window_partition(x, window_size: Tuple[int, int]): """ Args: x: (B, H, W, C) window_size (int): window size Returns: windows: (num_windows*B, window_size, window_size, C) """ B, H, W, C = x.shape x = x.view(B, H // window_size[0], window_size[0], W // window_size[1], window_size[1], C) windows = x.permute(0, 1, 3, 2, 4, 5).contiguous().view(-1, window_size[0], window_size[1], C) return windows @register_notrace_function # reason: int argument is a Proxy def window_reverse(windows, window_size: Tuple[int, int], img_size: Tuple[int, int]): """ Args: windows: (num_windows * B, window_size[0], window_size[1], C) window_size (Tuple[int, int]): Window size img_size (Tuple[int, int]): Image size Returns: x: (B, H, W, C) """ H, W = img_size C = windows.shape[-1] x = windows.view(-1, H // window_size[0], W // window_size[1], window_size[0], window_size[1], C) x = x.permute(0, 1, 3, 2, 4, 5).contiguous().view(-1, H, W, C) return x class WindowMultiHeadAttention(nn.Module): r"""This class implements window-based Multi-Head-Attention with log-spaced continuous position bias. Args: dim (int): Number of input features window_size (int): Window size num_heads (int): Number of attention heads drop_attn (float): Dropout rate of attention map drop_proj (float): Dropout rate after projection meta_hidden_dim (int): Number of hidden features in the two layer MLP meta network sequential_attn (bool): If true sequential self-attention is performed """ def __init__( self, dim: int, num_heads: int, window_size: Tuple[int, int], drop_attn: float = 0.0, drop_proj: float = 0.0, meta_hidden_dim: int = 384, # FIXME what's the optimal value? sequential_attn: bool = False, ) -> None: super(WindowMultiHeadAttention, self).__init__() assert dim % num_heads == 0, \ "The number of input features (in_features) are not divisible by the number of heads (num_heads)." self.in_features: int = dim self.window_size: Tuple[int, int] = window_size self.num_heads: int = num_heads self.sequential_attn: bool = sequential_attn self.qkv = nn.Linear(in_features=dim, out_features=dim * 3, bias=True) self.attn_drop = nn.Dropout(drop_attn) self.proj = nn.Linear(in_features=dim, out_features=dim, bias=True) self.proj_drop = nn.Dropout(drop_proj) # meta network for positional encodings self.meta_mlp = Mlp( 2, # x, y hidden_features=meta_hidden_dim, out_features=num_heads, act_layer=nn.ReLU, drop=(0.125, 0.) # FIXME should there be stochasticity, appears to 'overfit' without? ) # NOTE old checkpoints used inverse of logit_scale ('tau') following the paper, see conversion fn self.logit_scale = nn.Parameter(torch.log(10 * torch.ones(num_heads))) self._make_pair_wise_relative_positions() def _make_pair_wise_relative_positions(self) -> None: """Method initializes the pair-wise relative positions to compute the positional biases.""" device = self.logit_scale.device coordinates = torch.stack(ndgrid( torch.arange(self.window_size[0], device=device), torch.arange(self.window_size[1], device=device) ), dim=0).flatten(1) relative_coordinates = coordinates[:, :, None] - coordinates[:, None, :] relative_coordinates = relative_coordinates.permute(1, 2, 0).reshape(-1, 2).float() relative_coordinates_log = torch.sign(relative_coordinates) * torch.log( 1.0 + relative_coordinates.abs()) self.register_buffer("relative_coordinates_log", relative_coordinates_log, persistent=False) def update_input_size(self, new_window_size: int, **kwargs: Any) -> None: """Method updates the window size and so the pair-wise relative positions Args: new_window_size (int): New window size kwargs (Any): Unused """ # Set new window size and new pair-wise relative positions self.window_size: int = new_window_size self._make_pair_wise_relative_positions() def _relative_positional_encodings(self) -> torch.Tensor: """Method computes the relative positional encodings Returns: relative_position_bias (torch.Tensor): Relative positional encodings (1, number of heads, window size ** 2, window size ** 2) """ window_area = self.window_size[0] * self.window_size[1] relative_position_bias = self.meta_mlp(self.relative_coordinates_log) relative_position_bias = relative_position_bias.transpose(1, 0).reshape( self.num_heads, window_area, window_area ) relative_position_bias = relative_position_bias.unsqueeze(0) return relative_position_bias def forward(self, x: torch.Tensor, mask: Optional[torch.Tensor] = None) -> torch.Tensor: """ Forward pass. Args: x (torch.Tensor): Input tensor of the shape (B * windows, N, C) mask (Optional[torch.Tensor]): Attention mask for the shift case Returns: Output tensor of the shape [B * windows, N, C] """ Bw, L, C = x.shape qkv = self.qkv(x).view(Bw, L, 3, self.num_heads, C // self.num_heads).permute(2, 0, 3, 1, 4) query, key, value = qkv.unbind(0) # compute attention map with scaled cosine attention attn = (F.normalize(query, dim=-1) @ F.normalize(key, dim=-1).transpose(-2, -1)) logit_scale = torch.clamp(self.logit_scale.reshape(1, self.num_heads, 1, 1), max=math.log(1. / 0.01)).exp() attn = attn * logit_scale attn = attn + self._relative_positional_encodings() if mask is not None: # Apply mask if utilized num_win: int = mask.shape[0] attn = attn.view(Bw // num_win, num_win, self.num_heads, L, L) attn = attn + mask.unsqueeze(1).unsqueeze(0) attn = attn.view(-1, self.num_heads, L, L) attn = attn.softmax(dim=-1) attn = self.attn_drop(attn) x = (attn @ value).transpose(1, 2).reshape(Bw, L, -1) x = self.proj(x) x = self.proj_drop(x) return x class SwinTransformerV2CrBlock(nn.Module): r"""This class implements the Swin transformer block. Args: dim (int): Number of input channels num_heads (int): Number of attention heads to be utilized feat_size (Tuple[int, int]): Input resolution window_size (Tuple[int, int]): Window size to be utilized shift_size (int): Shifting size to be used mlp_ratio (int): Ratio of the hidden dimension in the FFN to the input channels proj_drop (float): Dropout in input mapping drop_attn (float): Dropout rate of attention map drop_path (float): Dropout in main path extra_norm (bool): Insert extra norm on 'main' branch if True sequential_attn (bool): If true sequential self-attention is performed norm_layer (Type[nn.Module]): Type of normalization layer to be utilized """ def __init__( self, dim: int, num_heads: int, feat_size: Tuple[int, int], window_size: Tuple[int, int], shift_size: Tuple[int, int] = (0, 0), mlp_ratio: float = 4.0, init_values: Optional[float] = 0, proj_drop: float = 0.0, drop_attn: float = 0.0, drop_path: float = 0.0, extra_norm: bool = False, sequential_attn: bool = False, norm_layer: Type[nn.Module] = nn.LayerNorm, ) -> None: super(SwinTransformerV2CrBlock, self).__init__() self.dim: int = dim self.feat_size: Tuple[int, int] = feat_size self.target_shift_size: Tuple[int, int] = to_2tuple(shift_size) self.window_size, self.shift_size = self._calc_window_shift(to_2tuple(window_size)) self.window_area = self.window_size[0] * self.window_size[1] self.init_values: Optional[float] = init_values # attn branch self.attn = WindowMultiHeadAttention( dim=dim, num_heads=num_heads, window_size=self.window_size, drop_attn=drop_attn, drop_proj=proj_drop, sequential_attn=sequential_attn, ) self.norm1 = norm_layer(dim) self.drop_path1 = DropPath(drop_prob=drop_path) if drop_path > 0.0 else nn.Identity() # mlp branch self.mlp = Mlp( in_features=dim, hidden_features=int(dim * mlp_ratio), drop=proj_drop, out_features=dim, ) self.norm2 = norm_layer(dim) self.drop_path2 = DropPath(drop_prob=drop_path) if drop_path > 0.0 else nn.Identity() # Extra main branch norm layer mentioned for Huge/Giant models in V2 paper. # Also being used as final network norm and optional stage ending norm while still in a C-last format. self.norm3 = norm_layer(dim) if extra_norm else nn.Identity() self._make_attention_mask() self.init_weights() def _calc_window_shift(self, target_window_size): window_size = [f if f <= w else w for f, w in zip(self.feat_size, target_window_size)] shift_size = [0 if f <= w else s for f, w, s in zip(self.feat_size, window_size, self.target_shift_size)] return tuple(window_size), tuple(shift_size) def _make_attention_mask(self) -> None: """Method generates the attention mask used in shift case.""" # Make masks for shift case if any(self.shift_size): # calculate attention mask for SW-MSA H, W = self.feat_size img_mask = torch.zeros((1, H, W, 1)) # 1 H W 1 cnt = 0 for h in ( slice(0, -self.window_size[0]), slice(-self.window_size[0], -self.shift_size[0]), slice(-self.shift_size[0], None)): for w in ( slice(0, -self.window_size[1]), slice(-self.window_size[1], -self.shift_size[1]), slice(-self.shift_size[1], None)): img_mask[:, h, w, :] = cnt cnt += 1 mask_windows = window_partition(img_mask, self.window_size) # num_windows, window_size, window_size, 1 mask_windows = mask_windows.view(-1, self.window_area) attn_mask = mask_windows.unsqueeze(1) - mask_windows.unsqueeze(2) attn_mask = attn_mask.masked_fill(attn_mask != 0, float(-100.0)).masked_fill(attn_mask == 0, float(0.0)) else: attn_mask = None self.register_buffer("attn_mask", attn_mask, persistent=False) def init_weights(self): # extra, module specific weight init if self.init_values is not None: nn.init.constant_(self.norm1.weight, self.init_values) nn.init.constant_(self.norm2.weight, self.init_values) def update_input_size(self, new_window_size: Tuple[int, int], new_feat_size: Tuple[int, int]) -> None: """Method updates the image resolution to be processed and window size and so the pair-wise relative positions. Args: new_window_size (int): New window size new_feat_size (Tuple[int, int]): New input resolution """ # Update input resolution self.feat_size: Tuple[int, int] = new_feat_size self.window_size, self.shift_size = self._calc_window_shift(to_2tuple(new_window_size)) self.window_area = self.window_size[0] * self.window_size[1] self.attn.update_input_size(new_window_size=self.window_size) self._make_attention_mask() def _shifted_window_attn(self, x): B, H, W, C = x.shape # cyclic shift sh, sw = self.shift_size do_shift: bool = any(self.shift_size) if do_shift: # FIXME PyTorch XLA needs cat impl, roll not lowered # x = torch.cat([x[:, sh:], x[:, :sh]], dim=1) # x = torch.cat([x[:, :, sw:], x[:, :, :sw]], dim=2) x = torch.roll(x, shifts=(-sh, -sw), dims=(1, 2)) # partition windows x_windows = window_partition(x, self.window_size) # num_windows * B, window_size, window_size, C x_windows = x_windows.view(-1, self.window_size[0] * self.window_size[1], C) # W-MSA/SW-MSA attn_windows = self.attn(x_windows, mask=self.attn_mask) # num_windows * B, window_size * window_size, C # merge windows attn_windows = attn_windows.view(-1, self.window_size[0], self.window_size[1], C) x = window_reverse(attn_windows, self.window_size, self.feat_size) # B H' W' C # reverse cyclic shift if do_shift: # FIXME PyTorch XLA needs cat impl, roll not lowered # x = torch.cat([x[:, -sh:], x[:, :-sh]], dim=1) # x = torch.cat([x[:, :, -sw:], x[:, :, :-sw]], dim=2) x = torch.roll(x, shifts=(sh, sw), dims=(1, 2)) return x def forward(self, x: torch.Tensor) -> torch.Tensor: """Forward pass. Args: x (torch.Tensor): Input tensor of the shape [B, C, H, W] Returns: output (torch.Tensor): Output tensor of the shape [B, C, H, W] """ # post-norm branches (op -> norm -> drop) x = x + self.drop_path1(self.norm1(self._shifted_window_attn(x))) B, H, W, C = x.shape x = x.reshape(B, -1, C) x = x + self.drop_path2(self.norm2(self.mlp(x))) x = self.norm3(x) # main-branch norm enabled for some blocks / stages (every 6 for Huge/Giant) x = x.reshape(B, H, W, C) return x class PatchMerging(nn.Module): """ This class implements the patch merging as a strided convolution with a normalization before. Args: dim (int): Number of input channels norm_layer (Type[nn.Module]): Type of normalization layer to be utilized. """ def __init__(self, dim: int, norm_layer: Type[nn.Module] = nn.LayerNorm) -> None: super(PatchMerging, self).__init__() self.norm = norm_layer(4 * dim) self.reduction = nn.Linear(in_features=4 * dim, out_features=2 * dim, bias=False) def forward(self, x: torch.Tensor) -> torch.Tensor: """ Forward pass. Args: x (torch.Tensor): Input tensor of the shape [B, C, H, W] Returns: output (torch.Tensor): Output tensor of the shape [B, 2 * C, H // 2, W // 2] """ B, H, W, C = x.shape x = x.reshape(B, H // 2, 2, W // 2, 2, C).permute(0, 1, 3, 4, 2, 5).flatten(3) x = self.norm(x) x = self.reduction(x) return x class PatchEmbed(nn.Module): """ 2D Image to Patch Embedding """ def __init__(self, img_size=224, patch_size=16, in_chans=3, embed_dim=768, norm_layer=None): super().__init__() img_size = to_2tuple(img_size) patch_size = to_2tuple(patch_size) self.img_size = img_size self.patch_size = patch_size self.grid_size = (img_size[0] // patch_size[0], img_size[1] // patch_size[1]) self.num_patches = self.grid_size[0] * self.grid_size[1] self.proj = nn.Conv2d(in_chans, embed_dim, kernel_size=patch_size, stride=patch_size) self.norm = norm_layer(embed_dim) if norm_layer else nn.Identity() def forward(self, x): B, C, H, W = x.shape _assert(H == self.img_size[0], f"Input image height ({H}) doesn't match model ({self.img_size[0]}).") _assert(W == self.img_size[1], f"Input image width ({W}) doesn't match model ({self.img_size[1]}).") x = self.proj(x) x = self.norm(x.permute(0, 2, 3, 1)).permute(0, 3, 1, 2) return x class SwinTransformerV2CrStage(nn.Module): r"""This class implements a stage of the Swin transformer including multiple layers. Args: embed_dim (int): Number of input channels depth (int): Depth of the stage (number of layers) downscale (bool): If true input is downsampled (see Fig. 3 or V1 paper) feat_size (Tuple[int, int]): input feature map size (H, W) num_heads (int): Number of attention heads to be utilized window_size (int): Window size to be utilized mlp_ratio (int): Ratio of the hidden dimension in the FFN to the input channels proj_drop (float): Dropout in input mapping drop_attn (float): Dropout rate of attention map drop_path (float): Dropout in main path norm_layer (Type[nn.Module]): Type of normalization layer to be utilized. Default: nn.LayerNorm extra_norm_period (int): Insert extra norm layer on main branch every N (period) blocks extra_norm_stage (bool): End each stage with an extra norm layer in main branch sequential_attn (bool): If true sequential self-attention is performed """ def __init__( self, embed_dim: int, depth: int, downscale: bool, num_heads: int, feat_size: Tuple[int, int], window_size: Tuple[int, int], mlp_ratio: float = 4.0, init_values: Optional[float] = 0.0, proj_drop: float = 0.0, drop_attn: float = 0.0, drop_path: Union[List[float], float] = 0.0, norm_layer: Type[nn.Module] = nn.LayerNorm, extra_norm_period: int = 0, extra_norm_stage: bool = False, sequential_attn: bool = False, ) -> None: super(SwinTransformerV2CrStage, self).__init__() self.downscale: bool = downscale self.grad_checkpointing: bool = False self.feat_size: Tuple[int, int] = (feat_size[0] // 2, feat_size[1] // 2) if downscale else feat_size if downscale: self.downsample = PatchMerging(embed_dim, norm_layer=norm_layer) embed_dim = embed_dim * 2 else: self.downsample = nn.Identity() def _extra_norm(index): i = index + 1 if extra_norm_period and i % extra_norm_period == 0: return True return i == depth if extra_norm_stage else False self.blocks = nn.Sequential(*[ SwinTransformerV2CrBlock( dim=embed_dim, num_heads=num_heads, feat_size=self.feat_size, window_size=window_size, shift_size=tuple([0 if ((index % 2) == 0) else w // 2 for w in window_size]), mlp_ratio=mlp_ratio, init_values=init_values, proj_drop=proj_drop, drop_attn=drop_attn, drop_path=drop_path[index] if isinstance(drop_path, list) else drop_path, extra_norm=_extra_norm(index), sequential_attn=sequential_attn, norm_layer=norm_layer, ) for index in range(depth)] ) def update_input_size(self, new_window_size: int, new_feat_size: Tuple[int, int]) -> None: """Method updates the resolution to utilize and the window size and so the pair-wise relative positions. Args: new_window_size (int): New window size new_feat_size (Tuple[int, int]): New input resolution """ self.feat_size: Tuple[int, int] = ( (new_feat_size[0] // 2, new_feat_size[1] // 2) if self.downscale else new_feat_size ) for block in self.blocks: block.update_input_size(new_window_size=new_window_size, new_feat_size=self.feat_size) def forward(self, x: torch.Tensor) -> torch.Tensor: """Forward pass. Args: x (torch.Tensor): Input tensor of the shape [B, C, H, W] or [B, L, C] Returns: output (torch.Tensor): Output tensor of the shape [B, 2 * C, H // 2, W // 2] """ x = bchw_to_bhwc(x) x = self.downsample(x) for block in self.blocks: # Perform checkpointing if utilized if self.grad_checkpointing and not torch.jit.is_scripting(): x = checkpoint.checkpoint(block, x) else: x = block(x) x = bhwc_to_bchw(x) return x class SwinTransformerV2Cr(nn.Module): r""" Swin Transformer V2 A PyTorch impl of : `Swin Transformer V2: Scaling Up Capacity and Resolution` - https://arxiv.org/pdf/2111.09883 Args: img_size: Input resolution. window_size: Window size. If None, img_size // window_div img_window_ratio: Window size to image size ratio. patch_size: Patch size. in_chans: Number of input channels. depths: Depth of the stage (number of layers). num_heads: Number of attention heads to be utilized. embed_dim: Patch embedding dimension. num_classes: Number of output classes. mlp_ratio: Ratio of the hidden dimension in the FFN to the input channels. drop_rate: Dropout rate. proj_drop_rate: Projection dropout rate. attn_drop_rate: Dropout rate of attention map. drop_path_rate: Stochastic depth rate. norm_layer: Type of normalization layer to be utilized. extra_norm_period: Insert extra norm layer on main branch every N (period) blocks in stage extra_norm_stage: End each stage with an extra norm layer in main branch sequential_attn: If true sequential self-attention is performed. """ def __init__( self, img_size: Tuple[int, int] = (224, 224), patch_size: int = 4, window_size: Optional[int] = None, img_window_ratio: int = 32, in_chans: int = 3, num_classes: int = 1000, embed_dim: int = 96, depths: Tuple[int, ...] = (2, 2, 6, 2), num_heads: Tuple[int, ...] = (3, 6, 12, 24), mlp_ratio: float = 4.0, init_values: Optional[float] = 0., drop_rate: float = 0.0, proj_drop_rate: float = 0.0, attn_drop_rate: float = 0.0, drop_path_rate: float = 0.0, norm_layer: Type[nn.Module] = nn.LayerNorm, extra_norm_period: int = 0, extra_norm_stage: bool = False, sequential_attn: bool = False, global_pool: str = 'avg', weight_init='skip', **kwargs: Any ) -> None: super(SwinTransformerV2Cr, self).__init__() img_size = to_2tuple(img_size) window_size = tuple([ s // img_window_ratio for s in img_size]) if window_size is None else to_2tuple(window_size) self.num_classes: int = num_classes self.patch_size: int = patch_size self.img_size: Tuple[int, int] = img_size self.window_size: int = window_size self.num_features: int = int(embed_dim * 2 ** (len(depths) - 1)) self.feature_info = [] self.patch_embed = PatchEmbed( img_size=img_size, patch_size=patch_size, in_chans=in_chans, embed_dim=embed_dim, norm_layer=norm_layer, ) patch_grid_size: Tuple[int, int] = self.patch_embed.grid_size dpr = [x.tolist() for x in torch.linspace(0, drop_path_rate, sum(depths)).split(depths)] stages = [] in_dim = embed_dim in_scale = 1 for stage_idx, (depth, num_heads) in enumerate(zip(depths, num_heads)): stages += [SwinTransformerV2CrStage( embed_dim=in_dim, depth=depth, downscale=stage_idx != 0, feat_size=( patch_grid_size[0] // in_scale, patch_grid_size[1] // in_scale ), num_heads=num_heads, window_size=window_size, mlp_ratio=mlp_ratio, init_values=init_values, proj_drop=proj_drop_rate, drop_attn=attn_drop_rate, drop_path=dpr[stage_idx], extra_norm_period=extra_norm_period, extra_norm_stage=extra_norm_stage or (stage_idx + 1) == len(depths), # last stage ends w/ norm sequential_attn=sequential_attn, norm_layer=norm_layer, )] if stage_idx != 0: in_dim *= 2 in_scale *= 2 self.feature_info += [dict(num_chs=in_dim, reduction=4 * in_scale, module=f'stages.{stage_idx}')] self.stages = nn.Sequential(*stages) self.head = ClassifierHead( self.num_features, num_classes, pool_type=global_pool, drop_rate=drop_rate, ) # current weight init skips custom init and uses pytorch layer defaults, seems to work well # FIXME more experiments needed if weight_init != 'skip': named_apply(init_weights, self) def update_input_size( self, new_img_size: Optional[Tuple[int, int]] = None, new_window_size: Optional[int] = None, img_window_ratio: int = 32, ) -> None: """Method updates the image resolution to be processed and window size and so the pair-wise relative positions. Args: new_window_size (Optional[int]): New window size, if None based on new_img_size // window_div new_img_size (Optional[Tuple[int, int]]): New input resolution, if None current resolution is used img_window_ratio (int): divisor for calculating window size from image size """ # Check parameters if new_img_size is None: new_img_size = self.img_size else: new_img_size = to_2tuple(new_img_size) if new_window_size is None: new_window_size = tuple([s // img_window_ratio for s in new_img_size]) # Compute new patch resolution & update resolution of each stage new_patch_grid_size = (new_img_size[0] // self.patch_size, new_img_size[1] // self.patch_size) for index, stage in enumerate(self.stages): stage_scale = 2 ** max(index - 1, 0) stage.update_input_size( new_window_size=new_window_size, new_img_size=(new_patch_grid_size[0] // stage_scale, new_patch_grid_size[1] // stage_scale), ) @torch.jit.ignore def group_matcher(self, coarse=False): return dict( stem=r'^patch_embed', # stem and embed blocks=r'^stages\.(\d+)' if coarse else [ (r'^stages\.(\d+).downsample', (0,)), (r'^stages\.(\d+)\.\w+\.(\d+)', None), ] ) @torch.jit.ignore def set_grad_checkpointing(self, enable=True): for s in self.stages: s.grad_checkpointing = enable @torch.jit.ignore() def get_classifier(self) -> nn.Module: """Method returns the classification head of the model. Returns: head (nn.Module): Current classification head """ return self.head.fc def reset_classifier(self, num_classes: int, global_pool: Optional[str] = None) -> None: """Method results the classification head Args: num_classes (int): Number of classes to be predicted global_pool (str): Unused """ self.num_classes = num_classes self.head.reset(num_classes, global_pool) def forward_features(self, x: torch.Tensor) -> torch.Tensor: x = self.patch_embed(x) x = self.stages(x) return x def forward_head(self, x, pre_logits: bool = False): return self.head(x, pre_logits=True) if pre_logits else self.head(x) def forward(self, x: torch.Tensor) -> torch.Tensor: x = self.forward_features(x) x = self.forward_head(x) return x def init_weights(module: nn.Module, name: str = ''): # FIXME WIP determining if there's a better weight init if isinstance(module, nn.Linear): if 'qkv' in name: # treat the weights of Q, K, V separately val = math.sqrt(6. / float(module.weight.shape[0] // 3 + module.weight.shape[1])) nn.init.uniform_(module.weight, -val, val) elif 'head' in name: nn.init.zeros_(module.weight) else: nn.init.xavier_uniform_(module.weight) if module.bias is not None: nn.init.zeros_(module.bias) elif hasattr(module, 'init_weights'): module.init_weights() def checkpoint_filter_fn(state_dict, model): """ convert patch embedding weight from manual patchify + linear proj to conv""" state_dict = state_dict.get('model', state_dict) state_dict = state_dict.get('state_dict', state_dict) if 'head.fc.weight' in state_dict: return state_dict out_dict = {} for k, v in state_dict.items(): if 'tau' in k: # convert old tau based checkpoints -> logit_scale (inverse) v = torch.log(1 / v) k = k.replace('tau', 'logit_scale') k = k.replace('head.', 'head.fc.') out_dict[k] = v return out_dict def _create_swin_transformer_v2_cr(variant, pretrained=False, **kwargs): default_out_indices = tuple(i for i, _ in enumerate(kwargs.get('depths', (1, 1, 1, 1)))) out_indices = kwargs.pop('out_indices', default_out_indices) model = build_model_with_cfg( SwinTransformerV2Cr, variant, pretrained, pretrained_filter_fn=checkpoint_filter_fn, feature_cfg=dict(flatten_sequential=True, out_indices=out_indices), **kwargs ) return model def _cfg(url='', **kwargs): return { 'url': url, 'num_classes': 1000, 'input_size': (3, 224, 224), 'pool_size': (7, 7), 'crop_pct': 0.9, 'interpolation': 'bicubic', 'fixed_input_size': True, 'mean': IMAGENET_DEFAULT_MEAN, 'std': IMAGENET_DEFAULT_STD, 'first_conv': 'patch_embed.proj', 'classifier': 'head.fc', **kwargs, } default_cfgs = generate_default_cfgs({ 'swinv2_cr_tiny_384.untrained': _cfg( url="", input_size=(3, 384, 384), crop_pct=1.0, pool_size=(12, 12)), 'swinv2_cr_tiny_224.untrained': _cfg( url="", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_tiny_ns_224.sw_in1k': _cfg( hf_hub_id='timm/', url="https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights-swinv2/swin_v2_cr_tiny_ns_224-ba8166c6.pth", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_small_384.untrained': _cfg( url="", input_size=(3, 384, 384), crop_pct=1.0, pool_size=(12, 12)), 'swinv2_cr_small_224.sw_in1k': _cfg( hf_hub_id='timm/', url="https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights-swinv2/swin_v2_cr_small_224-0813c165.pth", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_small_ns_224.sw_in1k': _cfg( hf_hub_id='timm/', url="https://github.com/rwightman/pytorch-image-models/releases/download/v0.1-weights-swinv2/swin_v2_cr_small_ns_224_iv-2ce90f8e.pth", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_small_ns_256.untrained': _cfg( url="", input_size=(3, 256, 256), crop_pct=1.0, pool_size=(8, 8)), 'swinv2_cr_base_384.untrained': _cfg( url="", input_size=(3, 384, 384), crop_pct=1.0, pool_size=(12, 12)), 'swinv2_cr_base_224.untrained': _cfg( url="", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_base_ns_224.untrained': _cfg( url="", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_large_384.untrained': _cfg( url="", input_size=(3, 384, 384), crop_pct=1.0, pool_size=(12, 12)), 'swinv2_cr_large_224.untrained': _cfg( url="", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_huge_384.untrained': _cfg( url="", input_size=(3, 384, 384), crop_pct=1.0, pool_size=(12, 12)), 'swinv2_cr_huge_224.untrained': _cfg( url="", input_size=(3, 224, 224), crop_pct=0.9), 'swinv2_cr_giant_384.untrained': _cfg( url="", input_size=(3, 384, 384), crop_pct=1.0, pool_size=(12, 12)), 'swinv2_cr_giant_224.untrained': _cfg( url="", input_size=(3, 224, 224), crop_pct=0.9), }) @register_model def swinv2_cr_tiny_384(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-T V2 CR @ 384x384, trained ImageNet-1k""" model_args = dict( embed_dim=96, depths=(2, 2, 6, 2), num_heads=(3, 6, 12, 24), ) return _create_swin_transformer_v2_cr('swinv2_cr_tiny_384', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_tiny_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-T V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=96, depths=(2, 2, 6, 2), num_heads=(3, 6, 12, 24), ) return _create_swin_transformer_v2_cr('swinv2_cr_tiny_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_tiny_ns_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-T V2 CR @ 224x224, trained ImageNet-1k w/ extra stage norms. ** Experimental, may make default if results are improved. ** """ model_args = dict( embed_dim=96, depths=(2, 2, 6, 2), num_heads=(3, 6, 12, 24), extra_norm_stage=True, ) return _create_swin_transformer_v2_cr('swinv2_cr_tiny_ns_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_small_384(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-S V2 CR @ 384x384, trained ImageNet-1k""" model_args = dict( embed_dim=96, depths=(2, 2, 18, 2), num_heads=(3, 6, 12, 24), ) return _create_swin_transformer_v2_cr('swinv2_cr_small_384', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_small_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-S V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=96, depths=(2, 2, 18, 2), num_heads=(3, 6, 12, 24), ) return _create_swin_transformer_v2_cr('swinv2_cr_small_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_small_ns_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-S V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=96, depths=(2, 2, 18, 2), num_heads=(3, 6, 12, 24), extra_norm_stage=True, ) return _create_swin_transformer_v2_cr('swinv2_cr_small_ns_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_small_ns_256(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-S V2 CR @ 256x256, trained ImageNet-1k""" model_args = dict( embed_dim=96, depths=(2, 2, 18, 2), num_heads=(3, 6, 12, 24), extra_norm_stage=True, ) return _create_swin_transformer_v2_cr('swinv2_cr_small_ns_256', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_base_384(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-B V2 CR @ 384x384, trained ImageNet-1k""" model_args = dict( embed_dim=128, depths=(2, 2, 18, 2), num_heads=(4, 8, 16, 32), ) return _create_swin_transformer_v2_cr('swinv2_cr_base_384', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_base_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-B V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=128, depths=(2, 2, 18, 2), num_heads=(4, 8, 16, 32), ) return _create_swin_transformer_v2_cr('swinv2_cr_base_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_base_ns_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-B V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=128, depths=(2, 2, 18, 2), num_heads=(4, 8, 16, 32), extra_norm_stage=True, ) return _create_swin_transformer_v2_cr('swinv2_cr_base_ns_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_large_384(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-L V2 CR @ 384x384, trained ImageNet-1k""" model_args = dict( embed_dim=192, depths=(2, 2, 18, 2), num_heads=(6, 12, 24, 48), ) return _create_swin_transformer_v2_cr('swinv2_cr_large_384', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_large_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-L V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=192, depths=(2, 2, 18, 2), num_heads=(6, 12, 24, 48), ) return _create_swin_transformer_v2_cr('swinv2_cr_large_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_huge_384(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-H V2 CR @ 384x384, trained ImageNet-1k""" model_args = dict( embed_dim=352, depths=(2, 2, 18, 2), num_heads=(11, 22, 44, 88), # head count not certain for Huge, 384 & 224 trying diff values extra_norm_period=6, ) return _create_swin_transformer_v2_cr('swinv2_cr_huge_384', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_huge_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-H V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=352, depths=(2, 2, 18, 2), num_heads=(8, 16, 32, 64), # head count not certain for Huge, 384 & 224 trying diff values extra_norm_period=6, ) return _create_swin_transformer_v2_cr('swinv2_cr_huge_224', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_giant_384(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-G V2 CR @ 384x384, trained ImageNet-1k""" model_args = dict( embed_dim=512, depths=(2, 2, 42, 2), num_heads=(16, 32, 64, 128), extra_norm_period=6, ) return _create_swin_transformer_v2_cr('swinv2_cr_giant_384', pretrained=pretrained, **dict(model_args, **kwargs)) @register_model def swinv2_cr_giant_224(pretrained=False, **kwargs) -> SwinTransformerV2Cr: """Swin-G V2 CR @ 224x224, trained ImageNet-1k""" model_args = dict( embed_dim=512, depths=(2, 2, 42, 2), num_heads=(16, 32, 64, 128), extra_norm_period=6, ) return _create_swin_transformer_v2_cr('swinv2_cr_giant_224', pretrained=pretrained, **dict(model_args, **kwargs))
pytorch-image-models/timm/models/swin_transformer_v2_cr.py/0
{ "file_path": "pytorch-image-models/timm/models/swin_transformer_v2_cr.py", "repo_id": "pytorch-image-models", "token_count": 18939 }
199