Year of Paper int64 1.99k 2.02k | Link to PubMed Entry stringlengths 40 154 | Journals stringclasses 173
values | Journal DOI stringlengths 13 82 | Citation stringlengths 132 505 | Type of Nucleic Acid stringclasses 13
values | Name of Aptamer stringlengths 1 102 | Target stringlengths 4 128 | Aptamer Sequence stringlengths 19 316 | Sequence Length int64 15 312 | GC Content float64 0.3 0.83 | Affinity stringlengths 3 186 | Kd (nM) float64 0 208M ⌀ | Pool Type stringlengths 3 360 | Pool Random Region float64 0 120 ⌀ | Binding Buffer/Conditions stringlengths 3 291 | Divalent Salt stringclasses 4
values | Type of the buffer stringclasses 4
values | pH float64 3.6 9.6 ⌀ | Molecular weight of target stringclasses 84
values | Application as quoted in the referenced paper stringlengths 3 1.13k | Post-selex modifications to the aptamer stringclasses 134
values | Additional Information
stringlengths 3 1.22k ⌀ | Serial Number int64 10M 10M | Parent sequence serial number float64 10M 10M ⌀ | Corresponding Author Name, email address stringlengths 3 118 ⌀ | Aptagen Cross Referencing(Check Aptamer Chemistry, Affinity, Length, GC content, sequence) stringclasses 75
values |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1,990 | https://pubmed.ncbi.nlm.nih.gov/1697402/ | Nature | https://doi.org/10.1038/346818a0 | Ellington, A. D., & Szostak, J. W. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature, 346(6287), 818–822. https://doi.org/10.1038/346818a0 | ssRNA | CB-42 | Cibacron Blue 3GA | 5'GGGAGAAUUCCCGCGGCAGAAGCCCACCUGGCUUUGAACUCUAUGUUAUUGGGUGGGGGAAACUUAAGAAAACUACCACCCUUCAACAUUACCGCCCUUCAGCCUGCCAGCGCCCUGCAGCCCGGGAAGCUU3' | 132 | 0.560606 | Kd~600µM | 600,000 | 5'-GGGAGAATTCCCGCGG-N98-CTGCAGCCCGGGAAGCTT-3' | 98 | 0.6 ml of 0.5 M LiCI, 20 mM Tris-HCI, pH 7.6, 1 mM MgCl2 | MgCl | Tris Buffers | 7.6 | Not reported | Detection: " Isolate RNAs that bind to several dyes that appear to mimic metabolic cofactors. For example, Cibacron Blue binds tightly to the NADbinding site of many dehydrogenases and Cibacron Blue columns have been used for purification of these proteins by affinity chromatography. The experiments described here used Cibacron Blue 3GA (CB), Reactive Red 120 (R), Reactive Yellow 86 (Y), Reactive Brown 10 (BR), Reactive Green 19 (GR) and Reactive Blue 4 (B4) attached to cross-linked, beaded agarose. We chose these molecules because they have many possible hydrogen-bond donor and acceptor groups as well as planar surfaces for stacking interactions." | Not applicable | The aptamer was reported in DNA (include thymine nucleotide, instead of Uridine). The T was changed to U to match the discription of paper content.
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,000 | null | Szostak JW | null |
1,990 | https://pubmed.ncbi.nlm.nih.gov/1697402/ | Nature | https://doi.org/10.1038/346818a0 | Ellington, A. D., & Szostak, J. W. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature, 346(6287), 818–822. https://doi.org/10.1038/346818a0 | ssRNA | B4-25 | Reactive Blue 4 | 5'GGGAGAAUUCCCGCGGCGUUGGCCCAGGAUAAUAGGACGAAAUCCGAAAAAUCCGUACCCAACAUAGAACCCCCCCAGCGCUCACACGGACGCCCCAUUACGGCUAACCGAACGCCUGCAGCCCGGGAAGCUU3' | 133 | 0.593985 | Kd<100µM | 100,000 | 5'-GGGAGAATTCCCGCGG-N97-CTGCAGCCCGGAAGCTT-3' | 97 | 0.6 ml of 0.5 M LiCI, 20 mM Tris-HCI, pH 7.6, 1 mM MgCl3 | MgCl | Tris Buffers | 7.6 | Not reported | Detection: " Isolate RNAs that bind to several dyes that appear to mimic metabolic cofactors. For example, Cibacron Blue binds tightly to the NADbinding site of many dehydrogenases and Cibacron Blue columns have been used for purification of these proteins by affinity chromatography. The experiments described here used Cibacron Blue 3GA (CB), Reactive Red 120 (R), Reactive Yellow 86 (Y), Reactive Brown 10 (BR), Reactive Green 19 (GR) and Reactive Blue 4 (B4) attached to cross-linked, beaded agarose. We chose these molecules because they have many possible hydrogen-bond donor and acceptor groups as well as planar surfaces for stacking interactions." | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,001 | null | Szostak JW | null |
1,990 | https://pubmed.ncbi.nlm.nih.gov/2200121/ | Science | https://doi.org/10.1126/science.2200121 | Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science (New York, N.Y.), 249(4968), 505–510. https://doi.org/10.1126/science.2200121 | ssRNA | wild type | T4 DNA polymerase (gp43) | 5'GAAUUGUGGUGUUGGCUCCCUAUAGUGAGUCGUAUUAAUAUUCCUUAGUUUUAUAGCCCAAUAACUCAGGCUCUUGAUUGGUUUUCAAUAGAGAUAUAAAAUUCUUUUCAUAG3' | 113 | 0.336283 | Kd: 4.8 nM | 4.8 | 5'-GAATTGTGGTGTTGGCTCCCTATAGTGAGTCGTATTA-ATATTCCTTAGTTTTATAGCCC-N9-AGGCTCTTGATTG-GTTTTCAATAGAGATATAAAATTCTTTTCATAG-3' | 9 | Not reported | null | Not Reported | null | Not reported | Detection: " We have previously shown that the RNA target of T4 DNA polymerase selectively inhibits its replicative function.Thus,the products of SELEX can affect the activity of the protein to which they have been fit. We expect that, at the very least,nucleic acid ligands that inhibit replicative proteins of epidemiologically important infections can be likewise evolved." | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,002 | null | Gold L | null |
1,990 | https://pubmed.ncbi.nlm.nih.gov/2200121/ | Science | https://doi.org/10.1126/science.2200121 | Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science (New York, N.Y.), 249(4968), 505–510. https://doi.org/10.1126/science.2200121 | ssRNA | major variant | T4 DNA polymerase (gp43) | 5'GAAUUGUGGUGUUGGCUCCCUAUAGUGAGUCGUAUUAAUAUUCCUUAGUUUUAUAGCCCAGCAACCUAGGCUCUUGAUUGGUUUUCAAUAGAGAUAUAAAAUUCUUUUCAUAG3' | 113 | 0.353982 | Kd: 4.8 nM | 4.8 | 5'-GAATTGTGGTGTTGGCTCCCTATAGTGAGTCGTATTA-ATATTCCTTAGTTTTATAGCCC-N9-AGGCTCTTGATTG-GTTTTCAATAGAGATATAAAATTCTTTTCATAG-3' | 9 | Not reported | null | Not Reported | null | Not reported | Detection: " We have previously shown that the RNA target of T4 DNA polymerase selectively inhibits its replicative function.Thus,the products of SELEX can affect the activity of the protein to which they have been fit. We expect that, at the very least,nucleic acid ligands that inhibit replicative proteins of epidemiologically important infections can be likewise evolved." | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,003 | null | Gold L | null |
1,992 | https://pubmed.ncbi.nlm.nih.gov/1741036/ | Nature | https://doi.org/10.1038/355564a0 | Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H., & Toole, J. J. (1992). Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature, 355(6360), 564–566. https://doi.org/10.1038/355564a0 | ssDNA | 15 mer (colloquially known as Bock DNA Aptamer) | Thrombin (Sigma), Human | 5'GGTTGGTGTGGTTGG3' | 15 | 0.6 | Kd: 25-200 nM | 112.5 | 5'-CGTACGGTCGACGCTAGC-60N-CACGTGGAGCTCGGATCC-3' | 60 | 19 mM Tris-acetate, pH 7.4, 140 mM NaCI, 5 mM KCI, 1 mM CaCI2, 1 mM MgCI2 | MgCl | Tris Buffers | 7.4 | Not reported | Diagnostic and therapeutic: "We are at present investigating the aptamer-binding site on thrombin and analysing the binding sequences of individual aptamers in an effort to understand the base relationships that mediate binding and inhibition, our long-term interest being to develop diagnostics and therapeutic agents." | Not applicable | Presumed minimized variant was found | 10,000,004 | null | Toole JJ | null |
1,992 | https://pubmed.ncbi.nlm.nih.gov/1379730/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.89.15.6988 | Tuerk, C., MacDougal, S., & Gold, L. (1992). RNA pseudoknots that inhibit human immunodeficiency virus type 1 reverse transcriptase. Proceedings of the National Academy of Sciences of the United States of America, 89(15), 6988–6992. https://doi.org/10.1073/pnas.89.15.6988 | ssRNA | ligand 1.1 | Human imunnodeficiency virus type 1 reverse transcriptase (HIV-1-RT) | 5'GGGAGCAUCAGACUUUUAAUCUGACAAUCAAGAAUUCCGUUUUCAGUCGGGAAAAACUGAACAAUCUAUGAAAGAAUUUUAUAUCUCUAUUGAAAC3' | 96 | 0.333333 | Kd: 5 nM | 5 | 5'-GGGAGCAUCAGACUUUUAAUCUGACAAUCAAG-N32-AUCUAUGAAAGAAUUUUAUAUCUCUAUUGAAAC-3' | 32 | 200 mM KOAc/50 mM Tris-HCI, pH 7.7/10 mM dithiothreitol | null | Tris Buffers | 7.7 | Not reported | Therapeutic: " Demonstrated that at least one of the ligands inhibits cDNA synthesis by HIV reverse transcriptase but falls to inhibit other reverse transcriptases. These exeriments highlight the power of SELEX to yield hlghiy spedfc ligands that reduce the activity of target proteins. Such ligands may provide therapeutic reagents for viral and' other dies." | Not applicable | null | 10,000,006 | null | Gold L | null |
1,992 | https://pubmed.ncbi.nlm.nih.gov/1379730/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.89.15.6988 | Tuerk, C., MacDougal, S., & Gold, L. (1992). RNA pseudoknots that inhibit human immunodeficiency virus type 1 reverse transcriptase. Proceedings of the National Academy of Sciences of the United States of America, 89(15), 6988–6992. https://doi.org/10.1073/pnas.89.15.6988 | ssRNA | ligand 1.3a | Human imunnodeficiency virus type 1 reverse transcriptase (HIV-1-RT) | 5'GGGAGCAUCAGACUUUUAAUCUGACAAUCAAGAAUAUCUUCCGAAGCCGAACGGGAAAACCGGCAUCUAUGAAAGAAUUUUAUCUCUAUUGAAAC3' | 95 | 0.389474 | Kd: 5 nM | 5 | 5'-GGGAGCAUCAGACUUUUAAUCUGACAAUCAA-N32-AUCUAUGAAAGAAUUUUAUCUCUAUUGAAAC-3' | 32 | 200 mM KOAc/50 mM Tris-HCI, pH 7.7/10 mM dithiothreitol | null | Tris Buffers | 7.7 | Not reported | Therapeutic: " Demonstrated that at least one of the ligands inhibits cDNA synthesis by HIV reverse transcriptase but falls to inhibit other reverse transcriptases. These exeriments highlight the power of SELEX to yield hlghiy spedfc ligands that reduce the activity of target proteins. Such ligands may provide therapeutic reagents for viral and' other dies." | Not applicable | null | 10,000,007 | null | Gold L | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 5A | Basic fibroblast growth factor (bFGF) | 5'GGGAGCUCAGAAUAAACGCUCAAAUCUCCUCCCGUCGAAGCUAACCUGGCCACUUCGACAUGAGGCCCGGAUCCGGC3' | 77 | 0.584416 | Kd: 23 ± 3 nM | 23 | 5'-GGGAGCUCAGAAUAAACGCUCAA-N30-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18000 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,008 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 7A | Basic fibroblast growth factor (bFGF) | 5'GGGAGCUCAGAAUAAACGCUCAAUCGGCGAGCUAACCAAGACACUCGCUGCACUUCGACAUGAGGCCCGGAUCCGGC3' | 77 | 0.584416 | Kd: 5.0 ± 0.5 nM | 5 | 5'-GGGAGCUCAGAAUAAACGCUCAA-N30-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18001 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,009 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 13A | Basic fibroblast growth factor (bFGF) | 5'GGGAGCUCAGAAUAAACGCUCAAACCCGCGGCCUCCGAAGCUAACCAGGACACUUCGACAUGAGGCCCGGAUCCGGC3' | 77 | 0.61039 | Kd: 3.2 ± 0.5 nM | 3.2 | 5'-GGGAGCUCAGAAUAAACGCUCAA-N30-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18002 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,010 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 14A | Basic fibroblast growth factor (bFGF) | 5'GGGAGCUCAGAAUAAACGCUCAAUGGGUGCUAACCAGGACACACCCACGCUGUUUCGACAUGAGGCCCGGAUCCGGC3' | 77 | 0.584416 | Kd: 3.0 ± 0.5 nM | 3 | 5'-GGGAGCUCAGAAUAAACGCUCAA-N30-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18003 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,011 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 21A | Basic fibroblast growth factor (bFGF) | 5'GGGAGCUCAGAAUAAACGCUCAAUGGGUGCUUAACCAGGCCACACCCUGCUGUUUCGACAUGAGGCCCGGAUCCGGC3' | 77 | 0.584416 | Kd: 8.1 ± 0.8 nM | 8.1 | 5'-GGGAGCUCAGAAUAAACGCUCAA-N30-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18004 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,012 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 12A | Basic fibroblast growth factor (bFGF) | 5'GGGAGAUGCCUGUCGAGCAUGCUGGGGGCAACGCUACAGACAAGUGCACCCAACGUAGCUAAACAGCUUUGUCGACGGG3' | 79 | 0.582278 | Kd: exhibits biphasic binding, 0.51 ± 0.13 nM, 60 ± 52 nM | 0.51 | 5'-GGGAGAUGCCUGUCGAGCAUGCUG-N30-GUAGCUAAACAGCUUUGUCGACGGG-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18005 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,013 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 26At | Basic fibroblast growth factor (bFGF) | 5'GGUGAAGGCAACGUAUAGGCAAGCACACUUCACC3' | 34 | 0.529412 | Kd: ~0.19 ± 0.02 nM | 0.19 | 5'-GGGAGAUGCCUGUCGAGCAUGCUG-N30-GUAGCUAAACAGCUUUGUCGACGGG-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18006 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Truncated | null | 10,000,014 | null | Janjić N | 5'rGprGprUprGprAprAprGprGprCprAprAprCprGprUprAprUprAprGprGprCprAprAprGprCprAprCprAprCprUprUprCprAprCprCp3'
https://www.aptagen.com/aptamer-details/?id=136 |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 26A | Basic fibroblast growth factor (bFGF) | 5'GGGAGAUGCCUGUCGAGCAUGCUGCGUCAGAAGGCAACGUAUAGGCAAGCACACGUAGCUAAACAGCUUUGUCGACGGG3' | 79 | 0.556962 | Kd: exhibits biphasic binding, 0.19 ± 0.02 nM, 49 ± 26 nM | 0.19 | 5'-GGGAGAUGCCUGUCGAGCAUGCUG-N30-GUAGCUAAACAGCUUUGUCGACGGG-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18006 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,015 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7504300/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.90.23.11227 | Jellinek, D., Lynott, C. K., Rifkin, D. B., & Janjić, N. (1993). High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding. Proceedings of the National Academy of Sciences of the United States of America, 90(23), 11227–11231. https://doi.org/10.1073/pnas.90.23.11227 | ssRNA | 28B | Basic fibroblast growth factor (bFGF) | 5'GGGAGAUGCCUGUCGAGCAUGCUGAGGGUAACGUAUAGUCAAGACACCUCAAGUGUAGCUAAACAGCUUUGUCGACGGG3' | 79 | 0.518987 | Kd: exhibits biphasic binding, 0.32 ± 0.07 nM, 140 ± 80 nM | 0.32 | 5'-GGGAGAUGCCUGUCGAGCAUGCUG-N30-GUAGCUAAACAGCUUUGUCGACGGG-3' | 30 | PBS = 10.1 mMNa2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4 | null | PBS/phosphate buffers | 7.4 | 18008 Da | Detection: " Describe and characterize a set of high-affinity RNA ligands for bFGF that were selected from a pool of 10^14 molecules and show that these ligands inhibit binding of the growth factor to its cell-surface receptors. The idea that bFGF antagonists may have useful medicinal applications is not new (reviewed in ref. 5). bFGF is believed to play a key role in the development of smooth-muscle cell lesions following vascular injury. Overexpression of bFGF (and other members of the FGF family) is correlated with many malignant disorders" | Not applicable | null | 10,000,017 | null | Janjić N | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 9 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'GCUCUUGGGCGCAGCCUCAAUGAGGCUGGUGGUGCAAG3' | 38 | 0.631579 | Kd: 1.9 ± 0.21* | null | 5'-GCUCUUG-N4-CAGCCUCAAUGAGGCUG-N6-CAAG-3' | 10 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units.
Sequences at the defined 5' and 3' ends of the 76.6 DNA pool
are, respectively, 5'-GGTAATACGATCACTATAGGG4ACTC_x0002_GATGAAGCGAGCT-3' and 5'-TACTGACT7CGGCATCCCTGC-
-(3') | 10,000,018 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 18 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'GCUCUUGGGCGCAGCCUCAAUGAGGCUGGAGGUACAAG3' | 38 | 0.605263 | Kd: 2.0* | null | 5'-GCUCUUG-N4-CAGCCUCAAUGAGGCUG-N6-CAAG-3' | 10 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
Sequences at the defined 5' and 3' ends of the 76.6 DNA pool
are, respectively, 5'-GGTAATACGATCACTATAGGG4ACTC_x0002_GATGAAGCGAGCT-3' and 5'-TACTGACT7CGGCATCCCTGC-
-(3') | 10,000,019 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 19 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'GCUCUUGGGCACAGCCUCAAUGAGGCUGGUGGUACAAG3' | 38 | 0.578947 | Kd: 1.2 ± 0.08* | null | 5'-GCUCUUG-N4-CAGCCUCAAUGAGGCUG-N6-CAAG-3' | 10 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
Sequences at the defined 5' and 3' ends of the 76.6 DNA pool
are, respectively, 5'-GGTAATACGATCACTATAGGG4ACTC_x0002_GATGAAGCGAGCT-3' and 5'-TACTGACT7CGGCATCCCTGC-
-(3') | 10,000,020 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 6 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'GCUCUUGGACACAGCCUCAAUGAGGCUGCAGAUACAAG3' | 38 | 0.526316 | Kd: 3.1 ± 0.26* | null | 5'-GCUCUUG-N4-CAGCCUCAAUGAGGCUG-N6-CAAG-3' | 10 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
Sequences at the defined 5' and 3' ends of the 76.6 DNA pool
are, respectively, 5'-GGTAATACGATCACTATAGGG4ACTC_x0002_GATGAAGCGAGCT-3' and 5'-TACTGACT7CGGCATCCCTGC-
-(3') | 10,000,021 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 116 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'GCUCUUGGACACAGCUGCUGCAGAUACAAG3' | 30 | 0.533333 | Kd: 2.1* | null | 5'-GCUCUUG-N4-CAGCCUCAAUGAGGCUG-N6-CAAG-3' | 10 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
Sequences at the defined 5' and 3' ends of the 76.6 DNA pool
are, respectively, 5'-GGTAATACGATCACTATAGGG4ACTC_x0002_GATGAAGCGAGCT-3' and 5'-TACTGACT7CGGCATCCCTGC-
-(3') | 10,000,022 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 126 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'GCUCUUGGACACAGCCUCAAUGAGGCUGCAGAAACAAG3' | 38 | 0.526316 | Kd: 2.7 ± 0.29* | null | 5'-GCUCUUG-N4-CAGCCUCAAUGAGGCUG-N6-CAAG-3' | 10 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
Sequences at the defined 5' and 3' ends of the 76.6 DNA pool
are, respectively, 5'-GGTAATACGATCACTATAGGG4ACTC_x0002_GATGAAGCGAGCT-3' and 5'-TACTGACT7CGGCATCCCTGC-
-(3') | 10,000,023 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 15 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'GCUCUUGGCCGCAGCCUCAAUGAGGCUGAUGAUACAAG3' | 38 | 0.552632 | Kd: 1.7* | null | 5'-GCUCUUG-N4-CAGCCUCAAUGAGGCUG-N6-CAAG-3' | 10 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
Sequences at the defined 5' and 3' ends of the 76.6 DNA pool
are, respectively, 5'-GGTAATACGATCACTATAGGG4ACTC_x0002_GATGAAGCGAGCT-3' and 5'-TACTGACT7CGGCATCCCTGC-
-(3') | 10,000,024 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 1 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUACUCCGUACGCAAGUACGGUCGAGAAACAG3' | 37 | 0.486486 | Kd: 4.3* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,025 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 2 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUUUAGGACUCGUACGCAAGUACUGAGAUACUACAG3' | 41 | 0.414634 | Kd: 2.4* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,026 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 14 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGACUCGUACGCAAGUACUGGAGAAACAG3' | 34 | 0.470588 | Kd: 5.4 ± 0.05* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,028 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 23 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUGGACUCGUACGCAAGUACUUGAGAUACACG3' | 37 | 0.459459 | Kd: 3.1* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,029 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 50 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGUCUCGUACGCAAGUACUGAGAAACGACAG3' | 36 | 0.472222 | Kd: 0.4* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,030 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 63 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGACUCCGUAUGCAAGUACGUUGAGCAACAG3' | 36 | 0.472222 | Kd: 7.7, 9.5, 9.6* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,031 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 74 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUAGACUCGUACGCAAGUACUCGAGAUAUACAG3' | 38 | 0.421053 | Kd: 4.2* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,032 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 83 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUGGACUCGUACGCAAGUACUGAGAAACACCG3' | 37 | 0.486486 | Kd: 3.6* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,034 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 88 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUGACUCUUUGUACGCAAGUACAGAGUGAUACAG3' | 39 | 0.410256 | Kd: 1.4* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,035 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 15 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGACGCGUACGCAAGUACUGUGAUACAG3' | 33 | 0.484848 | Kd: 4.1* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,036 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 17 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGACGCGCUGGUACGCAAGUACGGCUGUGAUACAG3' | 40 | 0.55 | Kd: 3.9* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,037 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 20 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUACUCUCGUACGCAAGUACGAUCGAGACACAG3' | 38 | 0.473684 | Kd: 2.6* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,039 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 51 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUGAGCUCGUACGCAAGUACUCGAGGUACAG3' | 36 | 0.5 | Kd: 1.0* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,040 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 58 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUACUCCUGUACGCAAGUACGGUUGAGACACAG3' | 38 | 0.473684 | Kd: 3.2* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,042 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 72 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUAUGAGAGUAGCAAGUACCGGACUCUACAG3' | 36 | 0.444444 | Kd: 0.3* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,043 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 73 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUGCUCGUGUACGCAAGUACGCUUGAGGAACAG3' | 38 | 0.5 | Kd: 1.4* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,044 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 86 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUGUAGAGGUACGCAAGUACGCGCUCCACAG3' | 36 | 0.527778 | Kd: 6.4, 6.5, 7.4, 9.7* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,045 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 92 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGUGUAGAGGUACGCAAGUAAGCGGCUCCACAG3' | 37 | 0.513514 | Kd: 7.4* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,047 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 22 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGUACGUUGUACGCAAGUACACGGGUUACAG3' | 36 | 0.472222 | Kd: 0.7* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,048 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 59 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGCUUCGUACGCAAGUAUGAUGAUACAG3' | 33 | 0.424242 | Kd: 0.2* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,049 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 61 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGACAUCGUACGCAAGUACCUUGAAACAG3' | 34 | 0.441176 | Kd: 4.6* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,050 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 76 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGACUUCGGUACGCAAUUACCGACUGACACAG3' | 37 | 0.486486 | Kd: 2.4* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,051 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 79 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCUGGACAUUUGUACGCAAGUACGUUUGAUACAG3' | 36 | 0.388889 | Kd: 3.9* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,052 | null | Ellington AD | null |
1,993 | https://pubmed.ncbi.nlm.nih.gov/7505429/ | Nucleic Acids Res | https://doi.org/10.1093/nar/21.23.5509 | Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993). Selective optimization of the Rev-binding element of HIV-1. Nucleic acids research, 21(23), 5509–5516. https://doi.org/10.1093/nar/21.23.5509 | ssRNA | 18 | Rev protein of HIV-1 (minimal Rev-binding element (RBE) found within the Rev Responsive Element (RRE)) | 5'AUUCGGUAGCAUCUUGUACGCAAGUACGAGAGAGCAACAG3' | 40 | 0.475 | Kd: 0.5* | null | 5'-AUUCUGU-N6.9-GUACGCAAGUAC-N6.9-ACAG-3' | 15 | 50 mM KCl, 50 mM Tris-Cl, pH 8.0 | null | Tris Buffers | 8 | Not reported | Therapeutic: " A population of improved Rev-binding aptamers can be used to inhibit viral
replication, as opposed to a single RNA species. In contrast to other pharmaceuticals, this approach will make it extremely difficult for HIV-1 to accumulate mutations that can simultaneously evade a multitude of different RRE decays." | Not applicable | *Activity values are described as "representing relative Kd's" with no units
6.9 means Both random sequence tracts were systematically varied from 6 to 9 nts in length.
Sequences at the defined 5' and 3' ends of the 79.9
pool are, respectively, 5'-GGTAATACGACTCACTATAGGG_x0002_AACTCG4TG4AGCGAATT-3' and 5'-GCCTATCTATCGGAT_x0002_CCACG-3'. | 10,000,053 | null | Ellington AD | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7518917/ | Nucleic Acids Res | https://doi.org/10.1093/nar/22.13.2619 | Kubik, M. F., Stephens, A. W., Schneider, D., Marlar, R. A., & Tasset, D. (1994). High-affinity RNA ligands to human alpha-thrombin. Nucleic acids research, 22(13), 2619–2626. https://doi.org/10.1093/nar/22.13.2619 | ssRNA | 16 | α-Thrombin, Human | 5'GGGAGAUGCCUGUCGAGCAUGCUGCAUCCGGAUCGAAGUUAGUAGGCGGAGUGGUAGCUAAACAGCUUUGUCGACGGG3' | 78 | 0.564103 | Kd: 37 ± 3.5 nM | 37 | 5'-CCCGTCGACAAAGCTGTTTAGCTAC-N30-CAGCATGCTCGACAGGCATCT-3' | 30 | 50 mM Tris-HCl, pH 7.7, 100 mM NaCl, 1 mM DTT, and 1 mM MgCl2 | MgCl | Tris Buffers | 7.7 | Not reported | Therapeutic: " These sequences can be used as a molecular anchor to select for a larger RNA with more extensive protein interactions, including the active site. One can also envision development of a heparin mimic that could be more specific for the ATIE-mediated inhibition of thrombin. It is clear from this work and related work that oligonucleotides have great potential as antithrombotic agents." | Minimum sequence requirements for high affinity binding derived from clone 16 (truncated) | 5' and 3' fixed regions differ than pool non-random regions.
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,054 | null | Tasset D | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7518917/ | Nucleic Acids Res | https://doi.org/10.1093/nar/22.13.2619 | Kubik, M. F., Stephens, A. W., Schneider, D., Marlar, R. A., & Tasset, D. (1994). High-affinity RNA ligands to human alpha-thrombin. Nucleic acids research, 22(13), 2619–2626. https://doi.org/10.1093/nar/22.13.2619 | ssRNA | 27 | α-Thrombin, Human | 5'GGGAGAUGCCUGUCGAGCAUGCUGGUGCGGCUUUGGGCGCCGUGCUUGACGUAGCUAAACAGCUUUGUCGACGGG3' | 75 | 0.613333 | Kd: 114 ± 2.0 nM | 114 | 5'-CCCGTCGACAAAGCTGTTTAGCTAC-N30-CAGCATGCTCGACAGGCATCT-3' | 30 | 50 mM Tris-HCl, pH 7.7, 100 mM NaCl, 1 mM DTT, and 1 mM MgCl2 | MgCl | Tris Buffers | 7.7 | Not reported | Therapeutic: " These sequences can be used as a molecular anchor to select for a larger RNA with more extensive protein interactions, including the active site. One can also envision development of a heparin mimic that could be more specific for the ATIE-mediated inhibition of thrombin. It is clear from this work and related work that oligonucleotides have great potential as antithrombotic agents." | Minimum sequence requirements for high affinity binding derived from clone 16 (truncated) | 5' and 3' fixed regions differ than pool non-random regions.
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,055 | null | Tasset D | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7518917/ | Nucleic Acids Res | https://doi.org/10.1093/nar/22.13.2619 | Kubik, M. F., Stephens, A. W., Schneider, D., Marlar, R. A., & Tasset, D. (1994). High-affinity RNA ligands to human alpha-thrombin. Nucleic acids research, 22(13), 2619–2626. https://doi.org/10.1093/nar/22.13.2619 | ssRNA | 16.24 | α-Thrombin, Human | 5'UCCGGAUCGAAGUUAGUAGGCGGA3' | 24 | 0.541667 | Kd: 9.3 ± 1.0 nM | 9.3 | 5'-CCCGTCGACAAAGCTGTTTAGCTAC-N30-CAGCATGCTCGACAGGCATCT-3' | 30 | 50 mM Tris-HCl, pH 7.7, 100 mM NaCl, 1 mM DTT, and 1 mM MgCl2 | MgCl | Tris Buffers | 7.7 | Not reported | Therapeutic: " These sequences can be used as a molecular anchor to select for a larger RNA with more extensive protein interactions, including the active site. One can also envision development of a heparin mimic that could be more specific for the ATIE-mediated inhibition of thrombin. It is clear from this work and related work that oligonucleotides have great potential as antithrombotic agents." | Minimum sequence requirements for high affinity binding derived from clone 16 (truncated) | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,056 | null | Tasset D | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7518917/ | Nucleic Acids Res | https://doi.org/10.1093/nar/22.13.2619 | Kubik, M. F., Stephens, A. W., Schneider, D., Marlar, R. A., & Tasset, D. (1994). High-affinity RNA ligands to human alpha-thrombin. Nucleic acids research, 22(13), 2619–2626. https://doi.org/10.1093/nar/22.13.2619 | ssRNA | 27.33 | α-Thrombin, Human | 5'GAGCAUGCUGGUGCGGCUUUGGGCGCCGUGCUU3' | 33 | 0.666667 | Kd: 155 ± 9.0 nM | 155 | 5'-CCCGTCGACAAAGCTGTTTAGCTAC-N30-CAGCATGCTCGACAGGCATCT-3' | 30 | 50 mM Tris-HCl, pH 7.7, 100 mM NaCl, 1 mM DTT, and 1 mM MgCl2 | MgCl | Tris Buffers | 7.7 | Not reported | Therapeutic: " These sequences can be used as a molecular anchor to select for a larger RNA with more extensive protein interactions, including the active site. One can also envision development of a heparin mimic that could be more specific for the ATIE-mediated inhibition of thrombin. It is clear from this work and related work that oligonucleotides have great potential as antithrombotic agents." | Minimum sequence requirements for high affinity binding derived from clone 27 (truncated) | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,057 | null | Tasset D | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7508262/ | Biochemistry | https://doi.org/10.1021/bi00170a016 | Lorsch, J. R., & Szostak, J. W. (1994). In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry, 33(4), 973–982. https://doi.org/10.1021/bi00170a016 | ssRNA | DOPE. 40 | Cyanocobalamin (vitamin B12) | 5'GUCGGCCUAUCCGACAGGCACCGCGAGAGGACCAUUAUAGUGCGCAUAACCACUUCAGUGCGAGCAAAAAUUUGG3' | 75 | 0.533333 | Kd: 88 ± 19 nM | 88 | Original random pool: 5'-AACACTATCCGACTG-GCACC-N72-CCTTGGTCATTAGGATCC-3' (source --> Bartel, D. P., & Szostak, J. W. (1993) Science 261,1411-1418.)
mutagenized pool( 30% dopped pool): 5'-GGAACCTCTAGGTCATTA-GGAACACTATCCGACTGGCACCGCCAGCGGACAAATCCGGTGCGCATAACCACCTCAGTGCGAGCAACGATGGCC-ACGTCAGAAGGATCCAAG-3' (inside the dash are sequence of original aptamer B12.9) | 72 | 1 M LiCl, 5 mM MgCl2, and 25 mM HEPES (pH 7.4) | MgCl | Other Buffers | 7.4 | Not reported | Detection: " The aptamers we have selected may also serve as a starting point for the in vitro evolution of cobalamindependent ribozymes. A number of other biologically important reactions are carried out by cobalamin-dependent enzymes, including methyl group transfers, carbon skeletal rearrangements, and diol dehydrations" | DMS modification for probing the tertiary interaction in aptamer | Using a doped pool for the region inside the "- -", 32P-labeled RNA was used to follow all selections.
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
The total length of the pool RNA the paper mentioned "was 111 bases (including two new primer binding sites), with
75 mutagenized bases, and a sequence complexity of approximately 5 X 1014 molecules." However, it did not mentioed the sequence of the new primers
| 10,000,061 | null | Szostak JW | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7508262/ | Biochemistry | https://doi.org/10.1021/bi00170a016 | Lorsch, J. R., & Szostak, J. W. (1994). In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry, 33(4), 973–982. https://doi.org/10.1021/bi00170a016 | ssRNA | DOPE. 40 | Cobinamide dicyanide | 5'GUCGGCCUAUCCGACAGGCACCGCGAGAGGACCAUUAUAGUGCGCAUAACCACUUCAGUGCGAGCAAAAAUUUGG3' | 75 | 0.533333 | Kd: 20 ± 9 uM | 20,000 | Original random pool: 5'-AACACTATCCGACTG-GCACC-N72-CCTTGGTCATTAGGATCC-3' (source --> Bartel, D. P., & Szostak, J. W. (1993) Science 261,1411-1418.)
mutagenized pool( 30% dopped pool): 5'-GGAACCTCTAGGTCATTA-GGAACACTATCCGACTGGCACCGCCAGCGGACAAATCCGGTGCGCATAACCACCTCAGTGCGAGCAACGATGGCC-ACGTCAGAAGGATCCAAG-3' (inside the dash are sequence of original aptamer B12.9) | 72 | 1 M LiCl, 5 mM MgCl2, and 25 mM HEPES (pH 7.4) | MgCl | Other Buffers | 7.4 | Not reported | Detection: " The aptamers we have selected may also serve as a starting point for the in vitro evolution of cobalamindependent ribozymes. A number of other biologically important reactions are carried out by cobalamin-dependent enzymes, including methyl group transfers, carbon skeletal rearrangements, and diol dehydrations" | DMS modification for probing the tertiary interaction in aptamer | Using a doped pool for the region inside the "- -", 32P-labeled RNA was used to follow all selections.
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,061 | null | Szostak JW | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7508262/ | Biochemistry | https://doi.org/10.1021/bi00170a016 | Lorsch, J. R., & Szostak, J. W. (1994). In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry, 33(4), 973–982. https://doi.org/10.1021/bi00170a016 | ssRNA | B12.9 | Cobinamide dicyanide | 5'AACACUAUCCGACUGGCACCGCCAGCGGACAAAUCCGGUGCGCAUAACCACCUCAGUGCGAGCAACGAUGGCCUUUCUACCCAAAGAUUUUCCUUGGUCAUUAGGAUCC3' | 109 | 0.53211 | Kd: 8.8 ± 0.5 uM | 8,800 | Original random pool 5'-AACACTATCCGACTG-GCACC-N72-CCTTGGTCATTAGGATCC-3' (source --> Bartel, D. P., & Szostak, J. W. (1993) Science 261,1411-1418.) | 72 | 1 M LiCl, 5 mM MgCl2, and 25 mM HEPES (pH 7.4) | MgCl | Other Buffers | 7.4 | Not reported | Detection: " The aptamers we have selected may also serve as a starting point for the in vitro evolution of cobalamindependent ribozymes. A number of other biologically important reactions are carried out by cobalamin-dependent enzymes, including methyl group transfers, carbon skeletal rearrangements, and diol dehydrations" | DMS modification for probing the tertiary interaction in aptamer | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,062 | null | Szostak JW | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7508262/ | Biochemistry | https://doi.org/10.1021/bi00170a016 | Lorsch, J. R., & Szostak, J. W. (1994). In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry, 33(4), 973–982. https://doi.org/10.1021/bi00170a016 | ssRNA | B12.9 | Cyanocobalamin (vitamin B12) | 5'AACACUAUCCGACUGGCACCGCCAGCGGACAAAUCCGGUGCGCAUAACCACCUCAGUGCGAGCAACGAUGGCCUUUCUACCCAAAGAUUUUCCUUGGUCAUUAGGAUCC3' | 109 | 0.53211 | Kd: 320 ± 90 nM | 320 | Original random pool 5'-AACACTATCCGACTG-GCACC-N72-CCTTGGTCATTAGGATCC-3' (source --> Bartel, D. P., & Szostak, J. W. (1993) Science 261,1411-1418.) | 72 | 1 M LiCl, 5 mM MgCl2, and 25 mM HEPES (pH 7.4) | MgCl | Other Buffers | 7.4 | Not reported | Detection: " The aptamers we have selected may also serve as a starting point for the in vitro evolution of cobalamindependent ribozymes. A number of other biologically important reactions are carried out by cobalamin-dependent enzymes, including methyl group transfers, carbon skeletal rearrangements, and diol dehydrations" | DMS modification for probing the tertiary interaction in aptamer | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,062 | null | Szostak JW | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7508262/ | Biochemistry | https://doi.org/10.1021/bi00170a016 | Lorsch, J. R., & Szostak, J. W. (1994). In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry, 33(4), 973–982. https://doi.org/10.1021/bi00170a016 | ssRNA | 35-mer aptamer | Cyanocobalamin (vitamin B12) | 5'GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA3' | 35 | 0.6 | Kd: 88 ± 19 nM | 87 | Original random pool 5'-AACACTATCCGACTG-GCACC-N72-CCTTGGTCATTAGGATCC-3' (source --> Bartel, D. P., & Szostak, J. W. (1993) Science 261,1411-1418.) | 72 | 1 M LiCl, 5 mM MgCl2, and 25 mM HEPES (pH 7.4) | MgCl | Other Buffers | 7.4 | Not reported | Detection: " The aptamers we have selected may also serve as a starting point for the in vitro evolution of cobalamindependent ribozymes. A number of other biologically important reactions are carried out by cobalamin-dependent enzymes, including methyl group transfers, carbon skeletal rearrangements, and diol dehydrations" | DMS modification for probing the tertiary interaction in aptamer
Based on the sequence data from the mutagenized pool selection, a smaller aptamer (35 nucleotides long) was made by run-off transcription of a synthetic DNA oligonucleotide (Truncation/minimal sequence) | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,063 | null | Szostak JW | 5'rCprCprGprGprUprGprCprGprCprAprUprAprAprCprCprAprCprCprUprCprAprGprUprGprCprGprAprGprCprAprAprGprGprAprAp3'
https://www.aptagen.com/aptamer-details/?id=105 |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7508262/ | Biochemistry | https://doi.org/10.1021/bi00170a016 | Lorsch, J. R., & Szostak, J. W. (1994). In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry, 33(4), 973–982. https://doi.org/10.1021/bi00170a016 | ssRNA | 35-mer aptamer | Cobinamide dicyanide | 5'GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA3' | 35 | 0.6 | Kd: 19.7 ± 8.7 uM | 19,700 | Original random pool 5'-AACACTATCCGACTG-GCACC-N72-CCTTGGTCATTAGGATCC-3' (source --> Bartel, D. P., & Szostak, J. W. (1993) Science 261,1411-1418.) | 72 | 1 M LiCl, 5 mM MgCl2, and 25 mM HEPES (pH 7.4) | MgCl | Other Buffers | 7.4 | Not reported | Detection: " The aptamers we have selected may also serve as a starting point for the in vitro evolution of cobalamindependent ribozymes. A number of other biologically important reactions are carried out by cobalamin-dependent enzymes, including methyl group transfers, carbon skeletal rearrangements, and diol dehydrations" | DMS modification for probing the tertiary interaction in aptamer
Based on the sequence data from the mutagenized pool selection, a smaller aptamer (35 nucleotides long) was made by run-off transcription of a synthetic DNA oligonucleotide (Truncation/minimal sequence) | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,063 | null | Szostak JW | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7519769/ | Nucleic Acids Res | https://doi.org/10.1093/nar/22.14.2817 | Latham, J. A., Johnson, R., & Toole, J. J. (1994). The application of a modified nucleotide in aptamer selection: novel thrombin aptamers containing 5-(1-pentynyl)-2'-deoxyuridine. Nucleic acids research, 22(14), 2817–2822. https://doi.org/10.1093/nar/22.14.2817 | 5-uracil-modified-DNA | Clone 3 | Thrombin, Human | 5'TAGAATACTCAAGCTTCGACGCAGAXACAGGCCAXGXGCAGTTTGGATCCCCGGGTAC3' | 55 | 0.545455 | Kd: 800 nM | 800 | 5'-TAGAATACTCAAGCTTCGACG-N20-AGTTTGGATCCCCGGGTAC-3' | 20 | 20 mM Tris—acetate pH 7.4, 140 mM NaCl, 5 mM KC1, 1 mM MgCl2, 1 mM CaCl2 | MgCl/CaCl | Tris Buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that the incorporation of this hydrophobic group into the random oligonucleotide library signficantly alters the outcome of the selection process against human thrombin. The isolated aptamers display enrichment for molecules containing extensive substitution with this modified nucleotide. Binding and anticoagulant activity of the isolated aptamers are discussed." | Not applicable | X denotes pentynyl dU as determined via sequencing. 5-(1-pentynyl)-2'-deoxyuridine used instead of thymidine ("X" in sequences) it is also called 5-pentynyl-dU | 10,000,064 | null | Latham, J. A. | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7510417/ | Science | https://doi.org/10.1126/science.7510417 | Jenison, R. D., Gill, S. C., Pardi, A., & Polisky, B. (1994). High-resolution molecular discrimination by RNA. Science (New York, N.Y.), 263(5152), 1425–1429. https://doi.org/10.1126/science.7510417 | ssRNA | mTCT8-4 | Bronchodilator theophylline | 5'AGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACU3' | 38 | 0.526316 | Kd: 0.1 μM | 100 | Not reported (N40) | 40 | Sepharose column conditions: 60 mg of N-hydroxysuccinimide and 190 mg of 1 -ethyl-3,3-dimethylaminopropyl carbodiimide in a 5-mi 1:1 mixture of dioxane and phosphatebuffered saline (pH 7.2) | null | PBS/phosphate buffers | 7.2 | Not reported | Diagnostic: " One of the selected RNAs shows binding discrimination between theophylline and caffeine that is 10-fold better than that for available antibodies. In addition, this RNA possesses a binding affinity to theophylline over 100-fold greater than that to other oligonucleotides that have been selected to bind to small molecule targets. These results illustrate that small RNAs can display molecular recognition and specificity with extremely high resolution and illustrate the potential utility of oligonucleotides as diagnostic reagents." | 38-nucleotide truncated version of the TCT8-4 aptamer. | Alternative sequence report: (Nx)AUACCA(Nx)CCUUGG(C/A)AG(Nx) | 10,000,067 | null | Polisky, B | 5'rAprGprUprGprAprUprAprCprCprAprGprCprAprUprCprGprUprCprUprUprGprAprUprGprCprCprCprUprUprGprGprCprAprGprCprAprCprUp3
https://www.aptagen.com/aptamer-details/?id=150 |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7510417/ | Science | https://doi.org/10.1126/science.7510417 | Jenison, R. D., Gill, S. C., Pardi, A., & Polisky, B. (1994). High-resolution molecular discrimination by RNA. Science (New York, N.Y.), 263(5152), 1425–1429. https://doi.org/10.1126/science.7510417 | ssRNA | TCT8-4 | Bronchodilator theophylline | 5'AAGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACUUCA3' | 42 | 0.5 | Kd: 0.6 μM | 600 | Not reported (N40) | 40 | Sepharose column conditions: 60 mg of N-hydroxysuccinimide and 190 mg of 1 -ethyl-3,3-dimethylaminopropyl carbodiimide in a 5-mi 1:1 mixture of dioxane and phosphatebuffered saline (pH 7.2) | null | PBS/phosphate buffers | 7.2 | Not reported | Diagnostic: " One of the selected RNAs shows binding discrimination between theophylline and caffeine that is 10-fold better than that for available antibodies. In addition, this RNA possesses a binding affinity to theophylline over 100-fold greater than that to other oligonucleotides that have been selected to bind to small molecule targets. These results illustrate that small RNAs can display molecular recognition and specificity with extremely high resolution and illustrate the potential utility of oligonucleotides as diagnostic reagents." | Not applicable | Alternative sequence report: (Nx)AUACCA(Nx)CCUUGG(C/A)AG(Nx) | 10,000,068 | null | Polisky, B | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/10786843/ | RNA | https://doi.org/10.1021/ja00084a010 | Famulok, M. (1994). Molecular recognition of amino acids by RNA-aptamers: An L-citrulline binding RNA motif and its evolution into an L-arginine binder. Journal of the American Chemical Society, 116(5), 1698–1706. https://doi.org/10.1021/ja00084a010 | ssRNA | 44.Cit11 | L-citrulline [L-(+)-2-amino-5-ureidovaleric acid] | 5'GACGAGAAGGAGUGCUGGUUAUACUAGCGGUUAGGUCACUCGUC3'
| 44 | 0.522727 | Kd: 62-68 µM | 62,000 | 5'-GGAGCTCAGCCTTCACTGC-N74-GGCACCACGGTCGGATCC-3' | 74 | 250 mM NaCl; 50 mM Tris-HCl, pH = 7.6; 5 mM MgCl2 | MgCl | Tris Buffers | 7.6 | Not reported | Research: " We now report the isolation of RNAs able to bind the amino acid L-tyrosine+ The tyrosine aptamers were obtained by in vitro evolution of a previously selected dopamine aptamer. Tyrosine-binding sites are characterized by the presence of both tyrosine (UAU and UAC) and termination (UAG and UAA) triplets." | On the basis of the similarities of the individual sequences, a 44-mer RNA was constructed | extended descriptions of the aptamer structures can be found here: https://doi.org/10.1093/nar/23.23.4769
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,069 | null | Famulok, M | 5'rGprAprCprGprAprGprAprAprGprGprAprGprUprGprCprUprGprGprUprUprAprUprAprCprUprAprGprCprGprGprUprUprAprGprGprUprCprAprCprUprCprGprUprCp3'
https://www.aptagen.com/aptamer-details/?id=109 |
1,994 | https://pubmed.ncbi.nlm.nih.gov/10786843/ | RNA | https://doi.org/10.1021/ja00084a010 | Famulok, M. (1994). Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and Its Evolution into an L-Arginine Binder. Journal of the American Chemical Society, 116(5), 1698–1706. https://doi.org/10.1021/ja00084a010 | ssRNA | 44.Arg11 | L-arginine | 5'GACGAGAAGGAGCGCUGGUUCUACUAGCAGGUAGGUCACUCGUC3' | 44 | 0.568182 | Kd: 56-76 µM | 56,000 | 5'-GGAGCTCAGCCTTCACTGC-N74-GGCACCACGGTCGGATCC-3' | 74 | 250 mM NaCl; 50 mM Tris-HCl, pH = 7.6; 5 mM MgCl2 | MgCl | Tris Buffers | 7.6 | Not reported | Research: " We now report the isolation of RNAs able to bind the amino acid L-tyrosine+ The tyrosine aptamers were obtained by in vitro evolution of a previously selected dopamine aptamer. Tyrosine-binding sites are characterized by the presence of both tyrosine (UAU and UAC) and termination (UAG and UAA) triplets." | On the basis of the similarities of the individual sequences, a 44-mer RNA was constructed | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,070 | null | Famulok, M | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7528207/ | J Biol Chem | PMID: 7528207 | Conrad, R., Keranen, L. M., Ellington, A. D., & Newton, A. C. (1994). Isozyme-specific inhibition of protein kinase C by RNA aptamers. The Journal of biological chemistry, 269(51), 32051–32054. | ssRNA | Clone 6 | Protein kinase C beta II (protein kinase C βII) | 5'GGGAGAAUUCCGACCAGAGGCUUACAGAGUGUGCGUAAUGGCGUUCCCAAAUUCGGGCUGGGAACCGUUCGUUCGUGUUAUGCCCGUAGAUAUGGCAAGUCGCGGAUGCUCAGUACUACACUCUUGUGGUCAGUCACAUAUGUGCGUCUACAUGGAUCCUCA3' | 162 | 0.518519 | Kd: 7 nM | 7 | 5'-GGGAGAAUUCCGACCAGAGGCUU-N120-CAUAUGUGCGUCUACAUGGAUCCUCA-3' | 120 | 20 mM HEPES, pH 7.5, 10 mM MgCl,, 0.3 m~ CaCl,, 1 mM DTT, 0.05 m~ ATP | MgCl/CaCl | Other Buffers | 7.5 | Not reported | Detection: " This work opens the possibility that the substrate recognition properties conferred on most proteins by natural selection can be mimicked by artificial evolution and that new allosteric inhibitors and activators of enzymes may be found using in vitro selection. As a practical example, expression of these aptamers in cells should now allow inhibition of one specific protein kinase C isozyme, thus opening the possibility for dissecting the roles of protein kinase C isozymes in signal transduction." | Not applicable | Paper says RNA aptamers but reports the sequences in DNA so T's were changed to U's in the spreadsheet
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,071 | null | Newton AC | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7528207/ | J Biol Chem | PMID: 7528207 | Conrad R, Keranen LM, Ellington AD, Newton AC. Isozyme-specific inhibition of protein kinase C by RNA aptamers. J Biol Chem. 1994 Dec 23;269(51):32051-4. PMID: 7528207 | ssRNA | Clone 10 | Protein kinase C beta II (protein kinase C βII) | 5'GGGAGAAUUCCGACCAGAGGUUGUUAAGUGCGAGUUGUUUUACUCCGAUGAUACGGGGAGCGUUAGAGUCUUAUGACCUUGUUCUCCACGUCACUGUCCAAGUCACUCCGCGUCAUAGCAGUCGGAUCCUGUACAUAUGUGCGUCUACAUGGAUCCUCA3' | 159 | 0.496855 | Kd: 7 nM | 7 | 5'-GGGAGAAUUCCGACCAGAGGCUU-N120-CAUAUGUGCGUCUACAUGGAUCCUCA-3' | 120 | 20 mM HEPES, pH 7.5, 10 mM MgCl,, 0.3 m~ CaCl,, 1 mM DTT, 0.05 m~ ATP | MgCl/CaCl | Other Buffers | 7.5 | Not reported | Detection: " This work opens the possibility that the substrate recognition properties conferred on most proteins by natural selection can be mimicked by artificial evolution and that new allosteric inhibitors and activators of enzymes may be found using in vitro selection. As a practical example, expression of these aptamers in cells should now allow inhibition of one specific protein kinase C isozyme, thus opening the possibility for dissecting the roles of protein kinase C isozymes in signal transduction." | Not applicable | Paper says RNA aptamers but reports the sequences in DNA so T's were changed to U's in the spreadsheet
DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,072 | null | Newton AC | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 100 | Vascular Endothelial Growth Factor (VEGF) | 5'GGGAGCUCAGAAUAAACGCUCAACCGGUAGUCGCAUGGCCCAUCGCGCCCGGUUCGACAUGAGGCCCGGAUCCGGC3' | 76 | 0.644737 | Kd1: 0.20 ± 0.02 nM
Kd2: 42 ± 30 nM
| 0.2 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | null | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,073 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 100t | Vascular Endothelial Growth Factor (VEGF) | 5'GGCCGGUAGUCGCAUGGCCCAUCGCGCCCGG3' | 31 | 0.774194 | Kd1: 0.42 ± 0.04 nM
Kd2: 182 ±94 nM
| 0.42 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | Truncated | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,074 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 44t | Vascular Endothelial Growth Factor (VEGF) | 5'GGAAGCUUGAUGGGUGACACACGUCAUGCCGAGCU3' | 35 | 0.571429 | Kd1: 0.48 ± 0.04 nM
Kd2: 82 ± 23 nM | 0.48 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | Truncated | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,075 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 12t | Vascular Endothelial Growth Factor (VEGF) | 5'GGAAGGGAACCUGCGUCUCGGCACCUUCG3' | 29 | 0.655172 | Kd1: 1.1 ±0.2 nM
Kd2: 180 ± 160 nM | 1.1 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | Truncated | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,076 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 40t | Vascular Endothelial Growth Factor (VEGF) | 5'GGUCAACGGUUGAGUCUGUCCCGUUCGAC3' | 29 | 0.586207 | Kd1: 20 ± 1 nM
| 20 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | Truncated | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,077 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 84t | Vascular Endothelial Growth Factor (VEGF) | 5'GGCUCAAUAGUUGGAGGCCUGUCCUCGCCGUAGAGC3' | 36 | 0.611111 | Kd1:1.8 ±0.4 nM
Kd2: 31 ± 10 nM
| 1.8 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | Truncated | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,078 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 126t | Vascular Endothelial Growth Factor (VEGF) | 5'GGAACGGUUCUGUGUGUGGACUAGCCGCGGCCGUU3' | 35 | 0.628571 | Kd1: 1.4 ±0.2 nM
Kd2: 181 ± 57 nM | 1.4 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | Truncated | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,079 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 44 | Vascular Endothelial Growth Factor (VEGF) | 5'GGGAGCUCAGAAUAAACGCUCAAAGCUUGAUGGGUGACACACGUCAUGCCGAGCUUUUCGACAUGAGGCCCGGAUCCGGC3' | 80 | 0.5625 | Kd1: 1.7 ±0.5 nM
Kd2: 38 ±32 nM | 1.7 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | null | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,080 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 12 | Vascular Endothelial Growth Factor (VEGF) | 5'GGGAGCUCAGAAUAAACGCUCAAGCAGACGAAGGGAACCUGCGUCUCGGCACCUUCGACAUGAGGCCCGGAUCCGGC3' | 77 | 0.61039 | Kd1: 0.48 ± 0.07 nM
Kd2: 21 ±5 nM | 0.48 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | null | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,081 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 40 | Vascular Endothelial Growth Factor (VEGF) | 5'GGGAGCUCAGAAUAAACGCUCAAGCUUGAUGGGUGACACACGUCAUGCCGAGCUUCGACAUGAGGCCCGGAUCCGGC3' | 77 | 0.584416 | Kd1: 0.19 ±0.09 nM
Kd2: 10 ± 1 nM | 0.19 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | null | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,082 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 84 | Vascular Endothelial Growth Factor (VEGF) | 5'GGGAGCUCAGAAUAAACGCUCAAGCUCAAUAGUUGGAGGCCUGUCCUCGCCGUAGAGCGUUCGACAUGAGGCCCGGAUCCGGC3' | 83 | 0.590361 | Kd1: 0.82 ±0.2 nM
Kd2: 21 ± 5 nM | 0.82 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | null | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,083 | null | Janjić, N | null |
1,994 | https://pubmed.ncbi.nlm.nih.gov/7520755/ | Biochemistry | https://doi.org/10.1021/bi00200a028 | Jellinek, D., Green, L. S., Bell, C., & Janjić, N. (1994). Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry, 33(34), 10450–10456. https://doi.org/10.1021/bi00200a028 | ssRNA | 126 | Vascular Endothelial Growth Factor (VEGF) | 5'GGGAGCUCAGAAUAAACGCUCAAAACGGUUCUGUGUGUGGACUAGCCGCGGCCGUUUUCGACAUGAGGCCCGGAUCCGGC3' | 80 | 0.5875 | Kd1: 0.14 ±0.04 nM
Kd2: 11 ± 3 nM | 0.14 | 5'-GGGAGCUCAGAAUAAACGCUCAA-30N-UUCGACAUGAGGCCCGGAUCCGGC-3' | 30 | Phosphate-buffered saline (PBS =10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaCl, and 2.7 mM KC1, pH 7.4) | null | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " We demonstrate that these ligands inhibit the initiating step of VEGF signaling:bindingof the growth factor to specific cell-surface receptors.This observation is relevant in view of the recent finding that basic fibroblast growth factor and VEGF have a strong synergistic effect on the induction of angiogenesis in vitro (Pepper etal., 1992). Oligonucleotide_x0002_based compounds, or their mimetic analogs, clearly have the potential for becoming a new class of potent and specific inhibitors of pathological angiogenesis. Efforts aimed toward the development of therapeutic as well as diagnostic agents based on our findings are in progress" | null | Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RN A is assumed to be partitioned between two noninterconverting components (Ri and R2) that bind to VEGF with different affinities. R1 is associated with kd1, and R2 is associated with kd2 | 10,000,084 | null | Janjić, N | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7819261/ | Biochemistry | https://doi.org/10.1021/bi00002a033 | Huizenga, D. E., & Szostak, J. W. (1995). A DNA aptamer that binds adenosine and ATP. Biochemistry, 34(2), 656–665. https://doi.org/10.1021/bi00002a033 | ssDNA | DH25.42 | Adenosine and Adenosine Triphosphate (ATP) | 5'CCTGGGGGAGTATTGCGGAGGAAGG3' | 25 | 0.64 | Not reported | null | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCC -3' | 72 | 300 mM NaCl, 5 mM MgCl2, 20 mM Tris, pH 7.6 | MgCl | Tris Buffers | 7.6 | Not reported | Research: " The specificity of ATP binding exhibited by the DNA aptamer raises the possibility that some DNA sequences might be able to stabilize reaction transition states with respect to ground state structures and, thus, exhibit catalytic function. Furthermore, the RNA aptamer for ATP has been used as a starting point for the selection of ribozymes with polynucleotide kinase activity (Lorsch & Szostak, 1994b). Now that a DNA aptamer for ATP has been isolated, similar selections for catalytic DNAs can also be attempted" | To see if the conserved and covarying sequences were sufficient for ATP binding, a 25 base oligonucleotide (DH25.42; Figure 5 A) that contained only these regions was synthesized. When this oligonucleotide was assayed for ATP binding, greater then 90% of the DNA remained on the ATP-agarose column after washing with 10 column vol_x0002_umes of buffer and was specifically eluted by ATP | The pool of random-sequence RNA molecules that was used in this work has been previously described (Bartel & Szostak,1993).The mutagenized pool used in the secondary selection was based on the sequence 5'-GTGCTTGGGGGAGTATTGCGGAGGAAAGCGGCCCTGCTGAAG-3', flanked by the same primer binding sites as in the original random-sequence pool. | 10,000,085 | null | Szostak, J. W | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7819261/ | Biochemistry | https://doi.org/10.1021/bi00002a033 | Huizenga, D. E., & Szostak, J. W. (1995). A DNA aptamer that binds adenosine and ATP. Biochemistry, 34(2), 656–665. https://doi.org/10.1021/bi00002a033 | ssDNA | clone 16 | Adenosine and Adenosine Triphosphate (ATP) | 5'CTACCTGGGGGAGCATTGGGGAGGAAGGTAGCCGTGCGAAAA3' | 42 | 0.595238 | Kd: 6 ± 3 uM | 6,000 | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCC -3' | 72 | 300 mM NaCl, 5 mM MgCl2, 20 mM Tris, pH 7.6 | MgCl | Tris Buffers | 7.6 | Not reported | Research: " The specificity of ATP binding exhibited by the DNA aptamer raises the possibility that some DNA sequences might be able to stabilize reaction transition states with respect to ground state structures and, thus, exhibit catalytic function. Furthermore, the RNA aptamer for ATP has been used as a starting point for the selection of ribozymes with polynucleotide kinase activity (Lorsch & Szostak, 1994b). Now that a DNA aptamer for ATP has been isolated, similar selections for catalytic DNAs can also be attempted" | The binding domain of this aptamer was localized to a 42 base sequence by deletion analysis. (Truncation) | The pool of random-sequence RNA molecules that was used in this work has been previously described (Bartel & Szostak,1993).The mutagenized pool used in the secondary selection was based on the sequence 5'-GTGCTTGGGGGAGTATTGCGGAGGAAAGCGGCCCTGCTGAAG-3', flanked by the same primer binding sites as in the original random-sequence pool. | 10,000,086 | null | Szostak, J. W | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7542922/ | Biochemistry | https://doi.org/10.1021/bi00029a037 | Schneider, D. J., Feigon, J., Hostomsky, Z., & Gold, L. (1995). High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry, 34(29), 9599–9610. https://doi.org/10.1021/bi00029a037 | ssDNA | RT1 | Reverse Transcriptase of Type 1 Human Immunodeficiency Virus (HIV-1 RT) | 5'CCCCTGCAGGTGATTTTGCTCAAGTCAGAAGGATAAACTGTCCAGAACTTGGAATATATCAGTATCGCTAATCAGGCGGAT3' | 81 | 0.444444 | Kd: 1 nM; Ki: <0.3 nM | 1 | 5'-CCCCTGCAGGTGATTTTGCTCAAGT-N35-AGTATCGCTAATCAGGCGGAT-3' | 35 | 200 mM KOAc, 50 mM TrisHC1, pH 8.0, 6 mM MgCl2, and 10 mM DTT | MgCl | Tris Buffers | 8 | 66 kDa (p66) polypeptide chain complexed with a 51 kDa (p51) polypeptide chain for a total weight of 117 kDa | Therapeutic: " The importance of RT in the life cycle of HIV-1 and the lack of a natural function in the host cell make RT a preferred target for antiviral agents; high affinity and specificity for HIV-1 RT exhibited by the selected DNA ligands, along with their inhibitory effects, make them good candidates for structural investigations and potentially for therapeutic application" | Not applicable | null | 10,000,087 | null | Gold L | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7542922/ | Biochemistry | https://doi.org/10.1021/bi00029a037 | Schneider, D. J., Feigon, J., Hostomsky, Z., & Gold, L. (1995). High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry, 34(29), 9599–9610. https://doi.org/10.1021/bi00029a037 | ssDNA | RT1t49 | Reverse Transcriptase of Type 1 Human Immunodeficiency Virus (HIV-1 RT) | 5'CCCCTGCAGGTGATTTTGCTCAAGTCAGAAGGATAAACTGTCCAGAACTTGGA3' | 53 | 0.471698 | Kd: 4 nM; | 4 | 5'-CCCCTGCAGGTGATTTTGCTCAAGT-N35-AGTATCGCTAATCAGGCGGAT-3' | 35 | 200 mM KOAc, 50 mM TrisHC1, pH 8.0, 6 mM MgCl2, and 10 mM DTT | MgCl | Tris Buffers | 8 | 66 kDa (p66) polypeptide chain complexed with a 51 kDa (p51) polypeptide chain for a total weight of 117 kDa | Therapeutic: " The importance of RT in the life cycle of HIV-1 and the lack of a natural function in the host cell make RT a preferred target for antiviral agents; high affinity and specificity for HIV-1 RT exhibited by the selected DNA ligands, along with their inhibitory effects, make them good candidates for structural investigations and potentially for therapeutic application" | Truncated | null | 10,000,088 | null | Gold L | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7542922/ | Biochemistry | https://doi.org/10.1021/bi00029a037 | Schneider, D. J., Feigon, J., Hostomsky, Z., & Gold, L. (1995). High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry, 34(29), 9599–9610. https://doi.org/10.1021/bi00029a037 | ssDNA | RT4 | Reverse Transcriptase of Type 1 Human Immunodeficiency Virus (HIV-1 RT) | 5'CCCCTGCAGGTGATTTTGCTCAAGTTTAGCAAAGTTGAAGCCGGACTAACAAGCTCTACGAGTATCGCTAATCAGGCGGAT3' | 81 | 0.481481 | Kd: 8 nM; Ki: 4 nM | 8 | 5'-CCCCTGCAGGTGATTTTGCTCAAGT-N35-AGTATCGCTAATCAGGCGGAT-3' | 35 | 200 mM KOAc, 50 mM TrisHC1, pH 8.0, 6 mM MgCl2, and 10 mM DTT | MgCl | Tris Buffers | 8 | 66 kDa (p66) polypeptide chain complexed with a 51 kDa (p51) polypeptide chain for a total weight of 117 kDa | Therapeutic: " The importance of RT in the life cycle of HIV-1 and the lack of a natural function in the host cell make RT a preferred target for antiviral agents; high affinity and specificity for HIV-1 RT exhibited by the selected DNA ligands, along with their inhibitory effects, make them good candidates for structural investigations and potentially for therapeutic application" | Not applicable | null | 10,000,089 | null | Gold L | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7542922/ | Biochemistry | https://doi.org/10.1021/bi00029a037 | Schneider, D. J., Feigon, J., Hostomsky, Z., & Gold, L. (1995). High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry, 34(29), 9599–9610. https://doi.org/10.1021/bi00029a037 | ssDNA | RT6 | Reverse Transcriptase of Type 1 Human Immunodeficiency Virus (HIV-1 RT) | 5'CCCCTGCAGGTGATTTTGCTCAAGTCAGGCGTTAGGGAAGGGCGTCGAAAGCAGGGTGGGAGTATCGCTAATCAGGCGGAT3' | 81 | 0.567901 | Kd: 5 nM; Ki: 30 nM | 5 | 5'-CCCCTGCAGGTGATTTTGCTCAAGT-N35-AGTATCGCTAATCAGGCGGAT-3' | 35 | 200 mM KOAc, 50 mM TrisHC1, pH 8.0, 6 mM MgCl2, and 10 mM DTT | MgCl | Tris Buffers | 8 | 66 kDa (p66) polypeptide chain complexed with a 51 kDa (p51) polypeptide chain for a total weight of 117 kDa | Therapeutic: " The importance of RT in the life cycle of HIV-1 and the lack of a natural function in the host cell make RT a preferred target for antiviral agents; high affinity and specificity for HIV-1 RT exhibited by the selected DNA ligands, along with their inhibitory effects, make them good candidates for structural investigations and potentially for therapeutic application" | Not applicable | null | 10,000,090 | null | Gold L | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7542922/ | Biochemistry | https://doi.org/10.1021/bi00029a037 | Schneider, D. J., Feigon, J., Hostomsky, Z., & Gold, L. (1995). High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry, 34(29), 9599–9610. https://doi.org/10.1021/bi00029a037 | ssDNA | RT10 | Reverse Transcriptase of Type 1 Human Immunodeficiency Virus (HIV-1 RT) | 5'CCCCTGCAGGTGATTTTGCTCAAGTTATTTGCCCCTGCAGGCCGCAGGAGTGCTAGCAGTAGTATCGCTAATCAGGCGGAT3' | 81 | 0.54321 | Kd: 11 nM; Ki: 62 nM | 11 | 5'-CCCCTGCAGGTGATTTTGCTCAAGT-N35-AGTATCGCTAATCAGGCGGAT-3' | 35 | 200 mM KOAc, 50 mM TrisHC1, pH 8.0, 6 mM MgCl2, and 10 mM DTT | MgCl | Tris Buffers | 8 | 66 kDa (p66) polypeptide chain complexed with a 51 kDa (p51) polypeptide chain for a total weight of 117 kDa | Therapeutic: " The importance of RT in the life cycle of HIV-1 and the lack of a natural function in the host cell make RT a preferred target for antiviral agents; high affinity and specificity for HIV-1 RT exhibited by the selected DNA ligands, along with their inhibitory effects, make them good candidates for structural investigations and potentially for therapeutic application" | Not applicable | null | 10,000,092 | null | Gold L | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7542922/ | Biochemistry | https://doi.org/10.1021/bi00029a037 | Schneider, D. J., Feigon, J., Hostomsky, Z., & Gold, L. (1995). High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry, 34(29), 9599–9610. https://doi.org/10.1021/bi00029a037 | ssDNA | RT12 | Reverse Transcriptase of Type 1 Human Immunodeficiency Virus (HIV-1 RT) | 5'CCCCTGCAGGTGATTTTGCTCAAGTCGATTAGGTCCCCTGCCGCTAAACAGCGCCGCGGTAAGTATCGCTAATCAGGCGGAT3' | 82 | 0.560976 | Kd: 2 nM | 2 | 5'-CCCCTGCAGGTGATTTTGCTCAAGT-N35-AGTATCGCTAATCAGGCGGAT-3' | 35 | 200 mM KOAc, 50 mM TrisHC1, pH 8.0, 6 mM MgCl2, and 10 mM DTT | MgCl | Tris Buffers | 8 | 66 kDa (p66) polypeptide chain complexed with a 51 kDa (p51) polypeptide chain for a total weight of 117 kDa | Therapeutic: " The importance of RT in the life cycle of HIV-1 and the lack of a natural function in the host cell make RT a preferred target for antiviral agents; high affinity and specificity for HIV-1 RT exhibited by the selected DNA ligands, along with their inhibitory effects, make them good candidates for structural investigations and potentially for therapeutic application" | Not applicable | null | 10,000,093 | null | Gold L | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7542922/ | Biochemistry | https://doi.org/10.1021/bi00029a037 | Schneider, D. J., Feigon, J., Hostomsky, Z., & Gold, L. (1995). High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry, 34(29), 9599–9610. https://doi.org/10.1021/bi00029a037 | ssDNA | RT36 | Reverse Transcriptase of Type 1 Human Immunodeficiency Virus (HIV-1 RT) | 5'CCCCTGCAGGTGATTTTGCTCAAGTAAGCTCTTAGTTGATGCGCGGTCAAAATTTAAGCTAGTATCGCTAATCAGGCGGAT3' | 81 | 0.45679 | Kd: 4 nM; Ki: 6.5 nM | 4 | 5'-CCCCTGCAGGTGATTTTGCTCAAGT-N35-AGTATCGCTAATCAGGCGGAT-3' | 35 | 200 mM KOAc, 50 mM TrisHC1, pH 8.0, 6 mM MgCl2, and 10 mM DTT | MgCl | Tris Buffers | 8 | 66 kDa (p66) polypeptide chain complexed with a 51 kDa (p51) polypeptide chain for a total weight of 117 kDa | Therapeutic: " The importance of RT in the life cycle of HIV-1 and the lack of a natural function in the host cell make RT a preferred target for antiviral agents; high affinity and specificity for HIV-1 RT exhibited by the selected DNA ligands, along with their inhibitory effects, make them good candidates for structural investigations and potentially for therapeutic application" | Not applicable | null | 10,000,095 | null | Gold L | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/7489503/ | RNA | PMID: 7489503 or PMCID: PMC1369084 | Tian, Y., Adya, N., Wagner, S., Giam, C. Z., Green, M. R., & Ellington, A. D. (1995). Dissecting protein:protein interactions between transcription factors with an RNA aptamer. RNA (New York, N.Y.), 1(3), 317–326. | ssRNA | YT1 | Tax protein of the human T-cell lymphomatic virus (HTLV-1) | 5'GGGAGAAUUCCGACCAGAAGCUUGGACUUAUUCUCGAGCCUGCAUGUGCUAGUCGACGUUGUUUCUGCAUCUUGAAAGAUGGGGCUGUGGGUGUGGUUACUUCUACGCGGUAUGCACUGUACGCCCCAUAUGUGCGUCUACAUGGAUCCUCA3' | 152 | 0.513158 | Kd: 70 nM | 70 | 5'-GGGAGAATTCCGACCAGAAGCTT-N120-CATATGTGCGTCTACATGGATCCTCA-3' | 120 | 20 mM Tris x Cl, pH 7.9, 80 mM KCl, 10% glycerol, 1 mM MgCl2, 0.2 mM EDTA, 10 microM DTT, 0.5 mM PMSF) | MgCl | Tris Buffers | 7.9 | Not reported | Therapeutic: " In order to develop reagents that could also be used to study protein:protein interactions, we have used in vitro selection to search for RNA aptamers that could interact with the transactivating protein Tax from human T-cell leukemia virus. The differential effects of our aptamer probe on protein:protein interactions suggest a model for how the transcription factor binding sites on the surface of the Tax protein are organized." | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,096 | null | Ellington AD, adelling@ucs.indiana.edu | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/9383430/ | Chem Biol | https://doi.org/10.1016/1074-5521(95)90047-0 | Wang, Y., & Rando, R. R. (1995). Specific binding of aminoglycoside antibiotics to RNA. Chemistry & biology, 2(5), 281–290. https://doi.org/10.1016/1074-5521(95)90047-0 | ssRNA | X1 | Tobramycin | 5'GGGAGAAUUCCGACCAGAAGCUUCUGGUUAGUUUUGCACAGUGGUCGAUGCUAGACUUGGUUUAGGUAAUGAGUCCAAUAGUCCAUAUGUGCGUCUACAUGGAUCCUCA3' | 109 | 0.458716 | Kd: 3 ± 1 nM (high affinity component); 15.9 ± 0.7 µM (low affinity component) | 3 | 5'-GGGAGAAUUCCGACCAGAAGCUU-N60-CAUAUGUGCGUCUACAUGGAUCCUCA-3' | 60 | 140 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and 20 mM Tris acetate at pH 7.4 | MgCl/CaCl | Tris Buffers | 7.4 | Not reported | Therapeutic, Detection, and Research: "When coupled with the use of high-resolution NMR and X-ray spectroscopic studies, it ought to be possible to define the specific ways in which RNA molecules recognize aminoglycoside antibiotics.This information will be important in the design of novel molecules that will bind to and interfere with the function of specific RNA structures. Molecules of this type could be useful as paradigms for the design of novel drugs." | Not applicable | null | 10,000,098 | null | Rando, R. R. | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/9383430/ | Chem Biol | https://doi.org/10.1016/1074-5521(95)90047-0 | Wang, Y., & Rando, R. R. (1995). Specific binding of aminoglycoside antibiotics to RNA. Chemistry & biology, 2(5), 281–290. https://doi.org/10.1016/1074-5521(95)90047-0 | ssRNA | J6 | Tobramycin | 5'GGGAGAAUUCCGACCAGAAGCUUAGUAUAGCGAGGUUUAGCUACACUCGUGCUGAUCGUUUGGUACGGGACCUGCGUGUAGCCCAUAUGUGCGUCUACAUGGAUCCUCA3' | 109 | 0.513761 | Kd: 2 ± 1 nM (high affinity component); 6.0 ± 0.4 µM (low affinity component) | 2 | 5'-GGGAGAAUUCCGACCAGAAGCUU-N60-CAUAUGUGCGUCUACAUGGAUCCUCA-3' | 60 | 140 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and 20 mM Tris acetate at pH 7.4 | MgCl/CaCl | Tris Buffers | 7.4 | Not reported | Therapeutic, Detection, and Research: "When coupled with the use of high-resolution NMR and X-ray spectroscopic studies, it ought to be possible to define the specific ways in which RNA molecules recognize aminoglycoside antibiotics.This information will be important in the design of novel molecules that will bind to and interfere with the function of specific RNA structures. Molecules of this type could be useful as paradigms for the design of novel drugs." | Not applicable | null | 10,000,099 | null | Rando, R. R. | 5'rGprGprGprAprGprAprAprUprUprCprCprGprAprCprCprAprGprAprAprGprCprUprUprAprGprUprAprUprAprGprCprGprAprGprGprUprUprUprAprGprCprUprAprCprAprCprUprCprGprUprGprCprUprGprAprUprCprGprUprUprUprGprGprUprAprCprGprGprGprAprCprCprUprGprCprGprUprGprUprAprGprCprCprCprAprUprAprUprGprUprGprCprGprUprCprUprAprCprAprUprGprGprAprUprCprCprUprCprAp3'
https://www.aptagen.com/aptamer-details/?id=41 |
1,995 | https://pubmed.ncbi.nlm.nih.gov/8524793/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.92.25.11509 | Pan, W., Craven, R. C., Qiu, Q., Wilson, C. B., Wills, J. W., Golovine, S., & Wang, J. F. (1995). Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proceedings of the National Academy of Sciences of the United States of America, 92(25), 11509–11513. https://doi.org/10.1073/pnas.92.25.11509 | 2'-fluoro-RNA | B | Rous sarcoma virus (RSV) | 5'GGGAGCUCAGAAUAAACGCUCAAUGCCUCGUGUCGAAGAAGGGUGGCGCGAGGGUAGGGUUUCGACAUGAGGCCCGGAUCCGGC3' | 84 | 0.607143 | Kd: ~2-3 μg of viral protein per ml) | 2,000 | 5'-GCCGGATCCGGGCCTCATGTCGAA-N40-TTGAGCGTTTATTCTGAGCTCCC-3' | 40 | 2.5 mM MgCl2/100 mM NaCl/20 mM Tris HCl, pH 7.5 | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The selection of the anti-RSV RNA and RNA analogs by intact virions immediately suggests the potential application of this approach to develop RNA and RNA analogs as inhibitors of other viruses such as human immunodeficiency virus. Aptamers change the structures of viral surface proteins so that these proteins can no longer function in steps critical for viral infection, such as viral attachment and virus-cell membrane fusion. Alternatively, some of the structural changes may trigger pathways to inhibit the steps which normally occur after virus internalization, such as the uncoating and the expression of the virus genome." | Not applicable | 2'F-RNA: 2'-F-CTP and 2'-F-UTP replaced CTP and UTP. Transcribed a pool of 2'-F-RNA from unmodified RNA after 9 cycles of selection by RSV | 10,000,100 | null | Wang JF | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/8524793/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.92.25.11509 | Pan, W., Craven, R. C., Qiu, Q., Wilson, C. B., Wills, J. W., Golovine, S., & Wang, J. F. (1995). Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proceedings of the National Academy of Sciences of the United States of America, 92(25), 11509–11513. https://doi.org/10.1073/pnas.92.25.11509 | 2'-fluoro-RNA | E | Rous sarcoma virus (RSV) | 5'GGGAGCUCAGAAUAAACGCUCAAUGUAGUGAACAUUAAUGGAGAGAGGGAGGGUAGGGUUACGUUCGACAUGAGGCCCGGAUCCGGC3' | 87 | 0.528736 | Not reported | null | 5'-GCCGGATCCGGGCCTCATGTCGAA-N40-TTGAGCGTTTATTCTGAGCTCCC-3' | 40 | 2.5 mM MgCl2/100 mM NaCl/20 mM Tris HCl, pH 7.5 | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The selection of the anti-RSV RNA and RNA analogs by intact virions immediately suggests the potential application of this approach to develop RNA and RNA analogs as inhibitors of other viruses such as human immunodeficiency virus. Aptamers change the structures of viral surface proteins so that these proteins can no longer function in steps critical for viral infection, such as viral attachment and virus-cell membrane fusion. Alternatively, some of the structural changes may trigger pathways to inhibit the steps which normally occur after virus internalization, such as the uncoating and the expression of the virus genome." | Not applicable | 2'F-RNA: 2'-F-CTP and 2'-F-UTP replaced CTP and UTP. Transcribed a pool of 2'-F-RNA from unmodified RNA after 9 cycles of selection by RSV | 10,000,101 | null | Wang JF | null |
1,995 | https://pubmed.ncbi.nlm.nih.gov/8524793/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.92.25.11509 | Pan, W., Craven, R. C., Qiu, Q., Wilson, C. B., Wills, J. W., Golovine, S., & Wang, J. F. (1995). Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proceedings of the National Academy of Sciences of the United States of America, 92(25), 11509–11513. https://doi.org/10.1073/pnas.92.25.11509 | 2'-fluoro-RNA | F | Rous sarcoma virus (RSV) | 5'GGGAGCUCAGAAUAAACGCUCAAAUUGUCUUGAACCCGUGGGAGGUGUGAGGGUAGGGGUGGUUCGACAUGAGGCCCGGAUCCGGC3' | 86 | 0.581395 | Not reported | null | 5'-GCCGGATCCGGGCCTCATGTCGAA-N40-TTGAGCGTTTATTCTGAGCTCCC-3' | 40 | 2.5 mM MgCl2/100 mM NaCl/20 mM Tris HCl, pH 7.5 | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The selection of the anti-RSV RNA and RNA analogs by intact virions immediately suggests the potential application of this approach to develop RNA and RNA analogs as inhibitors of other viruses such as human immunodeficiency virus. Aptamers change the structures of viral surface proteins so that these proteins can no longer function in steps critical for viral infection, such as viral attachment and virus-cell membrane fusion. Alternatively, some of the structural changes may trigger pathways to inhibit the steps which normally occur after virus internalization, such as the uncoating and the expression of the virus genome." | Not applicable | 2'F-RNA: 2'-F-CTP and 2'-F-UTP replaced CTP and UTP. Transcribed a pool of 2'-F-RNA from unmodified RNA after 9 cycles of selection by RSV | 10,000,102 | null | Wang JF | null |
UT Aptamer Dataset
This is a collection of 1480 aptamer sequences from the University of Texas Aptamer Database as of 2023. This dataset is split into three subsets (train, test, and validation) based on clustering by CD-HIT.
Clustering
Clustering was conducting using the CD-HIT: Cluster Database at High Identity with Tolerance web browser using a 40% sequence identity threshold and word size of 2. To update this dataset with new reported aptamers, splits can be determined by re-clustering.
Quickstart Usage
Install HuggingFace Datasets package
Each subset can be loaded into python using the HuggingFace datasets library. First, from the command line install the datasets library
$ pip install datasets
Optionally set the cache directory, e.g.
$ HF_HOME=${HOME}/.cache/huggingface/
$ export HF_HOME
then, from within python load the datasets library
import datasets
Load model datasets
To load one of the UTexasAptamer model datasets, use datasets.load_dataset(...):
dataset = datasets.load_dataset(f"kysie/UTexasAptamer", "train")
and the dataset is loaded as a datasets.arrow_dataset.Dataset
>>> print(dataset)
DatasetDict({
train: Dataset({
features: ['Year of Paper', 'Link to PubMed Entry', 'Journals', 'Journal DOI', 'Citation', 'Type of Nucleic Acid', 'Name of Aptamer', 'Target', 'Aptamer Sequence', 'Sequence Length', 'GC Content', 'Affinity', 'Kd (nM)', 'Pool Type', 'Pool Random Region', 'Binding Buffer/Conditions', 'Divalent Salt', 'Type of the buffer', 'pH', 'Molecular weight of target', 'Application as quoted in the referenced paper', 'Post-selex modification to the aptamer', 'Additional Information', 'Serial Number', 'Parent sequence serial number', 'Corresponding Author Name, email address', 'Aptagen Cross Referencing(Check Aptamer Chemistry, Affinity, Length, GC content, sequence)'],
num_rows: 1262
})
test: Dataset({
features: ['Year of Paper', 'Link to PubMed Entry', 'Journals', 'Journal DOI', 'Citation', 'Type of Nucleic Acid', 'Name of Aptamer', 'Target', 'Aptamer Sequence', 'Sequence Length', 'GC Content', 'Affinity', 'Kd (nM)', 'Pool Type', 'Pool Random Region', 'Binding Buffer/Conditions', 'Divalent Salt', 'Type of the buffer', 'pH', 'Molecular weight of target', 'Application as quoted in the referenced paper', 'Post-selex modification to the aptamer', 'Additional Information', 'Serial Number', 'Parent sequence serial number', 'Corresponding Author Name, email address', 'Aptagen Cross Referencing(Check Aptamer Chemistry, Affinity, Length, GC content, sequence)'],
num_rows: 154
})
validation: Dataset({
features: ['Year of Paper', 'Link to PubMed Entry', 'Journals', 'Journal DOI', 'Citation', 'Type of Nucleic Acid', 'Name of Aptamer', 'Target', 'Aptamer Sequence', 'Sequence Length', 'GC Content', 'Affinity', 'Kd (nM)', 'Pool Type', 'Pool Random Region', 'Binding Buffer/Conditions', 'Divalent Salt', 'Type of the buffer', 'pH', 'Molecular weight of target', 'Application as quoted in the referenced paper', 'Post-selex modification to the aptamer', 'Additional Information', 'Serial Number', 'Parent sequence serial number', 'Corresponding Author Name, email address', 'Aptagen Cross Referencing(Check Aptamer Chemistry, Affinity, Length, GC content, sequence)'],
num_rows: 64
})
})
which is a column oriented format that can be accessed directly, converted in to a pandas.DataFrame, or parquet format, e.g.
dataset.data.column('<COLUMN NAME IN DATASET>')
dataset.to_pandas()
dataset.to_parquet("dataset.parquet")
Curation Rationale
This dataset has the potential for training models related to aptamer sequence and binding relationships, including prediction of binding affinities and design of aptamers.
Dataset Sources
- Repository: https://zenodo.org/records/8387047
- Paper: Ali Askari, Sumedha Kota, Hailey Ferrell, Shriya Swamy, Kayla S Goodman, Christine C Okoro, Isaiah C Spruell Crenshaw, Daniela K Hernandez, Taylor E Oliphant, Akshata A Badrayani, Andrew D Ellington, Gwendolyn M Stovall, UTexas Aptamer Database: the collection and long-term preservation of aptamer sequence information, Nucleic Acids Research, Volume 52, Issue D1, 5 January 2024, Pages D351–D359, https://doi.org/10.1093/nar/gkad959
Dataset Card Authors
- Katie Sie katiesie/@/uw.edu
Acknowledgements
Askari, Ali; Kota, Sumedha; Ferrell, Hailey; Swamy, Shriya; Goodman, Kayla S.; Okoro, Christine C.; Spruell Crenshaw, Isaiah C.; Hernandez, Daniela K.; Oliphant, Taylor E.; Badrayani, Akshata A.; Ellington, Andrew D.; Stovall, Gwendolyn M.1
Citation
@article{Askari2023,
title = {UTexas Aptamer Database: the collection and long-term preservation of aptamer sequence information},
volume = {52},
ISSN = {1362-4962},
url = {http://dx.doi.org/10.1093/nar/gkad959},
DOI = {10.1093/nar/gkad959},
number = {D1},
journal = {Nucleic Acids Research},
publisher = {Oxford University Press (OUP)},
author = {Askari, Ali and Kota, Sumedha and Ferrell, Hailey and Swamy, Shriya and Goodman, Kayla S and Okoro, Christine C and Spruell Crenshaw, Isaiah C and Hernandez, Daniela K and Oliphant, Taylor E and Badrayani, Akshata A and Ellington, Andrew D and Stovall, Gwendolyn M},
year = {2023},
month = oct,
pages = {D351–D359}
}
License
Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/)
- Downloads last month
- 40